Hairpin probe for detecting DNA polymerase excision enzyme activity and preparation method and application thereof

Abstract

The invention discloses a hairpin probe for detecting DNA polymerase excision enzyme activity and a preparation method and application thereof. The hairpin type probe sequentially comprises an area a, an area b, an area c, an area d, an area e, an area f and an area g from the 5'end, the area a and the area c are in reverse complementary pairing, the 5 'end of the area a is marked with a first fluorophore, and the 3' end of the area a is marked with a first quenching group; the e region and the g region are in reverse complementary pairing, the 5'end of the g region is marked with a second quenching group, and the 3 'end of the g region is marked with a second fluorophore; the first fluorophore and the second fluorophore are different from each other. By adopting the hairpin probe disclosed by the invention, the activity of 3 '-5' and 5 '-3' exonuclease of DNA polymerase can be independently or simultaneously detected in a single system, and the hairpin probe is simple in operation step, high in flux, good in specificity, capable of avoiding radioactive contamination and extremely good in application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a hairpin probe for detecting DNA polymerase exonuclease activity, and a preparation method and application thereof. Background Art

[0002] As a fast, efficient and specific DNA amplification technology, PCR technology has been widely used in scientific research and medical diagnosis, and has become an important tool in contemporary molecular biology and medicine. As the core of the PCR reaction, the fidelity, stability, specificity and sensitivity of DNA polymerase have been put forward more stringent requirements. Among the DNA polymerases currently used for PCR amplification technology, such as Taq DNA polymerase, KOD DNA polymerase, etc., in addition to DNA polymerase activity, they all have 3'-5' exonuclease activity or 5'-3' exonuclease activity. This part of the exonuclease activity may cause mismatched probes or primers to digest before the PCR reaction, resulting in non-specific signals or poor amplification efficiency. Therefore, how to quickly screen monoclonal antibodies with blocked exonuclease activity and DNA polymerases with exonuclease activity blocking antibodies have become the main research objects.

[0003] In the related art, there is a relatively mature system for detecting the activity of DNA polymerase, but there are fewer methods for detecting its exonuclease activity, which mainly include the radioactive isotope method and the reverse method using mismatched primers (refer to CN 104293930A). The radioactive isotope method mainly synthesizes a single-stranded oligonucleotide with a radioactive isotope dATP at the end, and then cuts it using the activity of the exonuclease, and finally precipitates and filters it through TCA, and calculates the exonuclease activity by measuring the radioactivity content in the acid-soluble substance. Although this detection method has good accuracy, it has a long cycle, is easy to contaminate, and is difficult to achieve high throughput and automation. Therefore, it cannot meet the needs of rapid high-throughput screening of exonuclease activity blocking antibodies. The mismatched primer reverse deduction method is to first synthesize a terminal mismatched primer based on a single-stranded template, mix the primer and the single-stranded template and anneal them, then add exonuclease activity to the reaction solution for terminal base exonucleolysis, and then add a sufficient amount of polymerase without the exonuclease activity to extend the primer until double-stranded DNA is obtained. The relative amount of double-stranded DNA in the reaction system is then detected, and the degree of exonuclease activity is deduced based on the test results. This method requires a PCR amplification reaction, and the degree of exonuclease activity is indirectly inferred through the relative amount of double-stranded DNA. Its accuracy is relatively low. In addition, a single detection using this method can only detect the exonuclease activity of one end (such as 3'-5' or 5'-3').

[0004] Based on this, there is an urgent need to find a detection method that is simple and quick to operate, has high sensitivity and good accuracy, and can simultaneously detect 3'-5' exonuclease activity and 5'-3' exonuclease activity. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a hairpin probe for detecting exonuclease activity, the hairpin probe is cleverly designed with two stem-loop structures, and different fluorescent groups are designed at its 3' end and 5' end respectively. The hairpin probe can detect 3'-5' and / or 5'-3' exonuclease activity in a single reaction system.

[0006] The present invention also provides a method for preparing the hairpin probe for detecting exonuclease activity.

[0007] The present invention also proposes an application of the hairpin probe for detecting exonuclease activity in screening or identifying DNA polymerases with exonuclease activity, detecting DNA polymerase exonuclease activity, screening antibodies with exonuclease activity blocking function, and preparing exonuclease activity detection reagents or kits.

[0008] The invention also provides a method for detecting exonuclease activity.

[0009] In a first aspect of the present invention, a hairpin probe for detecting exonuclease activity is provided, wherein the hairpin probe comprises region a, region b, region c, region d, region e, region f and region g in sequence from the 5' end, wherein: The a region is reversely complementary to the c region, the 5' end of the a region is labeled with a first fluorescent group, and the 3' end of the a region is labeled with a first quenching group; The e region and the g region are reverse complementary pairs, the 5' end of the g region is labeled with a second quenching group, and the 3' end of the g region is labeled with a second fluorescent group; The first fluorescent group and the second fluorescent group are different from each other.

[0010] The hairpin probe according to the embodiment of the present invention has at least the following beneficial effects: The hairpin probe of the present invention is cleverly designed with two stem-loop structures, and different fluorescent groups are designed at its 3' end and 5' end, respectively, so that the 3'-5' and / or 5'-3' exonuclease activities can be detected simultaneously in a single reaction system. In addition, the hairpin probe of the present invention is combined with a multi-channel real-time fluorescence instrument to realize rapid and high-throughput analysis of low-content exonuclease activities in samples, which is not only simple to operate, but also helps to save detection costs.

[0011] In some embodiments of the present invention, the nucleotide length of the a region is 10 nt to 16 nt.

[0012] Setting an appropriate nucleotide length in region a helps improve the fluorescence quenching effect and reduce the detection background. It also helps improve the DNA polymerase binding efficiency and thus improve the detection sensitivity.

[0013] In some embodiments of the present invention, the nucleotide length of the c region is 10 nt to 16 nt.

[0014] In some embodiments of the present invention, the nucleotide length of the a region is the same as the nucleotide length of the c region.

[0015] In some embodiments of the present invention, the nucleotide length of the e region is 10 nt to 16 nt.

[0016] In some embodiments of the present invention, the nucleotide length of the g region is 10 nt to 16 nt.

[0017] In some embodiments of the present invention, the nucleotide length of the e region is the same as the nucleotide length of the g region.

[0018] In some embodiments of the present invention, the b region connects the a region and the c region to form a ring portion.

[0019] In some embodiments of the present invention, the f region connects the e region and the g region to form a ring portion.

[0020] In some embodiments of the present invention, the lengths of the b region and the f region are independently 10 nt to 16 nt.

[0021] In some embodiments of the present invention, the first fluorescent group and / or the second fluorescent group is selected from any one of FAM, HEX, TRAMA, VIC, CY5 or JOE.

[0022] In some embodiments of the present invention, the first quencher group is the same as or different from the second quencher group.

[0023] In some embodiments of the present invention, the first quencher group and the second quencher group are independently selected from any one of BHQ1, BHQ2, TAMRA, and MGB.

[0024] In some embodiments of the present invention, the nucleotide sequence of the hairpin probe is as shown in SEQ ID NO: 8, wherein: The first fluorescent group is modified at the first base, and the first quenching group is modified at the 13th base; The second fluorescent group is modified at the 99th base, and the second quenching group is modified at the 86th base.

[0025] In some embodiments of the present invention, the sequence information of the hairpin probe is as follows: 5'-(VIC)TACTACTGGGAAT(BHQ1)AAGTTAAGACCTATGATTCCCAGTAGTAGAGACGGGGGAGACGACTACGGGGGTACAGTATCCAGAATTGAA(BHQ1)TGTACCCCCGTAGT(FAM)-3' (SEQ ID NO:8).

[0026] The second aspect of the present invention provides a method for preparing a hairpin probe for detecting exonuclease activity as described in any one of the first aspects, comprising: The nucleotide sequence of the hairpin probe is obtained and a corresponding oligonucleotide single strand containing the first fluorescent group, the first quenching group, the second fluorescent group and the second quenching group is synthesized, and then annealed and cooled to obtain the single strand.

[0027] The preparation method according to the embodiment of the present invention has at least the following beneficial effects: the preparation method of the probe of the present invention is simple, and only requires temperature control to form a stable hairpin structure through self-hybridization.

[0028] In some embodiments of the present invention, the annealing reaction system comprises 8-12 mM Tris-HCl, 40-60 mM NaCl and 0.8-1.2 mM DTT.

[0029] In some embodiments of the present invention, the annealing reaction system comprises 10 mM Tris-HCl, 50 mM NaCl and 1.0 mM DTT.

[0030] In some embodiments of the present invention, the pH value of the annealing reaction system is 7.5 to 8.5. Preferably, the pH value of the annealing reaction system is 7.8 to 8.2.

[0031] In some embodiments of the present invention, the annealing temperature is 90-98°C.

[0032] In some preferred embodiments of the present invention, the annealing temperature is 94-96°C.

[0033] In some embodiments of the present invention, the cooling rate is 2-5°C / min.

[0034] The third aspect of the present invention provides the use of a hairpin probe for detecting exonuclease activity as described in any one of the first aspect in any one of A) to D): A) Screening or identification of DNA polymerases with exonuclease activity; B) Detection of DNA polymerase exonuclease activity; C) Screening for antibodies with the function of blocking exonuclease activity; D) Prepare exonuclease activity detection reagent or kit.

[0035] The fourth aspect of the present invention provides a method for detecting exonuclease activity, comprising: contacting the hairpin probe for detecting exonuclease activity described in any one of the first aspects with an enzyme to be detected, performing a hydrolysis reaction, and then performing a fluorescent quantitative or qualitative analysis.

[0036] The method according to the embodiment of the present invention has at least the following beneficial effects: the exonuclease detection method of the present invention is simple, and only one step is required in a single reaction system to detect 3'-5' and / or 5'-3' exonuclease activity.

[0037] It can be understood that the hydrolysis reaction refers to the process of sequentially hydrolyzing phosphodiester bonds from the ends of the nucleic acid molecule chains to generate single nucleotides.

[0038] In some embodiments of the present invention, the hydrolysis reaction system includes 20-40 mmol / L Tris-HCl, 100-120 mmol / L K + 、5~8 mmol / L Mg 2+ , 50~80 μg / mL BSA, 300~500 μmol / L dNTPs. For example, the hydrolysis reaction system may include 25 mmol / L Tris-HCl, 100 mmol / L K + 、5 mmol / L Mg 2+ , 50ug / mL BSA, 300 μmol / L dNTPs.

[0039] In some embodiments of the present invention, the pH of the hydrolysis reaction system is 7.2-9.2.

[0040] In some embodiments of the present invention, the enzyme to be detected includes but is not limited to enzymes with exonuclease activity such as DNA polymerase and exonuclease.

[0041] In some preferred embodiments of the present invention, the DNA polymerase includes Taq DNA polymerase and high-fidelity DNA polymerase.

[0042] Other features and advantages of the present invention will be set forth in the description which follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The schematic diagram of the structure of the hairpin probe used for detecting the 3' and / or 5' end exonuclease activity of the present invention; Figure 2 The schematic diagram of the structure of the hairpin probe used for detecting 5' end exonuclease activity of the present invention; Figure 3 The schematic diagram of the structure of the hairpin probe used for detecting 3' end exonuclease activity of the present invention; Figure 4 The fluorescence detection result of the hairpin probe Probe 1 of the present invention detecting Taq DNA polymerase alone, wherein the blue color corresponds to the 5'-3' exonuclease activity and the red color corresponds to the 3'-5' exonuclease activity; Figure 5 The fluorescence detection result of the hairpin probe Probe 1 of the present invention detecting HF DNA polymerase alone, wherein the blue color corresponds to the 5'-3' exonuclease activity and the red color corresponds to the 3'-5' exonuclease activity; Figure 6 The fluorescence detection result of the hairpin probe Probe 1 of the present invention detecting eTaq DNA polymerase alone, wherein the blue color corresponds to the 5'-3' exonuclease activity and the red color corresponds to the 3'-5' exonuclease activity; Figure 7 This is the blank control fluorescence detection result based on the hairpin probe Probe 1 of the present invention; Figure 8 The fluorescence detection results of the hairpin probe Probe 1 of the present invention for simultaneously detecting Taq DNA polymerase and HF DNA polymerase, wherein the blue color corresponds to the 5'-3' exonuclease activity and the red color corresponds to the 3'-5' exonuclease activity; Fig. 9 The fluorescence detection results of the hairpin probe Probe 2 of the present invention detecting three DNA polymerases alone; Fig.10 The fluorescence detection results of the hairpin probe Probe 3 of the present invention detecting three DNA polymerases separately. DETAILED DESCRIPTION

[0044] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0045] The words "preferably", "more preferably", etc. in the present invention refer to embodiments of the present invention that may provide certain beneficial effects in certain circumstances. However, other embodiments may also be preferred under the same circumstances or other circumstances. In addition, the description of one or more preferred embodiments does not imply that other embodiments are not applicable, nor is it intended to exclude other embodiments from the scope of the present invention.

[0046] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0047] In the description of the present invention, the reference term "and / or" includes all and any combinations of one or more of the associated listed items.

[0048] In the description of the present invention, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0049] In the description of the present invention, unless otherwise specified, the room temperature refers to 25±5°C.

[0050] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0051] Invention concept: The present invention designs a hairpin probe for detecting the exonuclease activity of 3' and / or 5' end DNA polymerase, and its structural schematic diagram is shown in FIG. Figure 1 As shown, the hairpin probe is composed of a single-stranded oligonucleotide, which includes region a, region b, region c, region d, region e, region f and region g in sequence from the 5' end, wherein: The a region is reverse complementary to the c region to form the stem of the first stem-loop structure, the nucleotide lengths of the a region and the c region are 10 nt to 16 nt, the 5' end of the a region is labeled with a fluorescent group, and the 3' end of the a region is labeled with a quenching group; The b region connects the a region and the c region to independently form a loop portion of the first stem-loop structure; The d region connects the c region and the e region; The e region and the g region are reverse complementary to each other to form the stem of the second stem-loop structure, the nucleotide lengths of the e region and the g region are 10 nt to 16 nt, the 5' end of the g region is labeled with a quenching group, and the 3' end of the g region is labeled with a fluorescent group; The f region connects the e region and the g region to independently form a loop portion of a second stem-loop structure.

[0052] The present invention realizes the detection of 3'-5' and / or 5'-3' exonuclease activity in a single reaction system by designing a hairpin probe with two stem-loop structures and designing different fluorescent groups at the 3' end and the 5' end thereof respectively. The signal generation of the hairpin probe of the present invention depends on the fluorescence resonance energy transfer (FRET) effect between the fluorescent group and the quenching group. When there is no target enzyme, the fluorescent group and the quenching group are close, and the fluorescence is in a quenched state. When the target enzyme reacts with the fluorescent probe, the probe structure changes, resulting in the separation of the two groups, thereby restoring the fluorescence. Based on this principle, the detection of 3' and / or 5' end exonuclease activity can be realized.

[0053] In some specific embodiments, considering the binding effect between the enzyme to be detected and the hairpin probe, the nucleotide length of the a region and the c region in the present invention is preferably 10 nt to 16 nt, and the nucleotide length of the e region and the g region is preferably 10 nt to 16 nt. Generally, if the distance is too short, it may form an obstruction, which will affect the binding efficiency between the enzyme to be detected and the hairpin probe, and then affect the detection sensitivity; if the distance is too long, the quenching effect may not be achieved well, and the blank fluorescence intensity may be high, which will also affect the detection sensitivity. Therefore, when designing the probe, it is preferably designed that the distance between the fluorescent group and the quenching group is 10 to 16 bases.

[0054] In some specific embodiments, the nucleotide length of region b and region f is preferably 10 nt~16 nt, and region b and region f constitute the loop portion of the first stem-loop structure and the loop portion of the second stem-loop structure, respectively. Taking into account the preparation cost and difficulty, the nucleotide length of region b and region f is preferably 10 nt~16 nt. If the loop structure is too short, the pre-designed hairpin structure may not be well formed after annealing; if the loop structure is too long, the difficulty of probe synthesis will be increased, resulting in the inability to synthesize the preset stem-loop structure.

[0055] In some embodiments, the nucleotide length of the d region is preferably 10 nt to 18 nt, more preferably 10 nt to 15 nt. If the d region is too short, it may affect the binding of the enzyme to the probe and thus affect the subsequent reaction; while if it is too long, it is not conducive to the synthesis of the probe.

[0056] In some specific embodiments, the fluorescent group can be a common detectable luminescent group, including but not limited to FAM, HEX, TRAMA, VIC, CY5 and JOE, and the quenching group can also be a common group that can quench the corresponding fluorescent group, including but not limited to BHQ1, BHQ2, TAMRA and MGB.

[0057] Example 1: Preparation of hairpin probe for detecting DNA polymerase exonuclease activity This example provides a method for designing, synthesizing and preparing a hairpin probe for detecting 3'-5' exonuclease activity and / or 5'-3' exonuclease activity, which specifically includes the following contents: 1. Preparation of hairpin probes for detecting 3' and / or 5' exonuclease activity The hairpin probe of this embodiment is composed of a single-stranded oligonucleotide, which includes region a, region b, region c, region d, region e, region f and region g in sequence from the 5' end, wherein: Region a is reverse complementary to region c, forming the stem of the first stem-loop structure. The nucleotide length of region a and region c is 13 nt. The nucleotide sequence of region a is 5'-TACTACTGGGAAT-3' (SEQ ID NO: 1), and the thymine at the 5' end is labeled with a fluorescent group VIC, and the thymine at the 3' end is labeled with a quenching group BHQ1. The nucleotide sequence of region c is 5'-TTCCCAGTAGTA-3' (SEQ ID NO: 2); Region b connects region a and region c to independently form the loop portion of the first stem-loop structure. Region b consists of 16 bases, and the nucleotide sequence is 5'-AAGTTAAGACCTATGA-3' (SEQ ID NO: 3); The d region connects the c region and the e region, consists of 15 bases, and the nucleotide sequence is: 5'-GAGACGGGGGAGACG-3' (SEQ ID NO: 4); The e region and the g region are reverse complementary to each other, forming the stem of the second stem-loop structure. The nucleotide length of the e region and the g region is 14 nt. The nucleotide sequence of the e region is 5'-ACTACGGGGGTACT-3' (SEQ ID NO: 5), and the nucleotide sequence of the g region is 5'-TGTACCCCCGTAGT-3' (SEQ ID NO: 6). The thymine at the 3' end is labeled with a fluorescent group FAM, and the thymine at the 5' end is labeled with a quenching group BHQ1; The f region connects the e region and the g region to independently form the loop portion of the second stem-loop structure. The f region consists of 16 bases, and the nucleotide sequence is 5'-AGTATCCAGAATTGAA-3' (SEQ ID NO: 7).

[0058] The nucleotide sequence of the hairpin probe for detecting 3' and / or 5' end exonuclease activity is as follows: 5'-(VIC)TACTACTGGGAAT(BHQ1)AAGTTAAGACCTATGATTCCCAGTAGTAGAGACGGGGGAGACGACTACGGGGGTACAGTATCCAGAATTGAA(BHQ1)TGTACCCCCGTAGT(FAM)-3' (SEQ ID NO:8).

[0059] Based on the above nucleotide sequence information, the corresponding oligonucleotide single strand was synthesized, and then heated at 90°C for 5 min in an annealing buffer (containing 10 mM Tris-HCl, 50 mM NaCl and 1 mM DTT, pH 8.0), and then slowly cooled to room temperature at a cooling rate of 2°C / min to obtain a hairpin probe for detecting 3' and / or 5' end exonuclease activity (hereinafter referred to as Probe 1) for use.

[0060] 2. Preparation of fluorescent probe for detecting 5' end exonuclease activity As a control group, this example also prepared a fluorescent probe for detecting 5' end exonuclease activity, the structural diagram of which is shown in FIG. Figure 2As shown, the main difference from the above-mentioned hairpin probe for detecting 3' and / or 5' end exonuclease activity is that it only contains one stem-loop structure. The fluorescent probe is composed of a single-stranded oligonucleotide, and starting from the 5' end, it includes a' region, b' region, c' region and d' region in sequence, wherein a' region is reversely complementary to c' region to form the stem of the stem-loop structure, and the 5' end adenine of the a' region is labeled with a fluorescent group FAM, and the 3' end thymine is labeled with a quenching group BHQ1; The b' region connects the a' region and the c' region to form the loop portion of the stem-loop structure, and the d' region is an extended sequence of the c' region.

[0061] The nucleotide sequence of the fluorescent probe for detecting 5' end exonuclease activity is as follows: 5'-(FAM)ACTACTGGGAAAACCGAGT (BHQ1)AAGTTAAGACCTATGACTCGGTTTTCCCAGTAGTAGAGACGGGGGAGACG-3' (SEQ ID NO:9).

[0062] Based on the above nucleotide sequence information, the corresponding oligonucleotide single strand was synthesized, and then heated at 90°C for 5 min in an annealing buffer (containing 10 mM Tris-HCl, 50 mM NaCl and 1 mM DTT, pH 8.0), and then slowly cooled to room temperature to obtain a hairpin probe for detecting 5' end exonuclease activity (hereinafter referred to as Probe 2) for use.

[0063] 3. Preparation of fluorescent probe for detecting 3' end exonuclease activity As a control group, this example also prepared a fluorescent probe for detecting 3' end exonuclease activity, the structural diagram of which is shown in FIG. Figure 3 As shown, the main difference from the above-mentioned hairpin probe for detecting 3' and / or 5' end exonuclease activity is that it only contains one stem-loop structure. The fluorescent probe is composed of a single-stranded oligonucleotide, and starting from the 5' end, it includes the d' region, the e' region, the f' region and the g' region in sequence, wherein the e' region is reversely complementary to the g' region to form the stem of the stem-loop structure, and the 5' end thymine of the g' region is labeled with a quenching group BHQ1, and the 3' end thymine is labeled with a fluorescent group FAM; The f' region connects the e' region and the g' region to form the loop portion of the stem-loop structure, and the d' region is connected to the e' region.

[0064] The nucleotide sequence of the fluorescent probe for detecting 3' end exonuclease activity is as follows: 5'-TAGAGACGGGGGAGACGACTACGGGGGTACAAGCAAGTATCCAGAATTGAA (BHQ1)TTGCTTGTACCCCCGTAGT (FAM)-3' (SEQ ID NO: 10).

[0065] Based on the above nucleotide sequence information, the corresponding oligonucleotide single strand was synthesized, and then heated at 90°C for 5 min in an annealing buffer (containing 10 mM Tris-HCl, 50 mM NaCl and 1 mM DTT, pH 8.0), and then slowly cooled to room temperature to obtain a hairpin probe for detecting 3' end exonuclease activity (hereinafter referred to as Probe 3) for use.

[0066] Example 2: Exonuclease activity detection In this example, Accurate Taq HS DNA polymerase, ApexHF HS DNA polymerase-FS and Accurate Taq HS DNA polymerase were used as the test objects, and the exonuclease activities of the two were detected using the hairpin probes Probe 1, Probe 2 and Probe 3 prepared above, respectively. The specific related experiments are as follows: (1) Experimental materials ① Reaction substrate: the hairpin probes Probe 1, Probe 2 and Probe 3 prepared as described above.

[0067] ②DNA polymerase: Three different DNA polymerases were selected, namely Accurate Taq HS DNA polymerase (hereinafter referred to as Taq), ApexHF HS DNA polymerase-FS (hereinafter referred to as HF) and Accurate Taq HS DNA polymerase (hereinafter referred to as eTaq). The enzyme activities corresponding to the above DNA polymerases are shown in Table 1.

[0068] Table 1: DNA polymerase exonuclease activity

[0069] In the table, “+” represents the presence of the corresponding exonuclease activity, and “-” represents the absence of the corresponding exonuclease activity.

[0070] (2) Experimental methods Construction of reaction system: The system used to detect exonuclease activity in this example is a 25 μL reaction system, which contains: 25 mmol / L Tris-HCl, 100 mmol / L KC1, 5 mmol / L MgCl2, 50 ug / mL BSA, 0.2 μmol / L hairpin probe and 1 U enzyme to be detected, pH is 7.5, and the solvent is deionized water.

[0071] The reaction program was set as: 72°C 30s / cycles, for a total of 50 cycles.

[0072] The above test method was used for sample addition detection, and 4 replicate wells were tested for each sample. After the reaction was completed, the fluorescence detection result graph was analyzed.

[0073] (3) Experimental results The results of using the hairpin probe Probe 1 of the present invention to detect the exonuclease activity of Taq DNA polymerase are as follows Figure 4 As shown, the results of detecting HF DNA polymerase-FS exonuclease activity alone are as follows Figure 5 The results of detecting the exonuclease activity of eTaq DNA polymerase alone are shown in Figure 6 As shown, when Taq DNA polymerase or HF DNA polymerase was added alone, the fluorescence intensity increased only in the VIC detection channel (corresponding to 5'-3' exonuclease activity) or FAM detection channel (corresponding to 3'-5' exonuclease activity), respectively, indicating that Taq DNA polymerase only has 5'-3' exonuclease activity but no 3'-5' exonuclease activity, and HF DNA polymerase only has 3'-5' exonuclease activity but no 5'-3' exonuclease activity, which is consistent with the expected results. When eTaq DNA polymerase was added alone, no relevant signals were detected in both the VIC detection channel and the FAM detection channel, and the fluorescence intensity was similar to that of the blank control without enzyme solution (such as Figure 7 The results are consistent with those shown in Figure 1, indicating that eTaq DNA polymerase has no exonuclease activity, and the results are consistent with expectations. It can be seen that the hairpin probe Probe 1 of the present invention can be used to accurately distinguish the exonuclease activity of DNA polymerase.

[0074] Furthermore, the hairpin probe Probe 1 of the present invention was used to simultaneously detect the activities of Taq DNA polymerase and HF DNA polymerase-FS exonuclease. The results are as follows: Figure 8 As shown, the fluorescence intensity increased in both the VIC detection channel and the FAM detection channel. The above results show that the hairpin probe Probe 1 of the present invention can detect enzymes containing 3'-5' exonuclease activity and 5'-3' exonuclease activity separately or simultaneously, and has good specificity.

[0075] Compare the results of using fluorescent probe Probe 2 or Probe 3 (such as Fig. 9 and Fig.10As shown in the figure, it can be analyzed that in the same reaction system, fluorescent probe Probe 2 can only be used to detect the 5'-3' exonuclease activity of DNA polymerase, while fluorescent probe Probe 2 can only be used to detect the 3'-5' exonuclease activity of DNA polymerase. Moreover, when fluorescent probes Probe 2 and Probe 3 are mixed and added to the reaction system for detection at the same time, since both probes have 5' and 3' ends, the detection results will deviate from the actual results and effective detection cannot be performed.

[0076] In summary, the present invention provides a hairpin probe for detecting DNA polymerase exonuclease activity and its preparation method and application, the hairpin probe has two stem-loop structures, and the stem-loop structure is cleverly used to design different fluorescent groups at the 3' end and 5' end of its stem, so as to achieve the detection of 3'-5' and / or 5'-3' exonuclease activity under a single reaction system. Further, the hairpin probe of the present invention adopts a self-hybridizing hairpin structure, so that the fluorescent group and the quenching group are very close, the fluorescence quenching efficiency is improved, and it helps to reduce the detection background.

[0077] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A hairpin probe for detecting exonuclease activity, characterized in that: The hairpin probe comprises region a, region b, region c, region d, region e, region f and region g in sequence from the 5' end, wherein: The a region is reversely complementary to the c region, the 5' end of the a region is labeled with a first fluorescent group, and the 3' end of the a region is labeled with a first quenching group; The e region and the g region are reverse complementary pairs, the 5' end of the g region is labeled with a second quenching group, and the 3' end of the g region is labeled with a second fluorescent group; The first fluorescent group and the second fluorescent group are different from each other.

2. The hairpin probe according to claim 1, characterized in that: The nucleotide length of the a region is 10 nt to 16 nt; and / or the nucleotide length of the c region is 10 nt to 16 nt; Preferably, the nucleotide length of the e region is 10 nt to 16 nt; and / or the nucleotide length of the g region is 10 nt to 16 nt.

3. The hairpin probe according to claim 1, characterized in that: The b region connects the a region and the c region to form a ring portion; and / or the f region connects the e region and the g region to form a ring portion.

4. The hairpin probe according to claim 3, characterized in that: The lengths of the b region and the f region are independently 10 nt to 16 nt.

5. The hairpin probe according to any one of claims 1 to 4, characterized in that: The first fluorescent group and / or the second fluorescent group are selected from any one of FAM, HEX, TRAMA, VIC, CY5 or JOE.

6. The hairpin probe according to claim 5, characterized in that: The first quenching group is the same as or different from the second quenching group; And / or, the first quencher group and the second quencher group are independently selected from any one of BHQ1, BHQ2, TAMRA, and MGB.

7. The hairpin probe according to claim 6, characterized in that: The nucleotide sequence of the hairpin probe is shown in SEQ ID NO: 8, wherein: The first fluorescent group is modified at the first base, and the first quenching group is modified at the 13th base; The second fluorescent group is modified at the 99th base, and the second quenching group is modified at the 86th base.

8. A method for preparing a hairpin probe for detecting exonuclease activity according to any one of claims 1 to 7, characterized in that: include: The nucleotide sequence of the hairpin probe is obtained and a corresponding oligonucleotide single strand containing the first fluorescent group, the first quenching group, the second fluorescent group and the second quenching group is synthesized, and then annealed and cooled to obtain the single strand.

9. Use of the hairpin probe for detecting exonuclease activity as claimed in any one of claims 1 to 7 in any one of A) to D): A) Screening or identification of DNA polymerases with exonuclease activity; B) Detection of DNA polymerase exonuclease activity; C) Screening for antibodies with the function of blocking exonuclease activity; D) Prepare exonuclease activity detection reagent or kit.

10. A method for detecting exonuclease activity, characterized in that: include: The hairpin probe for detecting exonuclease activity according to any one of claims 1 to 7 is contacted with an enzyme to be detected, and a hydrolysis reaction is performed, and then a fluorescence quantitative or qualitative analysis is performed.

Images