Method for efficiently and quickly constructing specific library

Abstract

The invention discloses a method for efficiently and quickly constructing a specific library, and relates to the technical field of second-generation gene sequencing improvement. Traditional library construction steps (such as DNA fragmentation, terminal repair, linker connection, amplification and the like) are integrated into a reaction system, a specific primer and an index primer are connected through an accompanying primer under the action of ligase, then specific PCR is performed, and reaction conditions are optimized, so that all the steps can be completed in one tube of reagent and one PCR reaction. The library construction process is greatly simplified, the library construction time is shortened, aerosol pollution is greatly reduced, and the library construction efficiency and quality are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of second-generation gene sequencing improvement, and in particular to a method for efficiently and quickly constructing a specific library. Background Art

[0002] There are two main methods for constructing a second-generation sequencing library for detecting specific sites: 1. Multiplex PCR, the basic principle of which is to add multiple pairs of specific primers to a reaction system. These primers can bind to specific regions of the target DNA sequence respectively, and amplify multiple target DNA fragments at the same time through PCR amplification reaction. These amplified fragments will then be added with adapters adapted to the sequencing platform to form a sequencing library for subsequent sequencing analysis; 2. Hybridization capture method, which obtains the target fragment library through fragmentation, end repair, adapter connection, PCR amplification and hybridization capture processes.

[0003] Disadvantages of existing technologies: 1. Multiplex PCR library construction method: In conventional multiplex PCR library construction technology, a series of operations need to be carried out in multiple steps, and contaminants may be introduced during each uncapping operation. 2. Hybridization capture library construction method: Since specific probes and special materials are required, the operation is more complicated, so the cost is relatively high and the process time is longer. Due to the complexity and variability of DNA sequences, hybridization capture may cause problems of missed capture and mismatch, reducing the accuracy and coverage of the library. Summary of the invention

[0004] The purpose of the present invention is to provide a method for constructing a specific library efficiently and quickly in view of the defects and shortcomings of the prior art. The method can integrate the traditional library construction steps into one reaction system, simplify the library construction process, shorten the library construction time, greatly reduce aerosol pollution, and improve the efficiency and quality of library construction. The method has high efficiency, rapidity, accuracy and flexibility, and realizes one-tube one-step library construction.

[0005] To achieve the above-mentioned purpose, the present invention adopts the following technical scheme: the method comprises the following steps: 1. preparing a PCR mixture according to the required material ratio; 2. gently shaking and mixing the prepared reaction solution, and centrifuging briefly; 3. reacting the prepared PCR mixture on a PCR instrument under the corresponding time and temperature conditions; 4. taking 25 μL of magnetic bead PCR product, mixing it by pipetting or vortexing, and standing at room temperature for 5 minutes; 5. instantaneous centrifugation, placing it on a magnetic stand, standing for 3 minutes, discarding the supernatant after the liquid is clarified, and avoiding touching the magnetic beads; 6. adding 180 μL 80% ethanol, standing for 30 seconds, and discarding the supernatant after the solution is clarified; 7. repeating the previous step, washing twice in total; 8. using a 10 μL pipette to absorb the residual ethanol, standing at room temperature for 1 minute, ensuring that the ethanol evaporates cleanly, but not over-drying; 9. removing the tube from the magnetic stand, adding 25 μL Nuclease-Free 10. Place the tube on a magnetic rack for 3 minutes to allow the solution to clarify. 11. Pipette 22.5 μL of supernatant, transfer to a new tube, and measure the library concentration and fragment size.

[0006] Furthermore, in the step 1, the materials in the PCR mixture include DNA template, 5×AssemplexMultiplex Buffer, Assemplex Multiplex Enzyme, specific primer Panel, and Index primer, and the ratios are 15:5:1:2:2, and the total number of parts is 25.

[0007] DNA template 15 5×Assemplex Multiplex Buffer 5 Assemplex Multiplex Enzyme 1 Specific Primer Panel 2 Index Primers 2 total 25

[0008] Furthermore, in the step three, the reaction temperature and time of the PCR mixture on the PCR instrument correspond to a temperature of 37°C and a reaction time of 10 minutes; a temperature of 95°C and a reaction time of 3 minutes; the reaction temperature is reduced from 95°C to 60°C, and the temperature of 95°C corresponds to a reaction time of 30 seconds; the temperature of 72°C and 60°C correspond to a reaction time of 1 minute; when the reaction temperature is stabilized at 72°C, the reaction time is 2 minutes; and when the reaction temperature is 4°C, the reaction is stopped and continued.

[0009]

[0010] Furthermore, the specific primer Panel is

[0011] Panel F: 5P-CCCTACACGACGCTCTTCCGATCT-(specific sequence)-3', panel R: 5P-TTCAGACGTGTGCTCTTCCGATCT-(specific sequence)-3.

[0012] The further described Index primer is

[0013] 5'-AATGATACGGCGACCACCGAGATCTACAC[i5 Barcode]ACACTCTTT-3', 5'-CAAGCAGAAGACGGCATACGAGAT[i7'Barcode]GTGACTGGAG-3'.

[0014] Furthermore, there are two types of accompanying primers required in step 1.

[0015] Accompanying primer 1: 5'-GTCGTGTAGGGAAAGAGTGT-3', accompanying primer 2: 5'-ACACGTCTGAACTCCAGTCAC-3'.

[0016] The working principle of the present invention is as follows: by integrating the traditional library construction steps (such as DNA fragmentation, end repair, adapter ligation, amplification, etc.) into one reaction system, connecting the specific primer and the index primer through the accompanying primer under the action of the ligase, and then performing specific PCR, and optimizing the reaction conditions, all steps can be completed in one tube of reagent and one PCR reaction.

[0017] After adopting the above technical solution, the beneficial effects of the present invention are as follows: the method greatly simplifies the library construction process, shortens the library construction time, greatly reduces aerosol pollution, and improves the efficiency and quality of library construction. The high efficiency is reflected in: the one-tube one-step library construction integrates multiple steps into one reaction system, greatly simplifies the library construction process, and improves efficiency.

[0018] The rapidity is reflected in that since all steps are completed in one reaction system, the library construction time is greatly shortened.

[0019] Accuracy is reflected in the fact that by optimizing reaction conditions and primer design, the one-tube one-step library construction can ensure accurate amplification and adapter ligation of target DNA fragments.

[0020] Flexibility is reflected in the following aspects: one-tube one-step library construction can flexibly design primer combinations according to experimental requirements to adapt to different experimental designs and research directions. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0022] Figure 1 It is a schematic diagram of the working principle flow of the present invention;

[0023] Figure 2 1 is a display diagram of the detection results in an embodiment of the present invention. DETAILED DESCRIPTION

[0024] See also Figure 1-2 As shown, the technical solution adopted in this specific implementation method is: this method includes the following steps: 1. Prepare PCR mixture according to the required material ratio; 2. Gently shake and mix the prepared reaction solution, and centrifuge briefly; 3. React the prepared PCR mixture on the PCR instrument under the corresponding time and temperature conditions; 4. Take 25μL magnetic bead PCR product, mix it by pipetting or vortexing, and let it stand at room temperature for 5 minutes; 5. Centrifuge instantly, place it on the magnetic rack, let it stand for 3 minutes, and discard the supernatant after the liquid is clarified to avoid touching the magnetic beads; 6. Add 180μL 80% ethanol, let it stand for 30s, and discard the supernatant after the solution is clarified; 7. Repeat the previous step and wash twice in total; 8. Use a 10μL pipette to absorb the residual ethanol, let it stand at room temperature for 1 minute, ensure that the ethanol evaporates cleanly, but do not over-dry; 9. Remove the tube from the magnetic rack and add 25μL Nuclease-Free 10. Place the tube on a magnetic rack for 3 minutes to allow the solution to clarify. 11. Pipette 22.5 μL of supernatant, transfer to a new tube, and measure the library concentration and fragment size.

[0025] Furthermore, in the step 1, the materials in the PCR mixture include DNA template, 5×AssemplexMultiplex Buffer, Assemplex Multiplex Enzyme, specific primer Panel, and Index primer, and the ratios are 15:5:1:2:2, and the total number of parts is 25.

[0026] DNA template 15 5×Assemplex Multiplex Buffer 5 Assemplex Multiplex Enzyme 1 Specific Primer Panel 2 Index Primers 2 total 25

[0027] Furthermore, in the step three, the reaction temperature and time of the PCR mixture on the PCR instrument correspond to a temperature of 37°C and a reaction time of 10 minutes; a temperature of 95°C and a reaction time of 3 minutes; the reaction temperature is reduced from 95°C to 60°C, and the temperature of 95°C corresponds to a reaction time of 30 seconds; the temperature of 72°C and 60°C correspond to a reaction time of 1 minute; when the reaction temperature is stabilized at 72°C, the reaction time is 2 minutes; and when the reaction temperature is 4°C, the reaction is stopped and continued.

[0028]

[0029] Furthermore, the specific primer Panel is

[0030] Panel F: 5P-CCCTACACGACGCTCTTCCGATCT-(specific sequence)-3', panel R: 5P-TTCAGACGTGTGCTCTTCCGATCT-(specific sequence)-3.

[0031] The further described Index primer is

[0032] 5'-AATGATACGGCGACCACCGAGATCTACAC[i5 Barcode]ACACTCTTT-3', 5'-CAAGCAGAAGACGGCATACGAGAT[i7'Barcode]GTGACTGGAG-3'.

[0033] Furthermore, there are two types of accompanying primers required in step 1.

[0034] Accompanying primer 1: 5'-GTCGTGTAGGGAAAGAGTGT-3', accompanying primer 2: 5'-ACACGTCTGAACTCCAGTCAC-3'.

[0035] Example:

[0036] Two mutation standards, EGFR L858R and EGFR 19del, were used and tested at mutation abundances of 1% and 5%.

[0037]

[0038]

[0039] Primers used:

[0040] EGFR 19del-F:CCCTACACGACGCTCTTCCGATCTTGGATCCCAGAAGGTGAGAAAGT EGFR19del-R:TTCAGACGTGTGCTCTTCCGATCTGTGGGCCTGAGGTTCAGAGC

[0041] EGFR L858R-F:CCCTACACGACGCTCTTCCGATCTGGAGGACCGTCGCTTGG

[0042] EGFR L858R-R:TTCAGACGTGTGCTCTTCCGATCTTGCATGGTATTCTTTCTCTTCCG

[0043] Test results:

[0044] Sample GENE HGVSCP VAF 01 EGFR c.2235_2249del(p.E746_A750del) 0.88％ 01 EGFR c.2573T>G(p.L858R) 1.67％ 02 EGFR c.2235_2249del(p.E746_A750del) 6.02％ 02 EGFR c.2573T>G(p.L858R) 7.72％

[0045] Conclusion: With an input as low as 1 ng, mutations with 1% and 5% abundance can be effectively detected.

[0046] The above description is only used to illustrate the technical solution of the present invention rather than to limit it. Other modifications or equivalent substitutions made to the technical solution of the present invention by ordinary technicians in this field should be included in the scope of the claims of the present invention as long as they do not depart from the spirit and scope of the technical solution of the present invention.

Claims

1. A method for efficiently and quickly constructing a specific library, characterized in that It includes the following steps: Step 1: Prepare the PCR mixture according to the required material ratio; Step 2: Gently shake and mix the prepared reaction solution, and centrifuge; Step 3: React the prepared PCR mixture on the PCR instrument under the corresponding time and temperature conditions; Step 4: Take 25μL of magnetic bead PCR product, mix it by pipetting or vortexing, and let it stand at room temperature for 5 minutes; Step 5: Centrifuge instantly, place it on the magnetic rack, let it stand for 3 minutes, and discard the supernatant after the liquid is clear to avoid touching the magnetic beads; Step 6: Add 180μL 80% ethanol, let it stand for 30s, and discard the supernatant after the solution is clear; Step 7: Repeat the previous step and wash twice in total; Step 8: Use a 10μL pipette to absorb the residual ethanol, let it stand at room temperature for 1 minute, and ensure that the ethanol evaporates completely, but do not over-dry; Step 9: Remove the tube from the magnetic rack and add 25μL Nuclease-Free Water, pipette or vortex to mix, and let stand at room temperature for 5 minutes; Step 10, place the tube on the magnetic rack for 3 minutes to wait for the solution to clarify; Step 11, aspirate 22.5μL of supernatant, transfer to a new tube, and measure the library concentration and fragment size.

2. The method for constructing a specific library efficiently and quickly according to claim 1, characterized in that: In the step 1, the materials in the PCR mixture include DNA template, 5×Assemplex Multiplex Buffer, AssemplexMultiplex Enzyme, specific primer Panel, and Index primer, and the ratio is 15:5:1:2:2, and the total number of parts is 25.

3. The method for constructing a specific library efficiently and quickly according to claim 1, characterized in that: In the step three, the reaction temperature and time of the PCR mixture on the PCR instrument correspond to a temperature of 37°C and a reaction time of 10 minutes; a temperature of 95°C and a reaction time of 3 minutes; a temperature drop from 95°C to 60°C, a temperature of 95°C and a corresponding reaction time of 30 seconds; a temperature of 72°C and a temperature of 60°C and a corresponding reaction time of 1 minute each; when the reaction temperature stabilizes at 72°C, the reaction time is 2 minutes; and when the reaction temperature is 4°C, the reaction is stopped and continued.

4. The method for constructing a specific library efficiently and quickly according to claim 2, characterized in that: The specific primer panels are panel F: 5P-CCCTACACGACGCTCTTCCGATCT-(specific sequence)-3', panel R: 5P-TTCAGACGTGTGCTCTTCCGATCT-(specific sequence)-3'.

5. The method for constructing a specific library efficiently and quickly according to claim 2, characterized in that: The Index primers are 5'-AATGATACGGCGACCACCGAGATCTACAC[i5 Barcode]ACACTCTTT-3' and 5'-CAAGCAGAAGACGGCATACGAGAT[i7' Barcode]GTGACTGGAG-3'.

6. The method for constructing a specific library efficiently and quickly according to claim 2, characterized in that: There are two kinds of accompanying primers required in step 1. Accompanying primer 1: 5'-GTCGTGTAGGGAAAGAGTGT-3', accompanying primer 2: 5'-ACACGTCTGAACTCCAGTCAC-3'.

Images