Dunaliella salina nuclear-plasm dual expression system as well as establishment method and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a dunaliella salina nuclear-cytoplasm dual expression system as well as an establishment method and application thereof. The system comprises a donor expression cassette and a ribonucleoprotein complex, the donor expression cassette and the ribonucleoprotein complex are jointly or successively introduced into dunaliella salina cells for gene knockout, or fixed-point insertion of exogenous genes is performed by using a homologous recombination or non-homologous end connection method; the donor expression box comprises a cell nucleus donor expression box and a chloroplast donor expression box; the chloroplast donor expression cassette comprises a homologous arm derived from a dunaliella salina chloroplast genome; the nuclear donor expression cassette comprises a homologous arm derived from a dunaliella salina nuclear genome. The system provided by the invention can be used for improving dunaliella salina genome level characters, and a recombinant algal strain obtained by utilizing the system can be used as a medicine for preventing and treating diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a salt algae nuclear-cytoplasmic dual expression system and an establishment method and application thereof. Background Art

[0002] Salt algae have many natural advantages: (1) It is a single-celled organism and can be used as a model organism, which is conducive to transformation. As a photosynthetic autotrophic algae, it can be quickly and conveniently cultured and can be cultivated on a large scale; (2) Due to the lack of cell walls, it is a natural protoplast and can be easily transformed with exogenous genes; in addition, it has a chloroplast system and a nuclear system, which can be used as an efficient expression system for recombinant protein production; (3) Salt algae are eukaryotic organisms and have the ability to modify proteins at the transcription and translation levels, so they can produce crude proteins with high biological activity. (4) Salt algae are highly adaptable to the environment and can grow in various salt concentrations from 0.2% to salt saturation. This characteristic can avoid contamination by other microorganisms. (5) It contains rich nutrients and can be used to produce high value-added products and is widely used in industry and pharmaceutical fields.

[0003] In view of the above advantages of Dunaliella itself, it has a bright application prospect when developed as a new expression system. However, the expression of exogenous genes in Dunaliella is mainly reporter genes and selection marker genes. When Dunaliella is used as a host for expression and production of proteins with practical value, only hepatitis B surface antigen, human vascular inhibitor canstatin, soybean trypsin inhibitor and shrimp white spot syndrome virus VP28 have been measured. Most of these proteins only show low expression in the nuclear transformation of Dunaliella cells, and a mature and stable expression system has not yet been formed.

[0004] The chlorophyll transformation system has the following characteristics: ① Small genome; ② Overexpression of exogenous genes; Since there are multiple copies of DNA molecules in chloroplasts, and chloroplasts are in a relatively isolated state in cells, they have a strong tolerance for the accumulation of expression products. The accumulation of target gene products will not have a significant impact on the normal function of cells, thus providing a guarantee for the large-scale expression of exogenous genes in chloroplasts. For exogenous genes of great value from prokaryotes, they can be efficiently expressed in chloroplasts without transformation and modification, which is impossible for nuclear gene transformation. ④ It is conducive to simultaneous multi-gene transformation; in the chloroplast genome, many genes with similar functions are aggregated together and share the same promoter to form polycistronic. This structure provides feasibility for the simultaneous expression of multiple exogenous genes under the regulation of the same promoter. Many products and important traits are often the product of the joint action of multiple genes, and it is difficult to achieve ideal results by transferring only a single gene. ⑤ Homogenization is relatively simple; the mesophyll cells of higher plants contain multiple chloroplasts, and each chloroplast contains multiple copies of the genome; the mesophyll cells of higher plants contain multiple chloroplasts, and each chloroplast contains multiple copies of the genome. Chloroplast expression of exogenous proteins has been explored in other microalgae, and the accumulation of exogenous recombinant proteins can reach 1% to 10% of the total protein, and the highest record can even be as high as 21%. However, there are no active exogenous proteins in salt algae, which is related to many factors, such as unclear genetic information, precise insertion of recombination sites, species codon preference, feedback inhibition of expression products, selection of appropriate regulatory elements, degradation of exogenous proteins by endogenous proteases, etc. Traditional transgenic technology has the problem of low integration efficiency.

[0005] Gene editing is a technology that can precisely modify DNA sequences at the genomic level. Since its emergence, it has been favored by scientists, especially the third-generation gene editing technology: CRISPR / Cas technology, which recognizes target sites through sgRNA, Cas proteins mediate site-specific blunt-end double-stranded DNA breaks, and the host initiates repair mechanisms to repair them to achieve gene knockout or insertion. At present, CRISPR / Cas technology has successfully achieved single and multiple gene knockout and insertion in Chlamydomonas reinhardtii, Chlorella vulgaris, and Nannochloropsis salina through different forms of gene editing. Dunaliella has broad prospects as an expression system, but the expression types and contents of exogenous proteins are limited. At present, it is mainly concentrated in the nuclear expression system, and the chloroplast system of Dunaliella, which accounts for a large volume of Dunaliella, has not been developed, and CRISPR / Cas gene editing tools provide a good opportunity. The selection of expression elements is also an important factor influencing the construction of suitable transformation vectors and the expression of exogenous proteins. In order to enable efficient expression of exogenous genes after integration into the chloroplast genome, promoters and terminators from chloroplasts are generally selected when constructing transformation vectors.

[0006] Therefore, a new salt algae nuclear-cytoplasmic dual expression system is urgently needed to solve the problems of low expression efficiency and instability of the existing salt algae expression system. Summary of the invention

[0007] In order to solve the problem of low expression efficiency and instability in the existing salt algae expression system, the present invention provides a salt algae nuclear-cytoplasmic dual expression system and its establishment method and application. The present invention provides a method for achieving salt algae nuclear-cytoplasmic co-expression while performing precise gene editing based on CRISPR / Cas technology.

[0008] To achieve the above object, the present invention adopts the following technical solution: The present invention provides a salt algae nuclear-cytoplasmic dual expression system, comprising a donor expression box and a ribonucleoprotein complex; The donor expression cassette includes a cell nucleus donor expression cassette and a chloroplast donor expression cassette.

[0009] The chloroplast donor expression cassette includes homology arms derived from the chloroplast genome of Dunaliella, including a left homology arm I and a right homology arm I; the nucleotide sequence of the left homology arm I is shown in SEQ ID NO.1, and the nucleotide sequence of the right homology arm I is shown in SEQ ID NO.2.

[0010] The cell nucleus donor expression box includes homology arms derived from the nuclear genome of Dunaliella, including a left homology arm II and a right homology arm II; the nucleotide sequence of the left homology arm II is shown in SEQ ID NO.3, and the nucleotide sequence of the right homology arm II is shown in SEQ ID NO.4.

[0011] The donor expression box and the ribonucleoprotein complex are introduced into Dunaliella cells together or successively to perform gene knockout, or the foreign gene is inserted at a specific site by using homologous recombination or non-homologous end connection.

[0012] Wherein, the sequence of SEQ ID NO.1 is as follows: TACTGTATGGACTGATGGTCTTACAAGTTTAGACAAATACAAAGGTCGTTGTTACGACCTTGAACCAGTGCCCGGTGAAGAAAATCAATATATCGCATATGTAGCGTACCCAATCGACCTTTTTGAGGAAGGTTCAGTAACAAACTTATTCACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCATTACGTCTTGAAGATCTTCGTATTTCACCAGCTTATGTTAAAACATTCGTTGGACCACCTCATGGTATTCAAGTTGAGCGTGACAAATTAAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGACGTGCTGTTTACGAATGTTTACGTGGTGGATTAGACTTTACCAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACTGGTGAAATTAAAGGTCACTACTTAAACGCTACAGCAGGTACTGCTGAAGGAATGCT。

[0013] The sequence of SEQ ID NO.2 is as follows: TCAACGTGCACAATGTGCTAAAGAGTTAGGTGTACCTATTATTATGCATGACTACTTAACAGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACACATTCACCGTGCGATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAACTTTACGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTAGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGATTTAATGCGTGATAACTTCGTAGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTCGGTGATGACGCATGTTTACAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCAGGTGCTGTTGCTAACCGTGTTGCATTAGAGGCTTGTACACAAGCTCGTAACGAAGGACGTGACCTTGCTCGTGAAGGTGGTAACGTAATCCGTTCAGCTTGTAAATGGTCTCCTGAATTAGCAGCTGCTTGTGAAGTTTGGAAAGAAATTAAATTCGAATTCGATACAGTTGATAAATTATAA。

[0014] The sequence of SEQ ID NO.3 is as follows: GACCTGAGCCGAGCTCGAGAGCAAGGCACAACAACGACCGCAAATGCTCAGACGCAGCAACAAGCCGAGGCGCCCTTGCAGCCCAGTCCAGCAGTGATGGAGAGGAGGCAGCAGCGTCAAAGGTGTGTGAGTGTAGCAAGGGCCGAGCAGTACCTTGGGTGGGAGGATTGGGCGGTAGGGGCGTGTGGTATGCTTGAGTTGGCGTCCAGAAAGCCACCAGTTGTGCCAGCCTCGCACATCCCCGTGCCAAAAGTGGCCACCACTCCAGCATGCACCTTTAACACCAGAGAGCCACGCACCCAGGCTGTGCTCAGCTCAAAAGGCAGGCAGGTGCTGTGAGGGGGGTTGGTGGGGCTGCGGCTGCAAGGAGTTGTGGCTTACACCGGAGGTTACACACGCATGCAAACGAGCGAGTCTGGCACCCTCATCAGCAGTTTAATTGAGTCAACTACTGATTTTCCTCTCTGCTTTCCTCGCCCCCATTGTTTCAGCAGTGTTTGACTTTCTTTTCCAGCAGTGTGCATGCCATGATGTTAGAATTAGTGAGGTCAGGCAGCTCAGCCCATCCGTGCCCTAGACACACCATTTTTGCCCCTGTGTCCATTTTCACAACAGGGAGCAGCAATTTTACAAGCTGGCTGCTGTGGCTGCCTCCTTGGGTGTCAGTGGGTTAGCCATCCTTGCCACCTACCTGCGTTTCTACTGGCACCTGCGG。

[0015] The sequence of SEQ ID NO.4 is as follows: .

[0016] The present invention uses CRISPR / Cas technology to allow more accurate integration of exogenous genes into the nucleoplasmic genes of Dunaliella, while making the expression of the Dunaliella expression system more stable and more efficient. Compared with the traditional technology based on plasmid transformation, the gene editing method based on CRISPR / Cas technology of the present invention has higher editing efficiency, greater flexibility and higher accuracy. In particular, when constructing the Dunaliella expression system, precise editing of specific sites can be achieved, solving the problem of low expression efficiency and instability in the existing Dunaliella expression system.

[0017] 10. Preferably, the chloroplast donor expression cassette comprises a promoter element, a foreign gene, a chloroplast signal peptide and a terminator, and the promoter element, the foreign gene, the chloroplast signal peptide and the terminator are connected in sequence.

[0018] The promoter element includes a light-sensitive promoter element or a temperature-sensitive promoter element, wherein the light-sensitive promoter element includes LIP; and the temperature-sensitive promoter element includes HSP70A.

[0019] The chloroplast donor expression cassette further comprises at least one of a left homology arm I and a right homology arm I; wherein the left homology arm I is connected to the promoter element, and the right homology arm I is connected to the terminator.

[0020] Preferably, the cell nucleus donor expression cassette comprises 3, a promoter element, a screening gene element, a nuclear localization sequence and a terminator, and the promoter element, the screening gene element, the nuclear localization sequence and the terminator are connected in sequence.

[0021] The promoter element includes a light-sensitive promoter element or a temperature-sensitive promoter element, wherein the light-sensitive promoter element includes LIP; and the temperature-sensitive promoter element includes HSP70A.

[0022] The cell nucleus donor expression cassette further includes at least one of a left homology arm II and a right homology arm II; wherein the left homology arm II is connected to the promoter element, and the right homology arm II is connected to the terminator.

[0023] Preferably, the ribonucleoprotein complex comprises a Cas protein and a corresponding form of sgRNA.

[0024] Preferably, the Cas protein includes proteins that play a nuclease-related role in the CRISPR / Cas system of Cas9, Cas12 and Cas13; the sgRNA refers to RNA that plays a positioning role in the ribonucleoprotein complex.

[0025] The present invention also provides an application of the salt algae nuclear-cytoplasmic dual expression system in the transformation of salt algae chloroplasts and cell nuclei.

[0026] Preferably, the photothermal effect and NLS are used to regulate the expression of exogenous proteins in the nucleus of Dunaliella cells, or the photothermal effect and chloroplast signal peptide are used to regulate the expression of exogenous proteins in Dunaliella chloroplasts.

[0027] The present invention also provides a method for establishing the salt algae nuclear-cytoplasmic dual expression system, using the salt algae nuclear-cytoplasmic dual expression system to introduce the exogenous gene into salt algae cells, and obtain double-mutant dual-expression stable salt algae through culture and screening.

[0028] The present invention also provides a double-mutation double-expression stable Dunaliella strain obtained by utilizing the method for establishing the Dunaliella nuclear-cytoplasmic dual expression system.

[0029] The present invention also provides the use of the double-mutation double-expression stable Dunaliella strain in preparing products for preventing or treating white spot syndrome virus infection, wherein the products include drugs and vaccines.

[0030] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a salt algae nuclear-cytoplasmic dual expression system, which is a nuclear and chloroplast dual expression system with the advantage of efficient expression of exogenous genes. The present invention uses CRISPR / Cas technology to allow more accurate integration of exogenous genes into salt algae nuclear and cytoplasmic genes, while making the expression of the salt algae expression system more stable and more efficient. Compared with traditional technologies based on plasmid transformation, the gene editing method based on CRISPR / Cas technology of the present invention has higher editing efficiency, greater flexibility, and higher accuracy. In particular, when constructing a salt algae expression system, precise editing of specific sites can be achieved, solving the problem of low expression efficiency and instability in existing salt algae expression systems.

[0031] 2. The present invention first utilizes the efficient and specific gene editing capabilities of CRISPR / Cas technology, and utilizes the DNA self-repair mechanism to obtain (by means of non-homologous end joining or homologous recombination, etc.) to accurately insert the nuclear genes and chloroplast genes of salt algae. Compared with the traditional transgenic technology that uses random integration, the salt algae nuclear-cytoplasmic dual expression system provided by the present invention uses the CRISPR / Cas gene editing method when it is established. This method is not prone to the loss of inserted exogenous genes after passage. At the same time, since the present invention uses the light-sensitive promoter (LIP) and temperature-sensitive promoter (HSP70A) of salt algae itself to express exogenous genes, it can achieve the regulation of exogenous protein expression by photothermal effect and specific high expression.

[0032] 3. The present invention utilizes a novel salt algae bioreactor as an expression vector to obtain transgenic algae strains, which can be used for the prevention and treatment of diseases without the need for processing and purification. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is a schematic diagram of the homologous recombination expression element in the present invention, wherein: Figure 1 Figure A is a schematic diagram of homologous recombination expression elements in the nucleus of Dunaliella; Figure 1 Figure B is a schematic diagram of chloroplast homologous recombination expression elements.

[0034] Figure 2 This is a plate screening diagram in the present invention, wherein: Figure 2 Figure A in the figure is a plate screening diagram of Dunaliella nuclear mutant strains; Figure 2 Figure B is a plate screening diagram of Dunaliella chloroplast mutants.

[0035] Figure 3 This is the result of the plate screening of double mutants in the present invention.

[0036] Figure 4 It is the cumulative mortality rate of shrimps after being fed with oral live vaccines in the present invention.

[0037] Figure 5 It is the cumulative mortality rate of shrimps after the recombinant algae strains in the present invention are processed and fed to shrimps.

[0038] Figure 6 The Western Blot method in the present invention detects the expression of exogenous genes.

[0039] Figure 7 The cell morphology of wild salt algae under a microscope and salt algae under different treatment conditions in the present invention (magnification 40×). DETAILED DESCRIPTION

[0040] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0041] The experimental materials, reagents and equipment used in the following examples are as follows: D. salina strain CCAP19 / 18 was purchased from Wenzhou Guangyu Biotechnology Co., Ltd., China.

[0042] The pKSE401 plasmid was purchased from Addgene.

[0043] T7 in vitro transcription kit was purchased from New England Biolabs.

[0044] Cas9 protein was purchased from Bioss.

[0045] PMD18 plasmid was purchased from Addgene.

[0046] The pT3TS-nCas9n plasmid was purchased from Addgene.

[0047] Example 1: Obtaining a recombinant algae strain with a cell nucleus This example takes the Dunaliella nucleus (phosphoenolpyruvate carboxylase PEPC- plays a negative regulatory role in glycerol synthesis Gen Bank: DI341471.1) gene as an example to perform site-directed mutagenesis and / or (bar) gene insertion, which is further described in detail below.

[0048] (1) Amplify the target sequences of nuclear and chloroplast target genes and design and synthesize the corresponding sgRNA The salt algae were cultured in a modified PKS medium, with a light intensity of 4000 Lux, a light cycle of 12 / 12 h, a culture room temperature of 26 ° C, static culture, and shaking once in the morning and evening every day. The salt algae cells grown to the logarithmic phase were centrifuged at 2000 rpm for 2 min to precipitate the salt algae, and then the salt algae genomic DNA was extracted using the following method.

[0049] ① Take 2 mL of Dunaliella cells, centrifuge at 10,000 g for 1 min, remove the supernatant, add 200 mL of GA buffer to the precipitate, and gently shake to make it evenly suspended.

[0050] ② Add 20L of Proteinase K solution and mix well. Add 200L of GB buffer and mix thoroughly, then incubate at 70℃ for 10min.

[0051] ③ Add 200 μL of anhydrous ethanol, shake thoroughly for 15 seconds, and centrifuge briefly.

[0052] ④ Transfer the mixed solution to the adsorption column, centrifuge at 12,000 mmp for 30 seconds, and discard the waste liquid.

[0053] ⑤Inject 500 μL of GD buffer into the adsorption column, centrifuge and discard the waste liquid.

[0054] ⑥ Add 600 mL of PW washing solution to the adsorption column, repeat the centrifugation step, discard the waste liquid, and place the adsorption column in the collection tube. This step needs to be repeated once.

[0055] ⑦ Centrifuge at 12,000 rpm for 2 min and dry the adsorption column at room temperature for 5 min.

[0056] ⑧ Transfer the adsorption column to a new tube, add 100% enzyme-free water, let stand at room temperature for 5 minutes, centrifuge and collect the sample. NanoDrop spectrometer is used to measure the sample concentration.

[0057] Using Dunaliella salina genomic DNA as a template, primers Nuclear-F and Nuclear-R were used to amplify the gene sequence of the nuclear gene phosphoenolpyruvate carboxylase PEPC (Gen Bank: DI341471.1), and the target sequence fragment size was 722bp. sgRNA targets were designed online. The designed targets were sgRNA1 and sgRNA2, and sgRNA was synthesized by in vitro transcription.

[0058] Wherein, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO.5: CGCGGATGACACTTCACGCCTGG.

[0059] The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.6: TTATCCTCTTGAGGCCCACATGG.

[0060] The specific steps of transcription are as follows: design two forward primers NsgRNA1-F and NsgRNA2-F primer sequences, use pKSE401 plasmid as template, and perform PCR amplification with common primer Common-R. PCR amplification reaction conditions are: 98°C for 30 seconds; 35 cycles including 98°C for 5 seconds, 60°C for 10 seconds, 72°C for 5 seconds; 72°C for 5 minutes. PCR amplification uses high-fidelity enzymes, and PCR products are purified using the following method.

[0061] ① Add 500 μL of balancing solution BL to the adsorption column CB2, centrifuge at 12,000 rpm for 1 min, remove the supernatant, and place the adsorption column CB2 back into the collection tube.

[0062] ② Add 5 times the volume of binding solution PB to the PCR reaction mixture and mix well.

[0063] ③ Transfer the mixture to the adsorption column, let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 60 seconds, discard the supernatant, and put the adsorption column back into the collection tube.

[0064] ④ Add 600 μL of washing solution PW to the adsorption column, centrifuge at 12,000 rpm for 60 seconds, and discard the supernatant. This step needs to be repeated once.

[0065] ⑤Put the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min, and dry at room temperature for 5 min.

[0066] ⑥ Use a new centrifuge tube, add 50 μL of enzyme-free water, let it stand at room temperature for 2 minutes, centrifuge to collect the DNA solution, and measure its concentration.

[0067] Using the purified PCR product as a template, sgRNA was transcribed using a T7 in vitro transcription kit, and RNA was purified according to the instructions of the RNA purification kit.

[0068] The formula of PKS medium is shown in Table 1 below.

[0069] Table 1 PKS medium composition The primers and their sequences used in the above steps are shown in Table 2.

[0070] Table 2 Primer names and sequences (2) RNP formation and construction of donor template DNA The Cas9 protein and the above sgRNA were incubated at 37°C for 30 minutes in a mass ratio of 1:1 to form an RNP complex. At the same time, the present invention first designed a donor with a homologous sequence to the Dunaliella genome and a screening marker gene. The transformed donor DNA sequence was a linear double-stranded DNA. The homologous sequence was divided into a left homologous arm (L-arm) and a right homologous arm (R-arm). The screening gene was connected at the junction of the two homologous arms. bar expression elements. According to the principle of homologous recombination, foreign genes can be completely inserted into the genome sequence. The corresponding expression elements were amplified from the genome and plasmid of Dunaliella, and the homologous arm sequences were inserted into the PMD18 plasmid using a seamless cloning kit to construct the intermediate plasmid pMD-HR. The amplified expression elements were also used to construct the corresponding intermediate plasmid, and finally inserted into the middle position of the two homologous arms of the pMD-HR plasmid to construct the final plasmid pMD-LTR. PCR amplification was performed using the final plasmid pMD-LTR as a template to obtain a linear double-stranded donor DNA.

[0071] (3) Transformation of Dunaliella and Screening for Mutant Strain In order to evaluate the targeting efficiency, the cells were first divided into three groups: a blank control group without transfection, a group transfected with only the genome of the targeting donor, and an experimental group transfected with a mixture of the above RNP complex and donor DNA.

[0072] Different samples were added to 300 μL conductivity buffer in a fixed ratio. After gently mixing with a pipette, the mixture was quickly poured into a 2 mm electroporation cup and precooled on ice for 15 min. Next, an electroporator was used for electroporation, and two electroporations were performed. The capacitance was set to 25 μF, the resistance was set to 200 Ω, and the voltage was set to 200 V. Finally, the loading efficiency was determined. After transformation, phosphinothricin (PPT) was used to screen positive single algae colonies, and some single algae colonies were taken, marked, and PCR amplification of the target site was performed. After the PCR amplification product was purified, the target fragment was cloned into T vector. After transformation, several monoclonal colonies were selected for sequencing analysis. At the same time, the remaining part of the positive single algae colony was inoculated into PKS medium for expansion culture for subsequent use.

[0073] The purification conditions of CR amplification products are shown in Figure 2 .

[0074] (4) Results analysis ① Identification of CRISPR / Cas9 targeting efficiency: This technology designed sgRNAs for target genes in the nucleus and chloroplasts of Dunaliella, respectively, and determined the targeting efficiency of the CRISPR / Cas9 system through TA cloning. The results showed that among 10 monoclonal algae colonies, 5 had Dunaliella growth.

[0075] The above results show that among the 10 selected monoclonal algal colonies, 5 mutations occurred, and the targeting efficiency was about 50%.

[0076] ② Detect the site-specific integration of the donor: The specific operation is: electroporate the RNP complex and the donor containing the homology arm of the target site to transform the salt algae cells, and use the screening gene to obtain a single algae colony. The results of the resistance gene screening are shown in Figure 2 A in Figure 1. Then, a pair of PCR primers were designed at the 5' and 3' ends of the sequence of phosphoenolpyruvate carboxylase PEPC after site-directed integration. The upstream of the 5' PCR amplification primer was located on the genome of Dunaliella, and the downstream of the 5' PCR amplification primer was located on the donor, spanning the left and right homologous arms; the upstream of the 3' PCR amplification primer was located on the donor, and the downstream of the 3' PCR amplification primer was located on the genome of Dunaliella, spanning the left and right homologous arms. The results of PCR were analyzed by agarose gel electrophoresis, and the PCR products showed obvious bands on the gel.

[0077] The above results show that the target fragment can be amplified by transfecting the RNP complex and the donor genome containing the target site homology arm at the same time, indicating that the donor has been integrated at the designated site, while the blank control group and the genome of the donor transfected with the target only cannot amplify the target band. The results of further TA cloning sequencing analysis show that the target fragment was detected at 10%, indicating that the efficiency of CRISPR / Cas9-mediated homologous recombination site integration is about 10%. At the same time, RT-PCR and western blot (steps as follows) can detect the expression of exogenous genes, indicating that the exogenous genes have been successfully inserted into the genome of Dunaliella.

[0078] Among them, the steps of western blot are as follows: ① Detect according to the BCA protein quantification kit, add 200uL / well of the working solution to a 96-well plate, and then add the standard solution.

[0079] ②Mix well, incubate at 37℃ for 30min, measure the absorbance at 560nm, and draw a standard curve to calculate the protein concentration.

[0080] ③The diluted protein sample was denatured at high temperature by heating at 100°C for 10 min and vortex centrifuging.

[0081] ④ Gel preparation: Prepare separation gel and concentrated gel according to the instructions, and pull out the upper concentrated gel after it solidifies.

[0082] ⑤ Loading: Add about 10ug of protein sample to each well, and add 2.5uL of Marker to the left and right edges of the sample.

[0083] ⑥ Electrophoresis: 80V voltage makes the sample flow into the separation gel, change the voltage to 120V and run the gel to the lowest 1 / 5, then turn off the power.

[0084] ⑦ Transfer: Use wet transfer method, current 200mA in ice bath, transfer for 2h.

[0085] ⑧Blocking: Add 5% skim milk blocking solution to the PVDF membrane and block it on a shaker at room temperature for 1 hour.

[0086] ⑨Primary antibody incubation: dilute the corresponding primary antibody with blocking solution, add 500u1 primary antibody, and incubate at 4°C overnight.

[0087] ⑩ Secondary antibody incubation: Wash the membrane 4 times with TBST, 10 min each time, add diluted secondary antibody, and incubate at room temperature for 1 h.

[0088] ⑪ Development and analysis: Wash the membrane 4 times with TBST, 10 min each time, develop and analyze using Image J software.

[0089] Example 2: Obtaining chloroplast recombinant algae strains This example is to perform site-directed mutagenesis and / or (bar) gene insertion in the intron (NC_016732.1) of the chloroplast ATP synthase α gene of Dunaliella salina for the purpose of site-directed mutagenesis and / or (bar) gene insertion, which will be further described in detail below.

[0090] (1) Amplify the target sequence of the chloroplast target gene and design and synthesize the corresponding sgRNA Dunaliella was cultured under the same conditions as in Example 1, and the genomic DNA of Dunaliella was obtained by the same method. Using the genomic DNA of Dunaliella as a template, the target sequence was amplified using primers: Plastid-F and Plastid-R for the intron sequence of the Dunaliella chloroplast gene ATP synthase α gene atpA (GeneID: 11541759), and the target sequence fragment size was 1706bp. The sgRNA target was designed online, which was sgRNA1':; sgRNA2'. The sgRNA was synthesized by in vitro transcription. The specific steps are as follows: a forward primer PsgRNA1-F and PsgRNA2-F were designed, and PCR amplification was performed using the pKSE401 plasmid as a template and the universal primer Common-R.

[0091] Wherein, the nucleotide sequence of sgRNA1' is shown in SEQ ID NO.12: GCCGGTCTTACGGACGGTGATGG.

[0092] The nucleotide sequence of sgRNA2' is shown in SEQ ID NO.13: 'TTCTCAAATAAGTGGTGTAGAGG.

[0093] The nucleotide sequence of Common-R is shown in SEQ ID NO.11: 5′-AAAAGCACCGACTCGGTGCC-3′.

[0094] The PCR reaction conditions were: 98°C for 30 seconds; 35 cycles including 98°C for 5 seconds, 60°C for 10 seconds, and 72°C for 5 seconds; 72°C for 5 minutes. High-fidelity enzymes were used for PCR amplification (same as in Example 1), and the PCR products were purified by conventional methods (same as in Example 1). The purified PCR products were used as templates, and sgRNA was transcribed using a T7 in vitro transcription kit, and purified using an RNA purification kit.

[0095] The primers and their sequences used in the above steps are shown in Table 3.

[0096] Table 3 Primer names and sequences (2) The method of forming RNP, constructing donor template DNA, transforming Dunaliella and screening to obtain recombinant algae strains is the same as in Example 1. The results are shown in Figure 2 Figure B in .

[0097] The results showed that the targeting efficiency was about 50%, and the efficiency of CRISPR / Cas9-mediated homologous recombination site-specific integration was about 10%.

[0098] Example 3: Obtaining double mutant strains The complex of Example 2 was added to the nucleus targeting complex of Dunaliella in Example 1 for electroporation transformation; the mutant strains were obtained by screening for gene resistance. The results of the screening are shown in Figure 3 We detected and determined the recombination efficiency through site-specific integration and detected the expression of exogenous genes through western blot and microscopy. The results are as follows: Figure 6 and Figure 7 shown.

[0099] Figure 6 and Figure 7 The results showed that among the 10 monoclonal colonies selected by the present invention, 5 mutations occurred, and the targeting efficiency was about 50%. The efficiency of site-directed integration of recombination was about 10%, and the expression of exogenous genes could be detected by RT-PCR and western blot.

[0100] Example 4: Application of RNA-based Crispr / Cas system In this example, the RNA-based CRISPR / Cas system is used to edit the genes of the nucleus and chloroplast system of Dunaliella salina. Except for the form and source of the Cas9 protein, the other steps are the same as those of Example 1. The specific steps are as follows:

[0101] (1) Synthesis of Cas9 mRNA The pT3TS-nCas9n plasmid was digested with endonuclease XbaI and purified to obtain a linearized plasmid; the linearized plasmid was used as a template for in vitro transcription with T3 polymerase to produce capped Cas9 mRNA and purify the Cas9 mRNA. The purification method was the same as in Example 1.

[0102] (2) Cas9 mRNA, sgRNA, and donor were mixed by electroporation to obtain a mixture, wherein the final concentrations of Cas9 mRNA, sgRNA, and donor were 500 ng / μL, 500 ng / μL, and 10 μM, respectively. Primers were designed to PCR amplify the genomic fragment containing the target site, and the PCR reaction conditions were: 94°C for 3 minutes; 45 cycles including 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds; 72°C for 5 minutes. For the PCR product of the point mutation experiment, PCR amplified the target gene fragment, and Taq polymerase was used to add A to the 3' end of the PCR product. Through T / A pairing, the PCR product was directly connected to the T-vector and the ligated product was transformed into bacteria. 15 monoclonal bacteria were randomly selected and sent to Shanghai Biotech Sequencing Co., Ltd. for purification and sequencing. Among them, the donor was synthesized according to the method of step 3 of Example 1.

[0103] (3) Result verification: In order to verify the occurrence of point mutations or insertions at the target site, resistance screening was performed, and the results were as follows Figure 3 As shown. The expected homologous recombination repair results were detected, and point mutations or foreign sequence insertions were obtained. Figure 3 It can be seen that the experimental group was sequenced and the mutation efficiency and mutation sequence in step 3) designed in Example 1 were consistent.

[0104] The above results illustrate that the method for exogenous gene insertion using homologous recombination mediated by the CRISPR / Cas technology provided by the present invention can produce site-directed mutagenesis or insertion, that is, the method provided by the present invention can achieve site-directed target gene modification and expression of exogenous proteins.

[0105] Example 5: Effect of light intensity on exogenous gene expression In order to explore the effect of light intensity on the expression of exogenous genes, we cultured the transfected Dunaliella cells under different light intensities. The specific research is as follows:

[0106] Effect of light intensity on the expression of exogenous proteins: 10 mL of sample was taken from the recombinant algae strain containing a photosensitive promoter (the acquisition method was the same as in Example 1) during the logarithmic growth period and placed under different light conditions: 2000 Lux, 4000 Lux, 6000 Lux, and 8000 Lux. A blank group was set up, and 10 mL of sample was taken at 1W, 2W, 3W, and 4W to extract RNA (using an RNA extraction kit) and protein, and RT-qPCR and western blot were performed (same as in Example 1) to detect the expression of exogenous genes.

[0107] Among them, the blank group is 4000Lux.

[0108] The results showed that the cell density of Dunaliella was positively correlated with light intensity and had a good linear relationship.

[0109] The above results show that the stronger the light intensity, the more exogenous protein is expressed.

[0110] Example 6: Use of recombinant algae as a drug to resist WSSV infection In order to illustrate the effect of the nuclear-cytoplasmic dual expression system of Dunaliella provided by the present invention, we took the recombinant algae strain obtained in Example 3 as an example and conducted the following research.

[0111] 1. Prevention and treatment We used the method in Example 3 to knock in WSSV envelope proteins VP19 and VP28 to obtain recombinant algae cells, collected the algae cells by centrifugation, freeze-dried them, and packaged them under sterile conditions to prepare them into oral live vaccines. Then, the prepared oral live vaccine was fed to shrimp bodies to identify its immune protection. The specific research is as follows:

[0112] The recombinant algae strain and the wild salt algae strain in the logarithmic growth phase of Example 3 were taken respectively, and centrifuged at 3000 rpm for 5 min to collect the recombinant algae strain and the wild salt algae strain. The wild salt algae cells were added to the shrimp feed at a mass ratio of 5% to prepare a granular feed containing wild salt algae cells for feeding. The inactivated WSSV was prepared at a mass ratio of 5% to prepare a feed containing WSSV for feeding. The recombinant algae strain was prepared at a mass ratio of 5% to prepare a feed containing recombinant algae cells.

[0113] The white shrimps with an average weight of 1.5 g were randomly divided into four groups: Group A, Group B, Group C and Group D, with 100 shrimps in each group and three replicates in each group. Group A, Group B, Group C and Group D were cultured 20 days after the challenge, and the immunization method was as follows, and the number and time of shrimp deaths were recorded respectively.

[0114] Group A: blank control group, fed with normal shrimp feed without Dunaliella cells. Feed was given three times a day, and the feed amount was 4% of the shrimp body weight.

[0115] Group B: Negative control group, fed with 10g feed containing wild Dunaliella cells once every two days, and normal feed at other times, three times a day.

[0116] Group C: positive control group, fed with normal shrimp feed, 10g of feed wrapped with wild Dunaliella cells once every two days, and normal feed at other times, three times a day. After 10 days of culture, a challenge experiment was conducted, that is, feed wrapped with WSSV once, and then normal feed was fed, three times a day.

[0117] Group D: Sample experimental group, fed with 10g of feed wrapped with recombinant algae cells once every two days, and normal feed was fed at other times, three times a day. After 10 days of cultivation, feed wrapped with WSSV was fed once, and then normal feed was fed, three times a day.

[0118] Among them, the source of the whiteleg shrimp is Shanghai Ocean University.

[0119] The source / formula composition of shrimp feed is 20% fish meal, 16.8% red fish meal, 6% silkworm pupa powder, 3% shrimp shell powder, 2% squid powder, 24% soybean meal, 5% bran, 18.6% flour, 0.3% salt, 1% fish oil, 1% phospholipids, 2% monocalcium phosphate, 0.1% high-vitamin for shrimp, 0.1% mycochloridian multi-mineral, and 0.1% compound probiotics.

[0120] The source of wild algae strains is Wenzhou Guangyu Biotechnology Co., Ltd. in China.

[0121] Survival analysis was performed on the four groups of Penaeus vannamei, and the results are shown in Figure 4 .

[0122] Depend on Figure 4 It can be seen that no white shrimp died in the blank control group and the negative control group, the cumulative mortality of white shrimp in the positive control group reached 100%, and the cumulative mortality of white shrimp in the sample experimental group was about 12%, indicating that the effective protection efficiency of the recombinant algae cells as a vaccine reached 88%, which significantly improved the ability to resist the infectivity of WSSV.

[0123] 2. Immune protection experiment We used the recombinant algae cells obtained by the method in Example 3, knocked in the anti-WSSV drug gene fragment, and prepared the recombinant algae cells into oral live vaccine anti-WSSV drugs. Then, the prepared anti-WSSV drugs were fed to shrimp bodies to identify their immune protection. The specific research is as follows:

[0124] The anti-WSSV drug recombinant algae strain in the logarithmic growth phase in Example 3 and an equal amount of wild Dunaliella cells were respectively taken, and the mixture was centrifuged at 3000 rpm for 5 min. After the anti-WSSV drug recombinant algae strain and wild Dunaliella cells were collected, they were crushed by an ultrasonic crusher (250 W, 25 kHz, 7 s on / 10 s off, 50 cycles) to obtain lysed anti-WSSV drug recombinant Dunaliella cells and lysed wild Dunaliella cells, respectively.

[0125] The lysed Dunaliella cells were added to the aquaculture water at a ratio of 7% of the volume of the aquaculture water. The culture of the white shrimp was carried out in a laboratory culture box with a volume of 50 cm 3 , each soaking time is 10h, and then the aquaculture water is completely renewed. The immune effect is determined according to the following groups. The white shrimp with an average weight of 1.5g are randomly divided into four groups: Group A, Group B, Group C and Group D, with 100 shrimps in each group and three replicates in each group. Group A, Group B, Group C and Group D are subjected to the challenge experiment (same conditions as above) and cultured for 20 days, and the number and time of shrimp deaths are recorded respectively.

[0126] Group A: blank control group, fed with normal shrimp feed without Dunaliella cells. Feed was given three times a day, and the feed amount was 3-5% of the shrimp body weight.

[0127] Group B: Negative control group, 50 mL of lysed wild-type Dunaliella cells were added to the aquaculture water once every 4 days, for a total of two immunizations, and no challenge experiment was performed.

[0128] Group C: positive control group, 50 mL of lysed wild-type Dunaliella cells were added to the culture water once every 4 days, for a total of two immunizations. On the 9th day of culture, the fish were fed with feed containing WSSV for three times, and then fed with normal feed.

[0129] Group D: Sample experimental group, 50 mL of lysed transgenic Dunaliella cells were added to the culture water once every 4 days, for a total of two immunizations. On the 9th day of culture, feed containing WSSV was fed three times, and then normal feed was fed.

[0130] The survival rate of the four groups of Penaeus vannamei was analyzed. Figure 5 .

[0131] Depend on Figure 5It can be seen that the immune protection experiment of shrimp bodies was carried out by immersion method using the lysed transgenic salt algae cells. The results showed that no shrimp bodies of whiteleg shrimp died in the blank control group and the negative control group, the cumulative mortality rate of whiteleg shrimp in the positive control group reached 100%, and the cumulative mortality rate of whiteleg shrimp in the sample experimental group was about 23%, indicating that the effective protection efficiency of transgenic salt algae cells as anti-WSSV drugs is about 77%.

[0132] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0133] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0134] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A nuclear-cytoplasmic dual expression system of Dunaliella, characterized in that: including a donor expression cassette and a ribonucleoprotein complex; The donor expression cassette includes a cell nucleus donor expression cassette and a chloroplast donor expression cassette; The chloroplast donor expression cassette includes homology arms derived from the chloroplast genome of Dunaliella, including a left homology arm I and a right homology arm I; the nucleotide sequence of the left homology arm I is shown in SEQ ID NO.1, and the nucleotide sequence of the right homology arm I is shown in SEQ ID NO.2; The cell nucleus donor expression cassette includes homology arms derived from the nuclear genome of Dunaliella salina, including a left homology arm II and a right homology arm II; the nucleotide sequence of the left homology arm II is shown in SEQ ID NO.3, and the nucleotide sequence of the right homology arm II is shown in SEQ ID NO.4; The donor expression box and the ribonucleoprotein complex are introduced into Dunaliella cells together or successively to perform gene knockout, or the foreign gene is inserted at a specific site by using homologous recombination or non-homologous end connection.

2. The nuclear-cytoplasmic dual expression system of Dunaliella salina according to claim 1, characterized in that: The chloroplast donor expression box includes a promoter element, a foreign gene, a chloroplast signal peptide and a terminator, and the promoter element, the foreign gene, the chloroplast signal peptide and the terminator are connected in sequence; The promoter element includes a light-sensitive promoter element or a temperature-sensitive promoter element; The chloroplast donor expression cassette also includes at least one of the left homology arm I and the right homology arm I; wherein the left homology arm I is connected to the promoter element, and the right homology arm I is connected to the terminator.

3. The nuclear-cytoplasmic dual expression system of Dunaliella salina according to claim 1, characterized in that: The cell nucleus donor expression cassette comprises a promoter element, a screening gene element, a nuclear localization sequence and a terminator, and the promoter element, the screening gene element, the nuclear localization sequence and the terminator are connected in sequence; The promoter element includes a light-sensitive promoter element or a temperature-sensitive promoter element; The cell nucleus donor expression cassette further comprises at least one of the left homology arm II and the right homology arm II; wherein the left homology arm II is connected to the promoter element, and the right homology arm II is connected to the terminator.

4. The nuclear-cytoplasmic dual expression system of Dunaliella salina according to claim 1, characterized in that: The ribonucleoprotein complex includes a Cas protein and a corresponding form of sgRNA.

5. The nuclear-cytoplasmic dual expression system of Dunaliella salina according to claim 4, characterized in that: The Cas proteins include proteins that play a nuclease-related role in the CRISPR / Cas system of Cas9, Cas12 and Cas13; the sgRNA refers to RNA that plays a positioning role in the ribonucleoprotein complex.

6. Use of the Dunaliella nuclear-cytoplasmic dual expression system according to claim 1 in the transformation of Dunaliella chloroplasts and cell nuclei.

7. The use according to claim 6, characterized in that: The photothermal effect and nuclear localization sequence are used to regulate the expression of exogenous proteins in the nucleus of Dunaliella cells, or the photothermal effect and chloroplast signal peptide are used to regulate the expression of exogenous proteins in Dunaliella chloroplasts.

8. The method for establishing a nuclear-cytoplasmic dual expression system of Dunaliella according to claim 1, characterized in that: The exogenous gene is introduced into the salt algae cells by using the salt algae nuclear-cytoplasmic dual expression system, and double-mutant and double-expression stable salt algae are obtained through culture and screening.

9. A double-mutant and double-expression stable Dunaliella strain obtained by using the method for establishing a Dunaliella nuclear-cytoplasmic dual expression system according to claim 8.

10. Use of the double mutant and double expression stable Dunaliella strain according to claim 9 in the preparation of a product for preventing and / or treating white spot syndrome virus disease, characterized in that: The products include medicines and vaccines.

Images