Efficient kiwi fruit genetic transformation method based on agrobacterium rhizogenes

Abstract

The invention is applicable to the technical field of plant genetic engineering, and provides an efficient kiwi fruit genetic transformation method based on agrobacterium rhizogenes, which comprises the steps of vector construction, agrobacterium transformation, transformation and co-culture, rooting induction, callus induction, plant regeneration and root regeneration. According to the method provided by the invention, the genetic transformation efficiency of the kiwi fruits can be remarkably improved, and the genetic transformation period can be shortened. Besides, by optimizing the composition and content of plant hormones in a culture medium in each step, the concentration of a bacterial solution and a leaf treatment mode, the purposes of shortening the period and improving the efficiency can be achieved, and the method is an ideal efficient genetic transformation method for the kiwi fruits.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a high-efficiency genetic transformation method of kiwifruit based on Agrobacterium rhizogenes. Background Art

[0002] Kiwifruit is widely popular for its rich vitamin C content and balanced nutritional ingredients, including dietary fiber, multiple minerals and other beneficial metabolites. Kiwifruit not only has a unique flavor, but also has many health benefits, such as promoting immune function, improving digestive system and metabolic health, and even has potential anti-cancer effects, so it is deeply loved by consumers. Given its species diversity and good domestication potential, research on the functional genes and functional genomics of kiwifruit has developed extensively.

[0003] To conduct gene function research, it is necessary to create corresponding genetic materials, such as mutants and overexpression strains; then genetic transformation is the bottleneck problem in the creation of genetic materials in kiwifruit function research. Developing an efficient and rapid transformation identification system is a key step to accelerate kiwifruit gene function research and variety improvement. The use of Agrobacterium-mediated transformation methods is an effective way to achieve this goal. The application of modern biotechnology has made it possible for kiwifruit to improve its varieties, fortify its nutrition, enhance its resistance to stress and diseases, and extend its shelf life. The current research focus is to achieve the directed breeding and optimization of kiwifruit through genetic engineering. Agrobacterium ( Agrobacterium ) is a common soil Gram-negative bacterium, among which Agrobacterium tumefaciens ( A. tumefaciens ) and Agrobacterium rhizogenes ( A. rhizogenes ) are the two most commonly used types. Agrobacterium-mediated genetic transformation is a natural plant gene transformation system that can integrate the target gene inserted in the modified T-DNA region into the plant genome through the infection process of Agrobacterium, and obtain transgenic plants with the help of tissue culture technology. At present, the most mature and widely used transformation method for kiwifruit is the leaf disc transformation mediated by Agrobacterium tumefaciens EHA105. In this process, Agrobacterium invades the cells through the wound of the leaf disc, and the T-DNA region is released from the Ti plasmid and integrated into the plant genome. Subsequently, callus formation is induced by antibiotic selection pressure, and transgenic kiwifruit plants are obtained through the regeneration step. Although this method is stable and reliable, it has a long cycle, requires continuous selection pressure, and has a low positive rate. Therefore, establishing an efficient and rapid genetic transformation identification system is of great value and significance for molecular biology research, gene editing exploration and breeding improvement of kiwifruit. Summary of the invention

[0004] The purpose of the embodiments of the present invention is to provide a method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes, aiming to solve the problems raised in the background technology.

[0005] In view of the above problems, the embodiment of the present invention is implemented as follows: a method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes, which includes vector construction, Agrobacterium transformation, transformation and co-cultivation, root induction, callus induction, plant regeneration and root regeneration steps, specifically including the following steps: Constructing overexpression vectors; The overexpression vector was mixed with competent cells of Agrobacterium rhizogenes, transformed by freeze-thaw method, and cultured on TY solid medium; a single clone was picked and cultured with TY liquid medium, and then the bacterial suspension was aspirated and spread on TY solid medium containing acetosyringone for culture; The cultured plate is resuspended and washed with a first buffer, and then resuspended and diluted with a second buffer to obtain a bacterial suspension; The sterile kiwifruit young leaves were placed in the above bacterial suspension for shaking culture, and then the bacterial suspension was removed, the residual bacterial liquid on the surface of the leaf disc was dried, and then the leaves were spread on the CM1 culture medium and placed in the dark for co-culture; After the co-cultivation, the leaf disc was placed in sterilized ultrapure water for cleaning, and then the residual liquid in the leaf disc was dried and spread on RM2 medium for cultivation; After the hair roots grow out, cut them off and place them in CM3 culture medium for cultivation; After the callus expands, the callus tissue is placed in RM4 medium for culture; After the plants are regenerated, the regenerated plants are placed in RM5 medium for culture to obtain transgenic plants.

[0006] Preferably, the Agrobacterium rhizogenes is Agrobacterium rhizogenes K599 strain.

[0007] Preferably, the TY solid culture medium and the TY liquid culture medium both contain 40-60 μg / L kanamycin and 40-60 μg / L streptomycin.

[0008] Preferably, the first buffer comprises MgSO4 and 40-60 μM acetosyringone; the second buffer comprises 1 / 4 MS, 8-12 g / L sucrose, 40-60 μM acetosyringone, and 0.004%-0.006% Silwet L-77.

[0009] Preferably, the CM1 medium comprises 1 / 2 MS, 20-40 g / L sucrose, 40-60 μM acetosyringone, and 6-10 g / L agar.

[0010] Preferably, the RM2 medium comprises 1 / 2 MS, 20-40 g / L sucrose, 80-120 mg / L timentin, and 6-10 g / L agar.

[0011] Preferably, the CM3 medium comprises MS, 1-3 mg / L 6-BA, 0.1-0.3 mg / L NAA, 20-40 g / L sucrose, 80-120 mg / L timentin, and 6-10 g / L agar.

[0012] Preferably, the RM4 medium comprises MS, 1-3 mg / L 6-BA, 0.1-0.3 mg / L NAA, 0.5-1.5 mg / L LTDZ, 20-40 g / L sucrose, 80-120 mg / L timentin, and 6-10 g / L agar.

[0013] Preferably, the RM5 medium comprises MS, 0.6-0.8 mg / L IBA, 20-40 g / L sucrose, and 6-10 g / L agar.

[0014] The invention provides a method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes, which mainly includes the steps of vector construction, Agrobacterium transformation, transformation and co-cultivation, rooting induction, callus induction, plant regeneration and root regeneration, etc., which can significantly improve the efficiency of genetic transformation of kiwifruit and shorten the genetic transformation cycle. In addition, the invention can shorten the cycle and improve the efficiency by optimizing the composition and content of plant hormones in the culture medium, the bacterial solution concentration and the leaf treatment method in each step, and is an ideal method for efficient genetic transformation of kiwifruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The present invention provides a flowchart of a method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes.

[0016] Figure 2 Process the blisk diagram for the blades; Figure 3 This is the morphology of the induced hairy roots.

[0017] Figure 4 This is the morphological diagram of callus induction.

[0018] Figure 5 This is a diagram of plant regeneration morphology.

[0019] Figure 6 This is a diagram for transgenic identification.

[0020] Figure 7 Illustration of transgenic identification for gene editing.

[0021] Figure 8 This is the mutation detection and sequencing peak graph of T1 site gene editing; in the figure, (A) is the mutation type and efficiency analysis; (B) is the sequencing peak graph result.

[0022] Fig. 9This is the mutation detection and sequencing peak graph of T2 site gene editing; in the figure, (A) is the mutation type and efficiency analysis, and (B) is the sequencing peak graph result. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0024] The experimental methods in the following examples that do not specify specific experimental conditions are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents, raw materials, and equipment used in the present invention can be obtained commercially. For example, the Agrobacterium rhizogenes K599 strain used in the following examples was purchased from Shanghai Tolo Port Company; all primers and sequencing were designed by the inventors and commissioned to Shanghai Biotech Co., Ltd. for synthesis; all PCR polymerases used were purchased from Beijing Quanshijin Co., Ltd.; other chemical reagents were purchased from Beijing Dingguo Biotechnology Co., Ltd.

[0025] Example 1: Figure 1 As shown, this embodiment provides a method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes, including vector construction, Agrobacterium transformation, transformation and co-cultivation, rooting induction, callus induction, plant regeneration and root regeneration, and specifically includes the following steps: S1. Vector construction: The EYFP overexpression vector was designed and constructed using snapgene software, named pGFC-EYFP, and sequenced for identification.

[0026] S2. Agrobacterium transformation: Take out 100 μL K599 competent cells from the -80℃ refrigerator, add the above-constructed overexpression vector, and mix well; place on ice for 5 minutes, quick-freeze with liquid nitrogen for 5 minutes, and thaw at 37℃ for 5 minutes; then place on ice for 5 minutes; add 800 μL TY culture medium to the clean bench, and shake the bacteria in a shaker at 28℃ for 3 hours; then centrifuge the bacterial suspension and resuspend it with 100uL culture medium, and spread all on TY solid culture medium (containing 50μg / L kanamycin and 50μg / L streptomycin) and culture at 28℃ for 2-3 days; pick a single clone from the plate, and use primers EYFP-F (nucleotide sequence as shown in the sequence list SEQ ID NO:1, specifically: ATCCTTCGCAAGACCCTTCCT) and EYFP-R (nucleotide sequence as shown in the sequence list SEQ ID NO:2, specifically: GGACACGCTGAACTTGTGGC) for colony PCR identification, and add positive clones to 1mL TY liquid medium (containing 50 μg / L kanamycin and 50 μg / L streptomycin) was shaken overnight at 28°C. On the second day, 200 μL of the bacterial suspension was spread on TY solid medium (containing 50 μg / L kanamycin, 50 μg / L streptomycin, and 100 μM acetosyringone) and cultured overnight at 28°C.

[0027] Prepare appropriate volumes of the first buffer Wash Buffer (containing 10 mm MgSO4, 50 μM acetosyringone) and the second buffer Induction Buffer (containing 1 / 4 MS, 10 g / L sucrose, 50 μM acetosyringone, 0.005% silwet L-77) according to the number of plates to be processed. Wash the bacteria with 2 mL Wash Buffer and repeat twice, then resuspend with 1 mL Induction Buffer, measure the OD600 of the bacterial suspension with a spectrophotometer, and finally dilute the bacterial suspension with Induction Buffer to OD600 = 0.8. The bacterial suspension is used for subsequent transformation.

[0028] S3. Transformation and co-cultivation: Use surgical scissors to cut sterile kiwifruit leaves into 5 × 5 mm leaves (such as Figure 2 As shown in the figure), place it in the bacterial suspension diluted to OD600 of 0.8 in the above step, and shake it at 120rpm / min at 28℃ for 12 minutes. After shaking, remove the bacterial suspension, dry the residual bacterial liquid on the surface of the leaf disc on sterile filter paper, and then spread the leaves on CM1 medium (containing 1 / 2 MS, 30g / L sucrose, 50μM acetosyringone, 8g / L agar), mark it as OE-EYFP, and co-cultivate it in the dark for 2-3 days.

[0029] S4. Root induction: After the co-cultivation, the leaf disc was washed in sterile ultrapure water for 4 times. The residual liquid in the leaf disc was dried on sterile filter paper and spread on RM2 medium (containing 1 / 2 MS, 30 g / L sucrose, 100 mg / L timentin, 8 g / L agar) and cultured normally in the tissue culture room. The plate was marked as OE-EYFP.

[0030] S5. Callus induction: After the hair roots grow out, cut them with sterilized scissors and place them in CM3 medium (containing MS, 2 mg / L 6-BA, 0.2 mg / L NAA, 30 g / L sucrose, 100 mg / L timentin, 8 g / L agar) for culture. The plate was marked as OE-EYFP.

[0031] S6. Plant regeneration: After the callus expands (such as Figure 3 As shown in the figure, the callus tissue was cultured in RM4 medium (containing MS, 2 mg / L 6-BA, 0.2 mg / L NAA, 1 mg / L TDZ, 30 g / L sucrose, 100 mg / timentin, and 8 g / L agar).

[0032] S7, root induction: After the plant regenerates (such as Figure 4 As shown in the figure, the regenerated plants were placed in RM5 medium (containing MS, 0.7 mg / L IBA, 30 g / L sucrose, and 8 g / L agar) for culture to obtain transgenic plants.

[0033] Identification of transgenic plants: Use sterilized scissors to take small leaf discs of 5 × 5 mm from the above transgenic plants, and then use the above primers EYFP-F and EYFP-R for plant direct PCR, then run agarose gel, and finally use a gel imaging system to take pictures (such as Figure 6 ). After randomly selecting 10 strains for identification, it was found that 9 strains had corresponding specific bands and 1 strain had no corresponding band. Therefore, the transformation efficiency was 90%, which was significantly higher than the original method, and it also proved that this method was highly efficient and suitable for large-scale genetic transformation and genetic improvement of kiwifruit.

[0034] Example 2: This example provides a kiwifruit gene editing method based on Agrobacterium rhizogenes, which specifically includes the following steps: S1. Vector construction: The online tool Cas-Designer (http: / / www.rgenome.net / cas-designer / ) was used to design two targets corresponding to the kiwifruit gene CEN4, which were respectively denoted as T1 (the nucleotide sequence is shown in SEQ ID NO:3 in the sequence listing, specifically: CCTAGGGTTGAAGTTCATGG) and T2 (the nucleotide sequence is shown in SEQ ID NO:4 in the sequence listing, specifically: AGAGCACAAACACAAACCTG), and the excision and ligation were performed according to the existing method. Then, primers SP-L (the nucleotide sequence is shown in SEQ ID NO:5 in the sequence listing, specifically: GTCGTGCTCCACATGTTGACCGG) and SP-R (the nucleotide sequence is shown in SEQ ID NO:6 in the sequence listing, specifically: CCCGACATAGATGCAATAACTTC) were used for colony PCR identification, and then sequencing verification was performed.

[0035] S2. Perform operations according to steps S2-S7 in Example 1, and just mark the symbol as GE-CEN4.

[0036] S3. Transgenic and mutation identification: Use sterile scissors to take small leaf disks of 5 × 5 mm from the transgenic plants obtained above, and then use the above primers SP-L and SP-R to perform plant direct PCR, and then run agarose gel (such as Figure 7 Finally, the gel imaging system was used to take pictures (as shown in Figure 6 ). At the same time, primers CEN4-F (nucleotide sequence is shown in the sequence table SEQ ID NO:7, specifically: TCTCTCTCACTCTCTCTCATGGCA) and CEN4-R (nucleotide sequence is shown in the sequence table SEQ ID NO:8, specifically: GTGGTCTCTTGAGGGAGGTGGTGT) were used for PCR, and then the PCR products were sequenced, and the sequencing results were analyzed using the online tool DSDecodeM (http: / / skl.scau.edu.cn / dsdecode / ). The results showed that the three strains identified in the embodiment of the present invention were all positive, and the transformation efficiency was 100%. Mutation analysis showed that gene editing caused the insertion and deletion of bases at specific sites of CEN4 (such as Figure 8 and Fig. 9 As shown in the figure, it is proved that the genetic transformation system can be used for gene editing of kiwifruit, which lays a solid foundation for the subsequent precise genetic improvement and excellent trait aggregation of kiwifruit.

[0037] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes, characterized in that: The method comprises the steps of vector construction, Agrobacterium transformation, transformation and co-cultivation, root induction, callus induction, plant regeneration and root regeneration, and specifically comprises the following steps: Constructing overexpression vectors; The overexpression vector was mixed with competent cells of Agrobacterium rhizogenes, transformed by freeze-thaw method, and cultured on TY solid medium; a single clone was picked and cultured with TY liquid medium, and then the bacterial suspension was aspirated and spread on TY solid medium containing acetosyringone for culture; The cultured plate is resuspended and washed with a first buffer, and then resuspended and diluted with a second buffer to obtain a bacterial suspension; The sterile kiwifruit young leaves were placed in the above bacterial suspension for shaking culture, and then the bacterial suspension was removed, the residual bacterial liquid on the surface of the leaf disc was dried, and then the leaves were spread on the CM1 culture medium and placed in the dark for co-culture; After the co-cultivation, the leaf disc was placed in sterilized ultrapure water for cleaning, and then the residual liquid in the leaf disc was dried and spread on RM2 medium for cultivation; After the hair roots grow out, cut them off and place them in CM3 culture medium for cultivation; After the callus expands, the callus tissue is placed in RM4 medium for culture; After the plants are regenerated, the regenerated plants are placed in RM5 medium for culture to obtain transgenic plants.

2. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The Agrobacterium rhizogenes is the Agrobacterium rhizogenes K599 strain.

3. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The TY solid culture medium and the TY liquid culture medium both contain 40-60 μg / L kanamycin and 40-60 μg / L streptomycin.

4. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The first buffer comprises MgSO4 and 40-60 μM acetosyringone; the second buffer comprises 1 / 4 MS, 8-12 g / L sucrose, 40-60 μM acetosyringone, and 0.004%-0.006% Silwet L-77.

5. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The CM1 medium includes 1 / 2 MS, 20-40 g / L sucrose, 40-60 μM acetosyringone, and 6-10 g / L agar.

6. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The RM2 culture medium includes 1 / 2 MS, 20-40 g / L sucrose, 80-120 mg / L timentin, and 6-10 g / L agar.

7. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The CM3 culture medium includes MS, 1-3 mg / L 6-BA, 0.1-0.3 mg / L NAA, 20-40 g / L sucrose, 80-120 mg / L timentin, and 6-10 g / L agar.

8. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The RM4 medium includes MS, 1-3 mg / L 6-BA, 0.1-0.3 mg / L NAA, 0.5-1.5 mg / L TDZ, 20-40 g / L sucrose, 80-120 mg / L timentin, and 6-10 g / L agar.

9. The method for efficient genetic transformation of kiwifruit based on Agrobacterium rhizogenes according to claim 1, characterized in that: The RM5 culture medium includes MS, 0.6-0.8 mg / L IBA, 20-40 g / L sucrose, and 6-10 g / L agar.

Images