Nanometer magnetic bead mediated Pennisetum alopecuroides pollen tube channel transgenic method

Abstract

The invention belongs to the technical field of plant transgenosis, and particularly relates to a nano magnetic bead mediated pennisetum alopecuroides pollen tube channel transgenosis method. The method comprises the following steps: compounding magnetic beads and plasmid DNA, compounding a magnetic bead-DNA compound and a pollen culture solution, carrying out magnetic transfection, and pollinating. Compared with a traditional transformation mode, the transformation method mediated by the nano magnetic beads does not need tissue culture, transformation conditions are milder, transformation time is shorter, and the transformation method is an efficient and rapid transformation mode and has great guiding significance on genetic breeding work of pennisetum alopecuroides; through artificial pollination, a large number of seeds can be obtained, and more materials are provided for subsequent screening of transgenic plants; the method provided by the invention is simple to operate, saves resources, and achieves an excellent effect through a synergistic effect among the operation steps.

Description

Technical Field

[0001] The invention belongs to the technical field of plant transgenic technology, and particularly relates to a nanomagnetic bead-mediated Pennisetum pollen tube channel transgenic method. Background Art

[0002] With the comprehensive development of my country's social economy and the improvement of people's living standards, the original horticultural varieties can no longer meet people's spiritual needs for beauty. There is an urgent need to cultivate more novel varieties. Therefore, ornamental plant breeding has become increasingly important.

[0003] Pennisetum alopecuroides is a perennial plant of the genus Pennisetum in the Poaceae family. It has strong stress resistance, salt and alkali tolerance, and low water resource consumption. It can be used for soil and water conservation, windbreak and sand fixation, and garden landscaping. It is an important ornamental grass. For most ornamental grasses, due to their biological characteristics such as cross-pollination, complex ploidy, and lack of a stable genetic transformation system, conventional hybridization and selective breeding are still the main methods, and the application of genetic engineering breeding in Pennisetum is not yet mature.

[0004] At present, the research on transgenic technology of Pennisetum is just beginning compared with other model crops. In 2002, Maram Girgi et al. obtained herbicide-resistant American Pennisetum by gene gun method. Wang Pingqing et al. (2007) transformed the Arabidopsis CBF1 transcription factor into hybrid Pennisetum leaves by Agrobacterium-mediated method and successfully obtained transgenic regenerated plants. Gong Shufang et al. (2010) conducted relevant research on tissue culture of Pennisetum using seeds as explants. Mu Tong et al. (2013) used Pennisetum callus as the receptor for genetic transformation and introduced the ryegrass antifreeze protein gene by Agrobacterium-mediated method, and initially established the genetic transformation system of Pennisetum. However, these traditional methods still have limitations: for example, gene gun method requires expensive equipment and materials, Agrobacterium-mediated method has low transformation efficiency, requires a mature genetic transformation system, and the operation steps are cumbersome. These factors limit the application and development of Pennisetum genetic engineering breeding. Therefore, there is an urgent need for an efficient DNA introduction method for Pennisetum that is not dependent on tissue culture system and is not restricted by genotype. Summary of the invention

[0005] In order to solve the above problems existing in the prior art, the present invention provides a method for transgenic Pennisetum pollen tube channel, which comprises the following steps:

[0006] Magnetic beads and plasmid DNA complex step: the magnetic beads and plasmid DNA are mixed and allowed to stand to obtain a magnetic bead-DNA complex;

[0007] The step of compounding the magnetic bead-DNA complex with the pollen culture solution: mixing the magnetic bead-DNA complex with the pollen opening culture solution to obtain the magnetic bead-DNA-pollen culture solution;

[0008] Magnetoresistive step: mixing Pennisetum pollen and the magnetic bead-DNA-pollen culture solution, performing magnetoresistive transfection, and obtaining transfected pollen;

[0009] Pollination step: drying the transfected pollen, and then pollinating the female inflorescence of Pennisetum to obtain the pollinated inflorescence.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] 1. Compared with the traditional transformation method, the transformation method mediated by nanomagnetic beads does not require tissue culture, has milder transformation conditions and shorter time, and is an efficient and rapid transformation method, which has great guiding significance for the genetic breeding of Pennisetum.

[0012] 2. The present invention combines nanomagnetic transformation technology with pollen-mediated method, overcoming the problems of traditional transgenic technology such as long tissue culture cycle, easy pollution, and complicated operation steps. Through artificial pollination, a large number of seeds can be obtained, providing more materials for the subsequent screening of transgenic plants.

[0013] 3. The present invention is successfully applied to Pennisetum transformation for the first time, can improve pollen vigor and transfection efficiency, and provides a method for obtaining transgenic plants without relying on tissue culture technology.

[0014] 4. The present invention establishes a nanomagnetic bead transformation system for Pennisetum, filling the gap in pollen-mediated transgenic research on Pennisetum. Gene editing technology can be comprehensively used in subsequent research work to provide a basis for subsequent transgenic breeding.

[0015] 5. The method of the present invention is simple to operate and saves resources; the synergy between the various operating steps achieves excellent results. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the plasmid map of pMDC85.

[0017] Figure 2 This is the electrophoresis diagram of the PCR test results of test example 1.

[0018] Figure 3 This is the laser confocal detection photo of detection example 1.

[0019] Figure 4 This is the electrophoresis diagram of the magnetic bead-plasmid complex detection results of Experimental Example 1 (A is before enzyme digestion, B is after enzyme digestion).

[0020] Figure 5 This is a scanning electron microscope photograph of the pollen morphology of Experimental Example 1.

[0021] Figure 6 Electron microscope photographs of pollen morphology at different temperatures in Experimental Example 1 (A) and a bar graph of pollen germination rate (B).

[0022] Figure 7 Electron microscope photos of pollen morphology at different transfection times in Experimental Example 1 (A), a bar graph of pollen opening rate (B), and a bar graph of pollen vitality (C).

[0023] Figure 8 The photographs show the growth of the seeds of the inflorescences that were not transfected and transfected with the pMDC85 plasmid in Experimental Example 1 in a medium containing 80 mg / L hygromycin. DETAILED DESCRIPTION

[0024] To make the technical solution, purpose and advantages of the present invention clearer, the present invention is further described in detail below through specific implementation examples. It should be understood that the specific implementation methods described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0025] The present invention provides a nanomagnetic bead-mediated Pennisetum pollen tube channel transgenic method, the method comprising the following steps:

[0026] Magnetic beads and plasmid DNA complex steps:

[0027] The magnetic beads and plasmid DNA are mixed and allowed to stand to obtain a magnetic bead-DNA complex.

[0028] As a preferred embodiment, the magnetic beads are nanomagnetic beads with an average particle size of 50 to 200 nanometers, preferably 100 nanometers; the storage concentration of the magnetic beads is 1 μg / μL, and the POLYMAG 100 magnetic transfection reagent from Chemicell of Germany is preferably used.

[0029] The plasmid can be any plasmid currently available in the field of plant genetic engineering, any commercially available plasmid, or a plasmid constructed by introducing other DNA fragments thereon. As a preferred embodiment, the plasmid DNA is a pMDC85 plasmid or a pYBA1132 plasmid.

[0030] As a preferred embodiment, the mass ratio of the magnetic beads to the plasmid DNA is 1:(3-5), for example, any one or two of 1:3, 1:3.5, 1:4, 1:4.5 and 1:5, for example, 1:(3-4), 1:(3.5-4.5), 1:(4-5); preferably 1:4.

[0031] As a preferred embodiment, the temperature of mixing and standing the magnetic beads and plasmids is 20 to 30°C, for example, any one of 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C or any two thereof, for example, 24-26°C, 23-27°C, 22-28°C, 21-29°C or 21-26°C, preferably 25°C; the mixing and standing time is 20 to 40 minutes, for example, 20 minutes, 21 minutes, 2 37 minutes, and preferably 30 minutes.

[0032] Steps for compounding magnetic beads-DNA complex and pollen culture solution:

[0033] The magnetic bead-DNA complex and the pollen opening culture solution are mixed to obtain the magnetic bead-DNA-pollen culture solution.

[0034] As a preferred embodiment, the mass volume ratio (w / v) of the magnetic beads and the pollen opening culture solution is (5-20):10000, for example, 5:10000, 6:10000, 7:10000, 8:10000, 9:10000, 10:10000, 11:10000, 12:10000, 13:10000, 14:10000, 15:10000, 16:1000 The range of any one or two of 0, 17:10000, 18:10000, 19:10000, 20:10000, for example, (10-14):10000, (8-16):10000, (6-18):10000, (7-15):10000, (9-17):10000, (11-19):10000, preferably 12:10000.

[0035] As a preferred embodiment, the pollen opening culture solution comprises:

[0036] Sucrose 150~200g / L, MgSO4·7H2O 200~300mg / L, H3BO3 30~100mg / L, KNO3 50~150mg / L, Ca(NO3)2·4H2O 180~300mg / L, MnSO4·H2O100~200mg / L, GA3 20~30mg / L.

[0037] Preferred are: sucrose 171 g / L, MgSO4·7H2O 246 mg / L, H3BO3 63 mg / L, KNO3 100 mg / L, Ca(NO3)2·4H2O 236 mg / L, MnSO4·H2O 169 mg / L, and GA3 25 mg / L.

[0038] Magnetorfection steps:

[0039] The Pennisetum pollen and magnetic bead-DNA-pollen culture solution are mixed and magnetic transfection is performed to obtain transfected pollen.

[0040] As a preferred embodiment, the Pennisetum pollen is fresh pollen that has just been scattered. The pollen is collected between 9 and 12 o'clock in the morning on a sunny day, when Pennisetum sheds a large amount of pollen, and a large amount of fresh pollen can be obtained for the experiment.

[0041] The above-mentioned Pennisetum can be selected from all existing varieties, and is preferably "Liqiu" Pennisetum.

[0042] As a preferred embodiment, the magnetic beads-DNA-pollen culture solution has been pre-cooled to a temperature of 4 to 10°C, preferably 8°C.

[0043] As a preferred embodiment, the mass volume ratio of the above-mentioned Pennisetum pollen and magnetic beads-DNA-pollen culture solution is 1:(3-5), for example, any one of 1:3, 1:3.5, 1:4, 1:4.5 and 1:5 or a range between two thereof, for example, 1:(3-4), 1:(3.5-4.5), 1:(4-5), preferably 1:4.

[0044] As a preferred embodiment, the time of the above-mentioned magnetic transfection is 10 to 50 minutes, preferably 30 minutes, and the temperature of the above-mentioned transfection is 4 to 10°C, for example, any one of 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C or a range between two thereof, for example, 4 to 8°C, 6 to 10°C, 7 to 9°C, 5 to 8°C, preferably 8°C; during the magnetic transfection process, the container is shaken every 5 to 15 minutes to ensure that the Pennisetum pollen is fully immersed in the magnetic bead-DNA complex solution.

[0045] Compared with transfection at room temperature, the vitality of Pennisetum pollen is better when transfected at a low temperature of 4-10°C, that is, there are more surviving pollen that can complete the hole opening and subsequent transfection experiments, thereby improving the transfection efficiency.

[0046] Pollination steps:

[0047] The transfected pollen is dried and then pollinated on the female inflorescence of Pennisetum to obtain the pollinated inflorescence.

[0048] The drying method can be: take a 500-mesh nylon cloth and spread it evenly, preferably put two layers of absorbent filter paper underneath, transfer the transfected pollen to the nylon cloth to absorb the moisture, and obtain dried pollen.

[0049] The female flowers of the Pennisetum above have been reproductively isolated before pollination; the inflorescences after pollination are still reproductively isolated.

[0050] The female inflorescence of the above Pennisetum is characterized by the pistil stigma being exposed 1 to 4 mm, while the stamens have not yet exposed the lemma.

[0051] The present invention adopts the operation of first preparing the magnetic bead-DNA complex, then mixing it with the pollen culture solution, and then adding the pollen. Compared with the operation of first mixing the pollen and the pollen complex solution, and then adding the magnetic bead-DNA complex, within the same transfection time, the contact time between the pollen and the magnetic bead-DNA complex is increased, the time for the pollen pore to open and facilitate the magnetic bead-DNA complex to enter the pollen pore is increased, and the operation is more convenient.

[0052] The above mass-to-volume ratio (w / v) is: the ratio between the mass of solid added to the liquid (or suspension) and the volume of the liquid (or suspension); for example: w / v is 1:4, which means adding 1g of solid to 4mL of liquid (or suspension).

[0053] The various reagents, materials, etc. used in the following examples, unless otherwise specified, are all products that can be obtained from commercial channels; the various tests and detection methods used in the following examples, unless otherwise specified, are all conventional tests and detection methods in the art and can be obtained from textbooks, reference books or academic journals.

[0054] Example 1

[0055] This example is used to illustrate a method for transgenic Pennisetum pollen tube pathway mediated by nanomagnetic beads, which comprises the following steps:

[0056] S1: Construction of magnetic bead-DNA complex

[0057] Magnetic nanoparticles polyMAG100 (i.e., nanomagnetic beads, with an average particle size of 100 nanometers and a storage concentration of 1 μg / μL, POLYMAG 100 magnetic transfection reagent from Chemicell, Germany) were used as gene carriers, and the extracted pMDC85 plasmid was mixed at a mass ratio of 1:4, with 4.8 μg of nanomagnetic beads and 19.2 μg of pMDC85 plasmid. The mixture was allowed to stand at 25°C for 30 min to construct a magnetic bead-DNA complex (i.e., nanocarrier-gene complex).

[0058] S2: Preparation of magnetic beads-DNA-pollen culture medium

[0059] The magnetic bead-DNA complex obtained in step S1 above was evenly mixed with 4 mL of pollen culture solution to obtain magnetic bead-DNA-pollen culture solution.

[0060] The above pollen culture solution contains: 171g / L sucrose, 246mg / L MgSO4·7H2O, 63mg / L H3BO3, 100mg / L KNO3, 236mg / L Ca(NO3)2·4H2O, 169mg / L MnSO4·H2O, and 25mg / L GA3.

[0061] S3: Collecting Pennisetum pollen

[0062] Collect fresh pollen from the newly-bloomed flowers of the "Li Qiu" Pennisetum between 9 and 12 o'clock in the morning on a sunny day, sieve the pollen (1 mm pore size), and collect the clean and fresh pollen after the sieve.

[0063] The "Liqiu" Pennisetum was purchased from Beijing Academy of Agricultural Sciences Seed Technology Co., Ltd., with the item number "Guo S-BV-PA-007-2021". The "Liqiu" Pennisetum is also stored in the National Grass Germplasm Resource Bank of the National Animal Husbandry Station, and the contact number is 010-59194608. Anyone can freely obtain the "Liqiu" Pennisetum for the purpose of achieving the present invention.

[0064] S4: Magnetofection

[0065] Weigh about 1 g of sieved pollen, carefully transfer it to a centrifuge tube, add 4 mL of the magnetic bead-DNA-pollen culture solution obtained in step S2 above, which has been pre-cooled to 8°C, to fully immerse it, cover the lid of the culture dish, place it on a magnetic plate (MagnetoFACTOR 96 plate (Cat. No. 9008 96, Chemicell, Germany)), let it stand at 8°C for 30 minutes, and gently shake the centrifuge tube every 15 minutes to allow the pollen culture solution to fully immerse the pollen, to obtain magnetically transformed pollen (i.e., transfected pollen).

[0066] S5: Pollination

[0067] Take a 500-mesh nylon cloth and spread it evenly, and pad two layers of absorbent filter paper underneath. Transfer the pollen obtained in step S4 after magnetic transformation to the nylon cloth to absorb moisture, take the dried pollen, select the inflorescence for reproductive isolation, pollinate the inflorescence with the stigma exposed 1 to 4 mm and the stamen not exposed lemma, and perform reproductive isolation on the pollinated inflorescence according to bagging.

[0068] Test Example 1

[0069] This test example is used to describe the screening and detection of seeds produced from the inflorescence after pollination in Example 1.

[0070] After the seeds were harvested from the pollinated inflorescence in Example 1, 150 seeds were randomly selected.

[0071] 1. Hygromycin resistance screening

[0072] Since the pMDC85 plasmid contains the hygromycin resistance gene, preliminary screening can be performed using hygromycin culture medium.

[0073] Prepare 1 / 2MS resistance medium with 80 mg / L hygromycin, disinfect the transfected Pennisetum seeds with 1% sodium hypochlorite solution for 10 minutes, wash them twice with clean water, and inoculate them into the resistance medium in a clean bench. After 10 days, observe the development of the seedling root system, and select seedlings with good root growth and move them into pots.

[0074] 2. PCR testing

[0075] The plants that can survive on the hygromycin resistance medium are transplanted into pots, and the surviving plants are tested by PCR. The PCR is performed using primers designed using the hygromycin resistance gene sequence, and the plants introduced with the plasmid have the target band.

[0076] When the plants grew to about 10-15 cm, a total of 13 transfected seedlings survived. The DNA of the 13 seedlings was extracted by CTAB method, and PCR identification was performed using ordinary PCR and specific primers of hygromycin resistance gene, with wild-type plants and H2O as negative controls and PMDC85 plasmid as positive control. The PCR products were subjected to agarose gel electrophoresis to observe whether the target band size was in line with expectations. The target band was 232 bp, and the plants that met the target band size were positive plants.

[0077] The coding sequence of the hygromycin resistance gene is as follows:

[0078] ATGAAAAAGCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTG

[0079] ATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGC

[0080] GAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCC

[0081] TGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTAT

[0082] CGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGACATTG

[0083] GGGAGTTTAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGG

[0084] GTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTAC

[0085] AACCGGTCGCGGAGGCTATGGATGCGATCGCTGCGGCCGATCTTAGCC

[0086] AGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACA

[0087] CTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCAC

[0088] TGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCT

[0089] CTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCAC

[0090] CTCGTGCACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGC

[0091] CGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCC

[0092] CAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTA

[0093] TGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAG

[0094] GATCGCCACGACTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACT

[0095] CTATCAGAGCTTGGTTGACGGCAATTTCGATGATCAGCTTGGGCGCAG

[0096] GGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGT

[0097] ACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTA

[0098] GAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGG

[0099] GCAAGAAATA.

[0100] The following primers were designed upstream and downstream of the hyg gene in the pMDC85 plasmid:

[0101] HYG-F: 5'-CTTCTGCGGGCGATTTGTGT-3';

[0102] HYG-R: 5'-GGCCGTGGTTGGCTTGTATG-3'.

[0103] In the above PCR detection, common PCR enzyme is used for amplification.

[0104] In the above PCR test, the PCR reaction system (25μ5) is:

[0105] 2×Taq Master Mix (Dye Plus) 12.5 μL, HYG-F 1 μL, HYG-R 1 μL, DNA 1 μL, ddH2O 9.5 μL.

[0106] In the above PCR test, the PCR reaction procedure is:

[0107] First, 95℃ for 3 min; then 95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, for a total of 30 cycles; then 72℃ for 5 min; then keep warm at 12℃.

[0108] The results are as follows Figure 2 As shown in the results, it was found that a clear 232bp target band could be amplified in 7 strains, and the sequencing results were correct, proving that 7 positive plants were obtained ( Figure 2 In the figure, each lane is: M: Marker; blank control: H2O; positive control: pMDC85; each number is the number of the strain that has been verified to be positive).

[0109] The verification results show that the positive strain ratio in all seeds reached 4.66% (7 / 150). The test results show that the nanomagnetic bead-mediated Pennisetum pollen tube channel method greatly improves the success rate of Pennisetum transgenic, and is a simple and effective transgenic technology.

[0110] 3. Observe positive plants with confocal microscopy

[0111] Laser confocal microscopy was performed on the 7 positive plants verified by PCR. The plants introduced with the target plasmid had the eGFP gene and green fluorescence. Subcellular localization of the pMDC85 plasmid was performed to observe the localization of GFP in the positive plants later.

[0112] The positive plants verified by PCR were verified by GFP fluorescence. Specifically, the root tip of the plant was taken, cut into about 0.5-1 cm root segments, placed on a glass slide, dripped a drop of water, pressed the slide, placed it under a laser confocal microscope for observation, and photographed. Figure 3 As shown, taking the root system of wild-type Pennisetum lycopersicum as control, it was found that the cell membrane of the plant transfected with the pMDC85 plasmid showed green fluorescence under a confocal microscope.

[0113] Experimental example

[0114] This experimental example is used to describe the influence of various reaction conditions and parameters in the pollination method of Example 1 and the detection method of Detection Example 1 on the transformation method.

[0115] 1. Nanomagnetic bead load detection.

[0116] (1) The magnetic nanoparticles polyMAG100 and pMDC85 plasmid of Example 1 were used in the following gradient mass ratios: 1:2, 1:4 (ratio in Example 1), 1:10, 1:20, 1:50, 1:100, and allowed to stand at 25° C. for 30 min to construct nanocarrier-gene complexes of different mass ratios. In all nanocarrier-gene complexes (i.e., MNP / DNA complexes), the amount of DNA was fixed at 1 μg.

[0117] A portion of the MNP / DNA complex was stored for later use; the other portion was subjected to the following enzyme digestion treatment (5 μL): 1 μL of Xho I was used for digestion at 37° C. for 16 h to obtain a digestion product.

[0118] (2) The pure plasmid DNA, MNP / DNA complex and enzyme digestion products were subjected to agarose gel electrophoresis blocking experiment to analyze the binding ability of magnetic nanoparticles polyMAG100 with DNA.

[0119] The nanocarrier-gene complex and enzyme cleavage product were subjected to electrophoresis in 0.6% agarose gel and TAE buffer (200 mM Tris, 200 mM acetic acid, 5 mM EDTA) at a voltage of 150 V for 15 min.

[0120] The results are as follows Figure 4 As shown in the figure, the results of part A show that the nanomagnetic beads have good DNA loading binding ability, and the maximum loading capacity is reached when the mass ratio of magnetic nanoparticles polyMAG100 and pMDC85 plasmid is 1:4. The results of part B show that the MNP / DNA complex can effectively resist the digestion of nucleases. The MNP / DNA complexes (green) with mass ratios of 1:2, 1:4, and 1:10 still remain in the spotting wells, and no enzyme-cut diffuse bands appear in the lanes; correspondingly, as the proportion of MNP in the MNP / DNA complex continues to decrease, in the lanes of 1:20, 1:50, and 1:100, the excess DNA migrates with the electric field and is cut by the restriction endonuclease Xho I to form a linear plasmid band. It can be seen that in addition to having good DNA loading binding ability, magnetic nanoparticles can also protect DNA from enzyme degradation. Figure 4 After the electrophoresis, the electrophoresis bands were observed by Bio-Rad Imager. Part A is the agarose gel electrophoresis analysis of MNP / DNA complex; Part B is the agarose gel electrophoresis analysis of MNP / DNA complex enzyme digestion products.

[0121] 2. Morphological observation of Pennisetum pollen.

[0122] (1) Before the Pennisetum liqiuensis sheds its pollen, it is bagged with a white translucent breathable plastic bag. When the Pennisetum liqiuensis sheds its pollen, the bag is flicked to make the pollen fall from the stamens into the bag. The bag is then placed in a sealed bag and stored at 4° C. The collected pollen is sieved (1 mm pore size), and 1 g of fresh and clean pollen is placed in 4 mL of pollen open-well culture solution (with the same composition as in Example 1) and cultured for 10 min.

[0123] (2) Place a 20-diameter absorbent paper at the bottom and a 300-mesh nylon cloth on the top. Gently mix the pollen culture solution and pour it on the nylon cloth. Fold the nylon cloth and absorbent paper in half and gently press the paper towel to absorb the moisture to obtain dried pollen.

[0124] (3) Place the dried pollen under a scanning electron microscope to observe the pollen morphology. Figure 5As shown in the figure, it can be seen that after 10 minutes of culture in pollen culture solution, the germination pores of Pennisetum liqiuensis pollen opened, facilitating the entry of exogenous substances; while the germination pores of pollen not cultured in pollen culture solution did not open, and exogenous substances could not enter. The above shows that the pollen culture solution environment is very important for the transfer of MNP / DNA complexes into pollen. The pollen culture solution mainly promotes the opening of pores, and the low temperature environment can also maintain the vitality of pollen.

[0125] 3. Screening of the optimal temperature for Pennisetum transfection.

[0126] (1) Using Pennisetum liqiuensis as the material, a translucent breathable bag was used to bag the young panicle of Pennisetum liqiuensis. After the panicle had finished shedding pollen, the bag was gently shaken to scatter the pollen in the bag for collection.

[0127] (2) After pollen was collected and sieved, 5 mg of pollen was weighed and 20 μL of pollen culture solution was added. After opening the wells at 4°C, 8°C, 12°C, 16°C and room temperature for 30 min, 180 μL of pollen in vitro liquid culture medium (50 mg / L sucrose + 0.08 mg / L boric acid + 0.04 mg / L calcium chloride) was added and cultured in the dark at 4°C, 8°C, 12°C, 16°C and room temperature for 3 h.

[0128] (4) Observe the state of pollen under an electron microscope and count the number of pollen grains using a cell counting plate. Successful germination is considered when the length of the pollen tube is greater than half of its own length. Calculate the germination rate (number of germinated pollen grains / total number of pollen grains) to determine the optimal pollen transfection temperature.

[0129] like Figure 6 As shown, part B shows through the statistics of pollen germination rate that at 4°C and 8°C, the germination rate of pollen is not much different from the germination rate of pollen without magnetic transfection at room temperature, which can ensure the vitality of pollen to the greatest extent. Figure 6 In the figure, RT in part A means magnetofection was performed at room temperature (25°C), and untransfected means no pollen transfection solution treatment was performed at room temperature; part A is the germination state of pollen magnetofection at different temperatures.

[0130] 4. Screening of the optimal time for Pennisetum transfection.

[0131] (1) Plasmid DNA and magnetic nanoparticles were placed at an optimal ratio (1:4) at 25°C for 30 min and then added to pollen opening culture medium (the transfection medium was pre-cooled at 8°C). 2 g of pollen was weighed and fully immersed in 8 ml of pollen opening culture medium. Three different transfection times of 0.5 h, 1 h, 2 h, and 5 h were set. The plasmid DNA was adsorbed by a magnetic nanogene carrier and the constructed vector was introduced into the pollen under the action of a magnetic field.

[0132] (2) After a certain period of time, the pollen was dried and observed under a scanning electron microscope to study its morphological structure and explore the porosity of pollen under different transfection conditions.

[0133] like Figure 7 As shown in the figure, at four different transfection times of 0.5h, 1h, 2h, and 5h, the pore opening state of pollen was observed by electron microscopy. The pore opening rate of pollen was the highest when it was treated for 5h, reaching 48.6%. The pore opening rate of pollen after 0.5h treatment was 27.9%, which was not significantly different from the pore opening rates of 1h and 2h (p<0.05) ( Figure 7 B). Pollen viability analysis found that there was no significant difference in the effect of pollen transfection time on viability ( Figure 7 C). When selecting the optimal opening time, since pollen shedding is strongest at noon and stigma vitality is better, the pollen vitality and opening rate of "Liqiu" Pennisetum, as well as the pollination environment, were considered comprehensively, and 0.5h was selected as the opening liquid transfection time. The above opening rate is: the number of open-hole pollen in the figure divided by the number of visible pollen holes. Pollen vitality is: 1% iodine-potassium iodide solution is used to stain the transfected pollen, and the number of pollen with vitality is counted and divided by the total number of pollen. Figure 7 In the figure, part A is the SEM images of pollen pretreated with transfection buffer at 8°C for different time periods, part B is the histogram of pollen opening rate, and part C is the histogram of pollen vitality.

[0134] 5. Screening of the optimal working concentration for hygromycin resistance in Pennisetum seeds.

[0135] Since the pMDC85 plasmid contains a hygromycin resistance gene, the hygromycin medium can be used to preliminarily screen plants that are resistant to hygromycin. Plants that have not been transformed with the plasmid have no resistance to hygromycin. In the 80 mg / mL hygromycin medium, most seeds have difficulty taking root or the root tips are poorly developed after taking root and gradually turn yellow. However, the transfected seeds can grow normally.

[0136] (1) To establish a hygromycin resistance screening system for Pennisetum 'Liqiu', 1 / 2MS culture medium containing hygromycin at concentrations of 0 mg / L, 60 mg / L, 70 mg / L, and 80 mg / L (the same as in Test Example 1) was prepared.

[0137] (2) The seeds of Pennisetum 'Liqiu' that had not been magnetofected were disinfected and inoculated into hygromycin culture medium with different working concentrations. The development of the seedling roots was observed to select the optimal working concentration of hygromycin.

[0138] (3) Results: All seeds grew normally on the medium containing 0 mg / L hygromycin, while some seeds were inhibited on the medium containing 60 mg / L and 70 mg / L hygromycin. Figure 8As shown, on the culture medium containing 80 mg / L hygromycin, the growth of untransfected WT seeds was inhibited, while the transfected seeds grew basically normally. Therefore, 80 mg / L hygromycin can be used to screen magnetically transfected Pennisetum seeds.

[0139] Example 2

[0140] This example is used to illustrate a method for transgenic Pennisetum pollen tube pathway mediated by nanomagnetic beads, which comprises the following steps:

[0141] S1: The magnetic nanoparticles polyMAG100 and pMDC85 plasmid described in Example 1 were mixed at a mass ratio of 1:3, wherein the nanomagnetic beads were 4.8 μg and the pMDC85 plasmid was 14.4 μg. The mixture was allowed to stand at 20° C. for 20 min to construct a magnetic bead-DNA complex.

[0142] S2: The magnetic beads-DNA complex was mixed evenly with 9.6 mL of the pollen culture solution described in Example 1 to obtain magnetic beads-DNA-pollen culture solution.

[0143] S3: The operation is the same as that in Example 1.

[0144] S4: The operation is similar to that of Example 1, except that: 1 g of sieved pollen is weighed, and 3 mL of the above-mentioned magnetic bead-DNA-pollen culture solution which has been pre-cooled to 4°C is added; the magnetic transfection time is 10 min, the temperature is 4°C, and the centrifuge tube is shaken every 5 min.

[0145] S5: The same operation as in Example 1.

[0146] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 5 positive plants were detected.

[0147] Example 3

[0148] This example is used to illustrate a method for transgenic Pennisetum pollen tube pathway mediated by nanomagnetic beads, which comprises the following steps:

[0149] S1: The magnetic nanoparticles polyMAG100 and pMDC85 plasmid described in Example 1 were mixed at a mass ratio of 1:5, wherein the nanomagnetic beads were 4.8 μg and the pMDC85 plasmid was 24 μg. The mixture was allowed to stand at 40° C. for 30 min to construct a magnetic bead-DNA complex.

[0150] S2: The magnetic beads-DNA complex is mixed evenly with 2.4 ml of the pollen culture solution described in Example 1 to obtain magnetic beads-DNA-pollen culture solution.

[0151] S3: The operation is the same as that in Example 1.

[0152] S4: The operation is similar to that of Example 1, except that: 1 g of sieved pollen is weighed, and then 5 mL of the above-mentioned magnetic bead-DNA-pollen culture solution which has been pre-cooled to 10°C is added; the magnetic transfection time is 50 min, the temperature is 10°C, and the centrifuge tube is shaken every 15 min.

[0153] S5: The same operation as in Example 1.

[0154] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 5 positive plants were detected.

[0155] Example 4

[0156] This embodiment is a method for transgenic Pennisetum pollen tube channel mediated by nanomagnetic beads, which includes the following steps.

[0157] S1: The quality and amount of the magnetic nanoparticles polyMAG100 and pMDC85 plasmid are the same as those in Example 1. The mixture is allowed to stand at 22° C. for 28 min and mixed to construct a magnetic bead-DNA complex.

[0158] S2: The operation is the same as that in Example 1.

[0159] S3: The operation is the same as that in Example 1.

[0160] S4: The operation is similar to that of Example 1, except that the precooling temperature of the magnetic bead-DNA-pollen culture solution is 9°C; the magnetic transfection time is 12 min, the temperature is 9°C, and the centrifuge tube is shaken every 5 min.

[0161] S5: The same operation as in Example 1.

[0162] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 5 positive plants were detected.

[0163] Comparative Example 1

[0164] This comparative example is the same as Example 1 except for the following operations and parameters:

[0165] The standing time of step S1 is 18 min.

[0166] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 2 positive plants were detected.

[0167] Comparative Example 2

[0168] This comparative example is the same as Example 1 except for the following operations and parameters:

[0169] The standing time of step S1 is 42 min.

[0170] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 2 positive plants were detected.

[0171] Comparative Example 3

[0172] This comparative example is the same as Example 1 except for the following operations and parameters:

[0173] The standing temperature in step S1 is 18°C.

[0174] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 2 positive plants were detected.

[0175] Comparative Example 4

[0176] This comparative example is the same as Example 1 except for the following operations and parameters:

[0177] The standing temperature in step S1 is 42°C.

[0178] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and screened for hygromycin resistance and tested by PCR in Test Example 1, and 2 positive plants were detected.

[0179] Comparative Example 5

[0180] This comparative example is the same as Example 1 except for the following operations and parameters:

[0181] In step S3, fresh pollen of Pennisetum lily is collected between 13:00 and 15:00 in the afternoon on a sunny day.

[0182] After harvesting seeds from the pollinated inflorescence, 150 seeds were randomly selected and subjected to hygromycin resistance screening and PCR testing as in Test Example 1, and 3 positive plants were detected.

[0183] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for transgenic Pennisetum pollen tube pathway, characterized in that: The method comprises the following steps: Magnetic beads and plasmid DNA complex step: the magnetic beads and plasmid DNA are mixed and allowed to stand to obtain a magnetic bead-DNA complex; The step of compounding the magnetic bead-DNA complex with the pollen culture solution: mixing the magnetic bead-DNA complex with the pollen opening culture solution to obtain the magnetic bead-DNA-pollen culture solution; Magnetoresistive step: mixing Pennisetum pollen and the magnetic bead-DNA-pollen culture solution, performing magnetoresistive transfection, and obtaining transfected pollen; Pollination step: drying the transfected pollen, and then pollinating the female inflorescence of Pennisetum to obtain the pollinated inflorescence.

2. The method according to claim 1, characterized in that: In the step of compounding the magnetic beads and plasmid DNA, the magnetic beads are nanomagnetic beads with an average particle size of 50 to 200 nanometers, preferably 100 nanometers; The plasmid DNA is pMDC85 plasmid.

3. The method according to claim 1 or 2, characterized in that: In the step of compounding the magnetic beads and the plasmid DNA, the mass ratio of the magnetic beads to the plasmid DNA is 1:(3-5), preferably 1:

4.

4. The method according to claim 1 or 2, characterized in that: In the step of compounding the magnetic beads and plasmid DNA, the magnetic beads and plasmid are kept at a temperature of 20 to 30° C., preferably 25° C., and for a time of 20 to 40 minutes, preferably 30 minutes.

5. The method according to claim 1, characterized in that: In the step of compounding the magnetic beads-DNA complex and the pollen culture solution, the mass volume ratio of the magnetic beads to the pollen opening culture solution is (5-20):10000, preferably 12:10000.

6. The method according to claim 1 or 5, characterized in that: In the step of compounding the magnetic bead-DNA complex with the pollen culture solution, the pollen opening culture solution comprises: Sucrose 150~200g / L, MgSO4·7H2O 200~300mg / L, H3BO3 30~100mg / L, KNO3 50~150mg / L, Ca(NO3)2·4H2O 180~300mg / L, MnSO4·H2O100~200mg / L, GA3 20~30mg / L.

7. The method according to claim 1, characterized in that: In the magnetic transfection step, the Pennisetum pollen is collected between 9 and 12 o'clock in the morning on a sunny day.

8. The method according to claim 1 or 7, characterized in that: In the magnetic transfection step, the mass volume ratio of the Pennisetum pollen to the magnetic beads-DNA-pollen culture solution is 1:(3-5), preferably 1:

4.

9. The method according to claim 1 or 7, characterized in that: In the magnetic transfection step, the temperature of the magnetic bead-DNA-pollen culture solution is 4-10°C, preferably 8°C.

10. The method according to claim 7, characterized in that: In the magnetofection step, the magnetofection time is 10 to 50 minutes, preferably 30 minutes; The temperature of the magnetofection is 4-10°C, preferably 8°C.

Images