MiRNA as Parkinson's disease biomarker and diagnostic kit using same

Abstract

The present invention relates to a method for providing information for diagnosing Parkinson's disease. Also, the present invention relates to a composition for preventing, ameliorating or treating Parkinson's disease. The expression of the miRNA provided by the invention is specifically down-regulated or up-regulated in a Parkinson's disease model, so that the miRNA can be effectively used for diagnosis and treatment of Parkinson's disease.

Description

[0001] This application is a divisional application of a Chinese patent application filed on July 17, 2018, with application number 201880059124.3 and invention name “miRNA as a biomarker for Parkinson's disease and a diagnostic kit using the same”. Technical Field

[0002] The present invention relates to a method for diagnosing Parkinson's disease using at least one miRNA whose expression is down-regulated or up-regulated in Parkinson's disease and a composition for preventing or treating Parkinson's disease using the miRNA. Background Art

[0003] Parkinson's disease is a degenerative disease of the central nervous system that begins with the degeneration of neurons in the substantia nigra pars compacta of the midbrain and has morbid physiological symptoms such as a decrease in brain volume and aggregation of α-synuclein (αSyn). The disease is accompanied by symptoms such as gait disorders, hand tremors, and rigid movements.

[0004] In 2010, the number of Parkinson's disease patients in South Korea was 61,565, with an average annual growth rate of 8.7%. In 2014, the number increased to 85,888. Among the patients in 2014, 95.7% were over 60 years old. The prevalence rate is correlated with the age of the patients. The number of male and female Parkinson's disease patients was 33,831 and 52,057 respectively (The number of Parkinson's disease patients and medical expenses have been increasing in the past five years, Young Korean Doctors, 2015).

[0005] The number of Parkinson's disease patients in seven major countries (the United States, Japan, France, Germany, Italy, Spain, and the United Kingdom) was approximately 4.54 million in 2008 and 5.05 million in 2012, with an average annual increase of 2.72%. In Asian countries, the number of Parkinson's disease patients increased from 1.98 million in 2008 to 2.19 million in 2012, and in European countries, the number of Parkinson's disease patients increased from 820,000 in 2008 to 910,000 in 2012 (Product and Pipeline Analysis of the Global Parkinson's Disease Therapeutic Market, F&S, 2014).

[0006] Looking at the product trends of Parkinson's disease therapeutics worldwide, dopamine agonists, which accounted for the largest share of 47% in 2011, are expected to drop to 42% by 2021, and new pipeline drugs are expected to account for about 20% by 2021 (R&D Trends: Parkinson's Disease, Datamonitor, 2012).

[0007] Various tests related to the diagnosis of Parkinson's disease include 1) positron emission tomography (PET) test, 2) magnetic resonance imaging (MRI) test, and 3) tests related to internal medicine diseases.

[0008] Brain dopamine transporter positron emission tomography (PET) can determine whether dopamine cells are damaged. If PET is performed, it can be used to detect whether Parkinson's symptoms are caused by causes other than Parkinson's disease. In the case of drug-induced Parkinson's syndrome, vascular Parkinson's syndrome, Alzheimer's disease-related Parkinson's symptoms, and essential tremor-related Parkinson's symptoms, at first glance, there are often tremors and bradykinesia similar to Parkinson's symptoms, but dopamine neurons are normal.

[0009] In the case of Parkinson's symptoms, it is necessary to distinguish diseases similar to Parkinson's disease. In order to distinguish Parkinson's disease from secondary Parkinson's syndrome and atypical Parkinson's syndrome, a brain magnetic resonance imaging (MRI) examination is required. In the case of patients with Parkinson's disease, MRI examination results are normal, on the contrary, MRI examination results of diseases other than Parkinson's disease are characteristic.

[0010] In the case of medical diseases, medical examinations (blood tests, urine tests, electrocardiograms, chest X-rays) are performed during the diagnosis of Parkinson's disease to confirm the onset and progression of other medical diseases that often cause general weakness and are mistaken for Parkinson's symptoms.

[0011] However, the above-mentioned Parkinson's disease diagnosis method has the problems of high cost and complicated diagnostic steps. Lundbeck, a Danish company that focuses on the treatment and diagnosis of Parkinson's disease, mentions the importance of developing tools for rapid diagnosis of Parkinson's disease on its homepage, but currently does not sell commercial reagents or kits. In addition, the number of patients with Parkinson's disease has increased rapidly year by year, and the market for Parkinson's disease therapeutic agents has also grown rapidly in proportion to this. However, the current development of the Parkinson's disease diagnosis market is very small. Therefore, there is an urgent need to develop a technology for distinguishing Parkinson's disease from similar diseases to quickly and economically diagnose Parkinson's disease and a technology for treating Parkinson's disease while diagnosing Parkinson's disease.

[0012] The description of the background art described above is only used to enhance the understanding of the background of the present invention and should not be construed as the prior art known to ordinary technicians in this technical field. Summary of the invention

[0013] Technical issues

[0014] The present inventors have worked hard and intensively to develop a technology for distinguishing Parkinson's disease from similar diseases to rapidly and economically diagnose Parkinson's disease and a technology for treating Parkinson's disease while diagnosing Parkinson's disease. As a result, they found that the expression level of a specific miRNA in a Parkinson's disease model is specifically upregulated or downregulated, and confirmed that it can be used to effectively diagnose and treat Parkinson's disease, and based on this finding, they completed the present invention.

[0015] Therefore, it is an object of the present invention to provide a method for providing information for diagnosing Parkinson's disease.

[0016] Another object of the present invention is to provide a kit for diagnosis or prognosis analysis of Parkinson's disease.

[0017] Another object of the present invention is to provide a method for screening substances that induce Parkinson's disease.

[0018] Still another object of the present invention is to provide a method for screening therapeutic agents for Parkinson's disease.

[0019] Another object of the present invention is to provide a composition for preventing, improving or treating Parkinson's disease.

[0020] Another object of the present invention is to provide a method for treating Parkinson's disease.

[0021] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, the claims and the accompanying drawings.

[0022] Means of solving the problem

[0023] One aspect of the present invention provides a method for providing information for diagnosing Parkinson's disease, comprising:

[0024] (a) comparing the expression level of one or more miRNAs selected from miR-494-3p, miR-501-5p, miR-1244, miR-6768-5p, miR-4324 and miR-4726-5p in a sample obtained from a subject with the expression level of the selected miRNA in a normal sample; and

[0025] (b) When the expression level of the selected miRNA in the sample of the subject is lower than the expression level of the selected miRNA in the normal sample, Parkinson's disease is diagnosed.

[0026] According to a preferred embodiment of the present invention, the method further comprises:

[0027] (a) comparing the expression level of one or more miRNAs selected from miR-1226-5p, miR-4767 and miR-3064-5p in a sample obtained from a subject with the expression level of the selected miRNA in a normal sample; and

[0028] (b) When the expression level of the selected miRNA in the sample of the subject is higher than the expression level of the selected miRNA in the normal sample, Parkinson's disease is diagnosed.

[0029] Another aspect of the present invention provides a method for providing information for diagnosing Parkinson's disease, comprising:

[0030] (a) comparing the expression level of one or more miRNAs selected from miR-1226-5p, miR-4767 and miR-3064-5p in a sample obtained from a subject with the expression level of the selected miRNA in a normal sample; and

[0031] (b) When the expression level of the selected miRNA in the sample of the subject is higher than the expression level of the selected miRNA in the normal sample, Parkinson's disease is diagnosed.

[0032] In this specification, unless otherwise specified, the term "miRNA" is used to refer to a non-coding RNA of 15 to 25 bases, which is transcribed as an RNA precursor of a hairpin structure, and is cleaved by a dsRNA cleavage enzyme having RNase III cleavage activity to be introduced into a protein complex called RISC, and is involved in the translation inhibition of mRNA. In addition, the miRNA used in this specification includes not only miRNAs shown in a specific nucleotide sequence (or sequence), but also precursors (pre-miRNA, pri-miRNA) of the above-mentioned miRNAs, miRNAs with biological functions equivalent thereto, such as homologs (i.e., homologs or orthologs), variants of gene polymorphisms, and derivatives thereof. These precursors, homologs, variants or derivatives can be specifically determined by miRBaserelease 20 (http: / / www.mirbase.org / ), and under strict conditions, examples thereof include miRNAs having sequences that hybridize with the complementary sequences of miRNAs of sequence 1 to sequence 9. Furthermore, the miRNA used in the present specification may also be a gene product of a miR gene, which gene product includes a mature miRNA (e.g., a non-coding RNA of 15 to 25 bases or 19 to 25 bases involved in the translational inhibition of mRNA as described above) or a miRNA precursor (e.g., a pre-miRNA or pri-miRNA as described above).

[0033] In this specification, the term "nucleic acid" refers to nucleic acids including RNA, DNA and RNA / DNA (chimera). The above-mentioned DNA includes any one of cDNA, genomic DNA and synthetic DNA. The above-mentioned RNA includes any one of total RNA, mRNA, rRNA, miRNA, siRNA, snoRNA, snRNA, non-coding RNA and synthetic RNA. In this specification, the terms "synthetic DNA" and "synthetic RNA" refer to DNA and RNA artificially prepared according to a specified base sequence (any one of a natural sequence or a non-natural sequence), such as by using an automatic nucleic acid synthesizer. In this specification, the term "non-natural sequence" is used in a broad sense, including sequences different from natural sequences, such as substitutions, deletions, insertions and / or additions of one or more nucleotides (ie, variant sequences), sequences including one or more modified nucleotides (ie, modified sequences), etc. In addition, in this specification, polynucleotides and nucleic acids are used interchangeably.

[0034] The "subject" used in this specification is understood to include mammals, such as humans, primates such as chimpanzees, pets such as dogs and cats, livestock such as cows, horses, sheep, goats, rodents such as mice and rats, etc. The "normal group" used in this specification also has the same meaning as the "subject", indicating a subject that is detected to be free of Parkinson's disease.

[0035] As long as the sample included in the present invention is naturally or artificially separated from the subject, including the Parkinson's disease-related genetic information of the subject, there is no limitation. Preferably, the sample is separated from feces, cells, blood, plasma, serum, hair or urine, etc., and more preferably, the sample is blood, plasma, serum, etc. separated from the body.

[0036] The method of providing information for diagnosing Parkinson's disease of the present invention can be carried out using various known test methods, such as hybridization, immunoassay, or gene amplification, but is not limited thereto.

[0037] The above hybridization method confirms the presence of miRNA by using a probe.

[0038] The term "probe" used in this specification is a natural or modified monomer or linked linear oligomer, and the probe is intended to include deoxyribonucleotides and ribonucleotides, which can specifically hybridize with the target nucleotide sequence and are naturally present or artificially synthesized. Preferably, the probe of the present invention is single-stranded and is an oligodeoxyribonucleotide.

[0039] In the case where the diagnostic method of the present invention can be implemented in a microarray mode in a hybridization mode, the probes as described above are used as hybridization array elements and fixed on a substrate. The preferred substrate is a rigid or semi-rigid carrier, examples of which include membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubes, plates, polymers, microparticles and capillaries. The hybridization array elements are arranged on the substrate as described above and fixed. The immobilization as described above is implemented by chemical bonding or covalent bonding and methods such as ultraviolet light (UV). For example, the hybridization array elements can be combined with glass surfaces, so it is necessary to include modifications of epoxy compounds or aldehyde groups, and can be combined with UV on polylysine coated surfaces. Alternatively, the hybridization array elements can be combined with the substrate through a connector (e.g., ethylene glycol oligomers and diamines).

[0040] On the other hand, the sample DNA suitable for the microarray of the present invention can be optionally labeled and hybridized with the array elements on the microarray. Hybridization can be performed in various ways. Moreover, the detection and analysis of the degree of hybridization can be implemented in various ways according to the labeling substance.

[0041] The label of the probe can provide a signal that can detect whether hybridization occurs, and the labeled probe can be connected to the oligonucleotide. Suitable labels include, but are not limited to, fluorescent groups (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, Cy3 and Cy5 (Pharmacia), terminal deoxynucleotidyl transferase (TdT), chromophores, chemiluminescent groups, magnetic particles, radioisotopes (P32 or S35), mass markers, electron-dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates associated with enzymes, heavy metals (e.g., gold), haptens with specific binding partners, such as antibodies, streptavidin, biotin, digoxigenin, and chelating groups. Labeling can be carried out by various methods commonly used in the art, such as nick translation, random primer method (MultiprimeDNA labelling systems booklet, "Amersham" (1989)) and 5' end phosphorylation method (Maxam & Gilbert, Methods in Enzymology, 65: 499 (1986)). Labeling provides a signal that can be detected by fluorescence, radiation energy, color detection, weight detection, X-ray diffraction or absorption, magnetism, enzyme activity, mass analysis, binding affinity, hybridization, high frequency, or nanocrystals.

[0042] When a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined by an optimization program in a series of processes. In order to establish the protocol to be used in the laboratory, the ordinary technician implements this program through a series of processes. For example, the conditions such as temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength vary according to various factors such as the length and GC content of the probe, the target nucleotide sequence, etc. The specific conditions for hybridization can be confirmed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. NY (1999).

[0043] After the hybridization reaction, the hybridization signal generated by the hybridization reaction is detected. The hybridization signal can be implemented in various ways, such as depending on the type of label bound to the probe. For example, when the probe is labeled with an enzyme, the presence or absence of hybridization can be confirmed by reacting the substrate of the above enzyme with the hybridization reaction product. The enzyme / substrate combination that can be used is peroxidase (for example, horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-fluorescein, lucigenin (bis-N-methylacridine nitrate), benzyloxyresorufin, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxy) The probes include 2,2-azino-bis(3-ethyl-benzothiazoline sulfonate) (ABTS), o-phenylenediamine (OPD) and naphthol / pyroxine; alkaline phosphatase and bromochloroindole phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrate; glucose oxidase and t-nitroblue tetrazolium (t-NBT) and phenazine dimethyl sulfate (m-PMS), etc. When the probe is labeled with gold particles, it can be detected by silver staining using silver nitrate.

[0044] When the hybridization signal associated with the miRNA sequence is upregulated or downregulated in the biological sample compared to a normal sample, the subject is diagnosed as having Parkinson's disease.

[0045] The method of providing information for diagnosing Parkinson's disease of the present invention can be implemented by an immunoassay method. The above-mentioned immunoassay method includes radiant energy immunoassay, radiant energy immunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture ELISA, inhibition or competition analysis, sandwich immunoassay, flow cytometry, immunofluorescence staining and immunoaffinity purification, but is not limited thereto. The above-mentioned immunoassay method is described in Enzyme Immunoassay, ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, the above-mentioned documents are incorporated into this specification by reference.

[0046] The method of providing information for diagnosing Parkinson's disease of the present invention can be implemented by a gene amplification method. The detection of miRNA using the gene amplification method can be implemented using various methods known in the art, in which case, a primer or probe of miRNA can be used.

[0047] In the case of using primers, the expression level of the gene of the above-mentioned miRNA is studied by performing a gene amplification reaction. Since the diagnostic method of the present invention is based on the analysis of the expression level of the above-mentioned gene, the expression level of the gene of the above-mentioned marker is determined by studying the amount of mRNA in the analysis sample (e.g., cells). Therefore, in principle, the present invention uses the mRNA in the biological sample as a template and performs a gene amplification reaction using primers that bind to the mRNA or cDNA.

[0048] First, in order to obtain mRNA, total RNA is isolated from the sample. Total RNA can be isolated according to conventional methods known in the art (see: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al., Plant Mol. Biol. Rep., 9:242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al., Anal. Biochem. 162:156 (1987)). For example, total RNA in cells can be easily isolated using Trizol.

[0049] Next, cDNA is synthesized from the isolated mRNA and amplified. The total RNA of the present invention is isolated from a human sample, and therefore has a poly A tail at the end of the mRNA. cDNA can be easily synthesized by using an oligo dT primer and a reverse transcriptase that utilizes this sequence characteristic (reference: PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). Next, the synthesized cDNA can be amplified by a gene amplification reaction. The primer used in the present invention hybridizes or anneals at one site of the template to form a double-stranded structure. Suitable nucleic acid hybridization conditions for forming such a double-stranded structure are described in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

[0050] Various DNA polymerases can be used for amplification of the present invention, including the "Klenow" fragment of E. coli DNA polymerase I, thermostable DNA polymerases, and bacteriophage T7 DNA polymerases. Specifically, the polymerase is a thermostable DNA polymerase that can be obtained from various bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). Preferably, when implementing the polymerization reaction, an excess of the components required for each reaction is provided to the reaction vessel. The excess required for the amplification reaction is the amount that the amplification reaction is not substantially limited by the concentration of the components. It is expected that cofactors such as Mg2+, dATP, dCTP, dGTP, and dTTP are provided to the reaction mixture in an amount that can achieve the desired degree of amplification. All enzymes used in the amplification reaction can be in an active state under the same reaction conditions. In fact, the use of a buffer allows close to all enzymes to reach the optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out with a single reactant without the need to change the conditions, such as the addition of other reactants.

[0051] In the present invention, annealing or hybridization is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary depending on the surrounding environment.

[0052] The term "amplification reaction" in this specification is a reaction for amplifying nucleic acid molecules. Various amplification reactions have been reported in the art, examples of which include polymerase chain reaction (hereinafter referred to as PCR) (U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159), reverse transcription-polymerase chain reaction (hereinafter referred to as RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89 / 06700) and Davey, C. et al. (EP 329822) methods, ligase chain reaction (LCR) (17, 18), nick-LCR (WO 90 / 01069), repair chain reaction (EP 439182), transcription-mediated amplification (TMA) (19) (WO 88 / 10315), self-sustained sequence replication (self-sustained sequence replication) (20) (WO 90 / 06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6410276), consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Patent No. 4437975) and loop-mediated isothermal amplification (LAMP), but are not limited thereto. Other amplification methods that can be used are described in U.S. Patent Nos. 5242794, 5494810, 4988617 and U.S. Patent Application Serial No. 09 / 854317. The gene amplification method of the present invention is implemented according to the PCR (polymerase chain reaction) disclosed in U.S. Patent Nos. 4683195, 4683202 and 4800159.

[0053] PCR is a well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, in order to increase the specificity or sensitivity of PCR, conventional PCR steps have been modified to develop touchdown PCR, hot start PCR, nested PCR, and booster PCR. In addition, for specific applications, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (IPCR), vectorette PCR, thermal asymmetric interlaced PCR (TAIL)-PCR (thermal asymmetric interlaced PCR) have been developed. Details related to PCR are described in McPherson, MJ, and Moller, SG PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, NY (2000), the disclosure of which is incorporated into this specification by reference.

[0054] In the present invention, the primer used for gene amplification method is an oligonucleotide having a complementary sequence to the cDNA sequence of the above-mentioned miRNA. In this specification, the term "primer" is a single-stranded oligonucleotide that can act as a template-guided starting point for DNA synthesis under appropriate temperature, appropriate buffer, and appropriate conditions (i.e., 4 different nucleoside triphosphates and polymerase). The appropriate length of each primer varies according to various factors, such as temperature and the purpose of the primer, and is generally 15 to 30 nucleotides. In order for short primer molecules to form a fully stable hybrid complex with the template, a lower temperature is usually required.

[0055] The sequence of the primer does not need to be a completely complementary sequence to a portion of the sequence of the template, and there is no particular limitation, as long as it has sufficient complementarity within the scope of the inherent function of the primer when hybridizing with the template. Therefore, the primer set in the present invention does not need to be a completely complementary sequence to the cDNA sequence of the above-mentioned marker as a template, and there is no particular limitation, as long as it has sufficient complementarity within the scope of the primer function when hybridizing with the above-mentioned sequence. Preferably, the primer used in the present invention is a completely complementary sequence to the cDNA sequence of the above-mentioned marker.

[0056] A person skilled in the art can easily design such primers by referring to the cDNA sequence of the miRNA described above. For example, the PRIMER 3 program can be used for primer design.

[0057] The cDNA of the above-mentioned marker amplified in the above-mentioned manner is analyzed with an appropriate method to study the expression level of the gene of the above-mentioned marker. For example, the above-mentioned amplification reaction product is subjected to gel electrophoresis, and the band finally formed is observed and analyzed, thereby analyzing the expression level of the gene of the above-mentioned marker.

[0058] When the expression of the gene in the biological sample is upregulated or downregulated as compared with the expression of the gene in the normal sample through this amplification reaction, the subject is diagnosed as having Parkinson's disease.

[0059] In the present invention, miRNA is a biological molecule whose expression is down-regulated or up-regulated in Parkinson's disease. The term "high expression (or overexpression)" or "up-regulated" used in this specification refers to the situation that the expression level of the target nucleotide sequence or protein in the biological sample of the research object is higher than that in the normal sample. For example, in the case of expression analysis by the expression analysis method commonly used in the art, such as reverse RT-PCR or ELISA method (reference: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), the analysis result is the situation of up-regulated expression. For example, when the result of analysis by the diagnostic method as described above is compared with the normal sample, the miRNA of the present invention is up-regulated or down-regulated by more than 10%, it is judged as "high expression" or "low expression" in the present invention, so that the object is diagnosed as suffering from Parkinson's disease.

[0060] According to the embodiments of the present invention, the miRNAs included in the diagnostic method of the present invention are confirmed to be upregulated or downregulated in Parkinson's disease patients compared with healthy subjects, upregulated or downregulated by more than 10%, preferably, upregulated or downregulated by more than 50%.

[0061] Another aspect of the present invention provides a kit for diagnosis or prognosis analysis of Parkinson's disease, comprising a nucleic acid capable of specifically binding to one or more miRNAs selected from miR-494-3p, miR-501-5p, miR-1244, miR-6768-5p, miR-4324, miR-4726-5p, miR-1226-5p, miR-4767 and miR-3064-5p.

[0062] According to a preferred embodiment of the present invention, the kit of the present invention also contains a nucleic acid capable of specifically binding to one or more than one miRNA selected from hsa-miR-494-3p, hsa-miR-1244, hsa-miR-6768-5p, hsa-miR-4324, hsa-miR-4726-5p, hsa-miR-501-5p, hsa-miR-1226-5p, hsa-miR-4767 and hsa-miR-3064-5p.

[0063] In addition to nucleic acids, the kit of the present invention may contain nucleic acids known in the art or nucleic acids to be discovered in the future for detecting Parkinson's disease. The kit of the present invention may also contain known antibodies for detecting markers of Parkinson's disease.

[0064] The above-mentioned nucleic acids contained in the kit of the present invention may be packaged individually or in any combination in other containers.

[0065] The kit of the present invention may include a kit for extracting nucleic acid (eg, total RNA) from body fluids, cells or tissues, a fluorescent substance for labeling, an enzyme and culture medium for nucleic acid amplification, instructions for use, and the like.

[0066] The kit of the present invention is a device for determining Parkinson's disease markers, wherein, for example, nucleic acids are bound to or attached to a solid phase. Examples of solid phase materials include plastic, paper, glass, silicone, etc., and preferred solid phase materials that are easy to process are plastic. The shape of the solid phase is random, for example, it can be in the form of a quadrilateral, a circle, a rectangle, a film, etc.

[0067] The kit of the present invention may contain nucleic acids that can specifically bind to at least one of the above miRNAs, preferably nucleic acids that can specifically bind to at least two of the above miRNAs, and more preferably nucleic acids that can specifically bind to at least three of the above miRNAs.

[0068] Another aspect of the present invention provides a method for screening substances that induce Parkinson's disease, comprising:

[0069] (i) treating cells expressing one or more miRNAs selected from miR-494-3p, miR-501-5p, miR-1244, miR-6768-5p, miR-4324 and miR-4726-5p with a candidate substance inducing Parkinson's disease to confirm the expression level of the selected miRNA in the treated cells; and

[0070] (ii) When the expression level of the selected miRNA is downregulated in the treated cells, the substance is judged to be a substance that induces Parkinson's disease.

[0071] According to a preferred embodiment of the present invention, the screening method of the present invention further comprises:

[0072] (i) treating cells expressing one or more miRNAs selected from miR-1226-5p, miR-4767 and miR-3064-5p with a Parkinson's disease-inducing candidate substance to confirm the expression level of the selected miRNA in the treated cells; and

[0073] (ii) When the expression level of the selected miRNA is upregulated in the treated cells, the substance is judged to be a substance that induces Parkinson's disease.

[0074] Another aspect of the present invention provides a method for screening substances that induce Parkinson's disease, comprising:

[0075] (i) treating cells expressing one or more miRNAs selected from miR-1226-5p, miR-4767 and miR-3064-5p with a Parkinson's disease-inducing candidate substance to confirm the expression level of the selected miRNA in the treated cells; and

[0076] (ii) When the expression level of the selected miRNA is upregulated in the treated cells, the substance is judged to be a substance that induces Parkinson's disease.

[0077] Another aspect of the present invention provides a method for screening a therapeutic agent for Parkinson's disease, comprising:

[0078] (i) treating cells expressing one or more miRNAs selected from miR-494-3p, miR-501-5p, miR-1244, miR-6768-5p, miR-4324 and miR-4726-5p with a candidate substance for Parkinson's disease therapeutic agent to confirm the expression level of the selected miRNA in the treated cells; and

[0079] (ii) When the expression level of the selected miRNA is upregulated in the treated cells, the treated cells are judged to be a therapeutic agent for Parkinson's disease.

[0080] According to a preferred embodiment of the present invention, the screening method of the present invention further comprises:

[0081] (i) treating cells expressing one or more miRNAs selected from miR-1226-5p, miR-4767 and miR-3064-5p with a candidate substance for Parkinson's disease therapeutic agent to confirm the expression level of the selected miRNA in the treated cells; and

[0082] (ii) When the expression level of the selected miRNA is downregulated in the treated cells, the treated cells are judged to be a therapeutic agent for Parkinson's disease.

[0083] Another aspect of the present invention provides a method for screening a therapeutic agent for Parkinson's disease, comprising:

[0084] (i) treating cells expressing one or more miRNAs selected from miR-1226-5p, miR-4767 and miR-3064-5p with a candidate substance for Parkinson's disease therapeutic agent to confirm the expression level of the selected miRNA in the treated cells; and

[0085] (ii) When the expression level of the selected miRNA is downregulated in the treated cells, the treated cells are judged to be a therapeutic agent for Parkinson's disease.

[0086] The term "candidate substance" used in conjunction with the screening method of the present invention refers to an unknown substance (e.g., various natural substances, compound libraries, gene or protein libraries, etc.) utilized in the screening process in order to examine whether it has the activity of inducing, reducing, preventing or removing Parkinson's disease symptoms.

[0087] The term "Parkinson's disease therapeutic agent" used in this specification refers to a drug (pharmaceutical composition), a health functional food or a diet therapy that is known or confirmed to exhibit pharmacological activity for Parkinson's disease. For example, in the present invention, drugs and functional foods that are known in the art to have pharmacological activity for Parkinson's disease can be used to sensitively diagnose or predict the prognosis of a subject diagnosed with Parkinson's disease. As another example, the method of the present invention can be applied to screening for a substance having pharmacological activity for Parkinson's disease from candidate substances whose pharmacological activity for Parkinson's disease is not known.

[0088] One aspect of the present invention provides a composition for preventing, improving or treating Parkinson's disease, comprising one or more miRNAs selected from miR-494-3p, miR-501-5p, miR-1244, miR-6768-5p, miR-4324 and miR-4726-5p as active ingredients.

[0089] Another aspect of the present invention provides a method for treating Parkinson's disease, comprising the step of administering to a patient an effective amount of one or more miRNAs selected from miR-494-3p, miR-501-5p, miR-1244, miR-6768-5p, miR-4324 and miR-4726-5p.

[0090] According to one embodiment of the present invention, the composition of the present invention is a pharmaceutical composition.

[0091] The pharmaceutical composition of the present invention may include pharmaceutically acceptable carriers, which are generally known in the art. Suitable carriers for the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginic acid, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, but are not limited thereto. In addition to the above-mentioned ingredients, the pharmaceutical composition of the present invention may also include one or more additives selected from lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and preparations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0092] The pharmaceutical composition of the present invention can be administered orally or parenterally. In the case of parenteral administration, it can be administered by nasal administration, eye drop administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc.

[0093] The appropriate dosage of the pharmaceutical composition of the present invention is different according to factors such as formulation method, mode of administration, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity of the patient. Usually, a skilled doctor can easily determine and prescribe the desired amount of the pharmaceutical composition effective for treatment or prevention. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001 mg / kg to 100 mg / kg.

[0094] The pharmaceutical composition of the present invention can be prepared as a unit dosage form or dispersed in a multi-dose container using a pharmaceutically acceptable carrier and / or excipient according to a method that is easily implemented by a person skilled in the art. In this case, the dosage form can be a solution, suspension or emulsion in an oil or aqueous medium, or can also be an extract, powder, granule, tablet or capsule, and can also include a dispersant or stabilizer.

[0095] The pharmaceutical composition of the present invention can be prepared into external skin preparations, aerosols, sprays, eye drops, oral preparations and injection preparations.

[0096] According to one embodiment of the present invention, the composition of the present invention is a food composition.

[0097] Food compositions of the present invention can also optionally comprise one or more than one composition that is usually added when preparing food, for example, optional composition can be selected from protein, carbohydrate, fat, nutrient, flavoring agent and flavoring agent.The example of carbohydrate as above comprises sugar, for example monosaccharide of glucose, fructose etc., disaccharide such as maltose, sucrose, oligosaccharide etc., such as dextrin, the polysaccharide of cyclodextrin etc. and the sugar alcohol of xylitol, sorbitol, erythritol etc..As flavoring agent, natural flavoring agent (taurine, stevia extract [for example, rebaudioside A, glycyrrhizic acid glycoside etc.]) and synthetic flavoring agent (saccharin, aspartame etc.) can be used.

[0098] For example, when the food composition of the present invention is prepared as a beverage, it may further comprise citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, eucommia extract, jujube extract, licorice extract, and the like.

[0099] Effects of the Invention

[0100] The features and advantages of the present invention are as follows:

[0101] (i) The present invention provides a method for providing information for diagnosing Parkinson's disease.

[0102] (ii) The present invention provides a composition for preventing, improving or treating Parkinson's disease.

[0103] (iii) The miRNA used in the present invention is specifically down-regulated or up-regulated in the Parkinson's disease model and can be effectively used for the diagnosis and treatment of Parkinson's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] Figure 1 The miRNAs whose expression is downregulated in the apoptotic step of Parkinson's disease model cells are shown.

[0105] Figure 2 The miRNAs upregulated in the apoptotic step of Parkinson's disease model cells are shown.

[0106] Figure 3 This is a photograph of the internal control group injected with 6-OHDA. The substantia nigra of the left hemisphere, where no brain tissue was treated, was well preserved (A), whereas the neurons of the substantia nigra of the right hemisphere injected with 6-hydroxydopamine died and shrank excessively due to tissue deformation (B).

[0107] Figure 4 Live neurons of the substantia nigra under the influence of 494-3p co-injection with 6-OHDA are shown. Lesions in A (normal) and B (injection) in the same individual were confirmed by H&E staining.

[0108] Figure 5 The live neurons of the substantia nigra under the influence of miR1244 co-injection with 6-OHDA are shown. The lesions in A (normal) and B (injection) in the same individual were confirmed by H&E staining.

[0109] Figure 6 The live neurons of the substantia nigra under the influence of miR4324 co-injected with 6-OHDA are shown. The lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

[0110] Figure 7 The live neurons of the substantia nigra under the influence of miR4726-5 co-injected with 6-OHDA are shown. The lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

[0111] Figure 8 The live neurons of the substantia nigra under the influence of 6-OHDA co-injection with miR6768-5 are shown. The lesions in A (normal) and B (injection) in the same individual were confirmed by H&E staining.

[0112] Fig. 9 The live neurons of the substantia nigra under the influence of miR501-5p co-injection with 6-OHDA are shown. The lesions in A (normal) and B (injection) in the same individual were confirmed by H&E staining. DETAILED DESCRIPTION

[0113] The present invention is described in more detail below by way of examples. These examples are only used to specifically illustrate the present invention. According to the gist of the present invention, the scope of the present invention is not limited to these examples, which is obvious to those skilled in the art to which the present invention belongs. Example

[0114] Materials and Methods

[0115] 1. Cultivation of SH-SY5Y cells

[0116] C57BL / 6 SH-SY5Y neuroblasts (Jang, S.-W., Oh, M.-S., Yang, SI & Cho, E.-M. Gene expression profiles of human neuroblastoma cells exposed to CuO nanoparticles and Cu ions. BioChip Journal 10, 140-149 (2016)) were cultured in DMEM (Dulbecco's Modified Eagle's Medium, Invitrogen, MD, USA) supplemented with 10% heat-inactivated fetal bovine serum (GIBCO, MD, USA) at 37°C in a CO2 chamber with 5% humidity. In addition, 6-hydroxydopamine (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in phosphate buffer and stored at -80°C before use. Whenever needed, the solution was added to the plate and the reagent was used in batches. In particular, attention was paid to light because the solution was photosensitive.

[0117] 2. Cell viability test

[0118] To observe cell survival, a stable tetrazolium salt, WST-1 assay (Sigma-Aldrich, St. Louis, MO, USA) was used. SH-SY5Y cells were added to a 96-well plate at 5,000 cells per well and treated with 6-hydroxydopamine (6OHDA, 25 μM, 24 h). WST-1 solution was added at 10 μl / well 2 hours before the end of the experiment and the cells were cultured in a chamber at 37°C. After the experiment, the color change at 450 nm was measured and confirmed.

[0119] 3. Isolation of RNA

[0120] Total RNA from SH-SY5Y cells treated with 6OHDA (25 μM, 24 h) was isolated using Trizol reagent according to the manufacturer's recommended method (Invitrogen, California, USA), and the total amount and purity of the isolated RNA were determined using a NanoDrop spectrophotometer (Nano Drop, Delaware, USA) at 260 / 280 nm (ratio 1.8 to 2.0) (Kim, G.W. Integrative analyses of differential gene expression and DNA methylation of ethylbenzene-exposed workers. BioChip Journal 9, 259-267 (2015)).

[0121] 4. Analysis of miRNA expression

[0122] For miRNA expression profiling, Affymetrix miRNA 4.0 arrays were used (Lee, S. E. Identification and characterization of MicroRNAs in acrolein-stimulated endothelial cells: Implications for vascular disease. . BioChip Journal 9, 144-155 (2015)), and the microarray data were analyzed using the Gene Expression Omnibus (GEO) database.

[0123] 5. Target prediction and gene ontology analysis

[0124] In order to predict miRNA target genes based on miRNA expression profiles, TargetScan 6.2DB was used and the miRanda algorithm was followed (Kim, GW et al. Integrative analyses of differential gene expression and DNA methylation of ethylbenzene-exposed workers. BioChip Journal 9, 259-267 (2015)). Furthermore, the target miRNAs showing the highest frequency and high expression level changes were reconfirmed using Gene Ontology (GO) categories (http: / / www.geneontology.org / ) (Cho, H. et al. A relationship between miRNA and gene expression in themouse Sertoli cell line after exposure to bisphenol A. BioChip Journal 4, 75-81 (2010); Jeong, SI et al. MicroRNA microarray analysis of human umbilical vein endothelial cells exposed to benzo (a) pyrene. BioChip Journal 6, 191-196 (2012); Park, HR, Lee, SE, Yang, H., Son, GW & Park, YS Functional screening of altered microRNA expression in 3-methylcholanthrene-treated human umbilical vein endothelial cells. BioChip Journal 8, 260-268 (2014); Park, JH et al. Expression profiles of miRNAs during ethanol-induced differentiation of neural stem cells. BioChip Journal 6, 73-83 (2012)). The miRs were screened in the order of increase or decrease in expression level according to log2 fold change.

[0125] 6. Preparation of animal models of Parkinson's disease

[0126] In order to limit the toxicity caused by 6-OHDA (Sigma, St. Louis, USA) to dopaminergic neurons, desipramine (12.5 mg / kg; Sigma, St. Louis, USA) as a norepinephrine transport blocker was injected into the peritoneum of the experimental animals 30 minutes before the injection of 6-OHDA. The experimental animals were placed in a deep anesthesia state by intraperitoneal injection of a mixture of ketamine (40 mg / kg) and methylbenzylthiazide (5 mg / kg), and then fixed in a brain stereotaxic apparatus (David KOPF instrument., CA, USA) under respiratory anesthesia. After the head skin was incised to expose the skull, the bregma was confirmed and a small hole was made with a dental drill at a position 1.1 mm posteriorly and 1.2 mm to the right based on the bregma. A 26-gauge needle was inserted through the hole to a position 5.0 mm posteriorly so that it was located on the medial forebrain bundle (MFB). Using an infusion pump (Harvard Apparatus., USA), 2 μL of a solution of 6-OHDA dissolved in 0.1% ascorbic acid (2.5 μg / μL) was injected using a 5 μL Hamilton syringe at a rate of 0.5 μL / min. Using another 5 μL Hamilton syringe, 5 uL of the experimental miRNA was injected at a rate of 0.5 μL / min. Five minutes after the injection, the Hamilton syringe was removed and the skin was sutured. The left hemisphere was not injected with any substance for internal control. After the experimental animals were anesthetized with a mixture of ketamine (70 mg / kg) and thiazide (8 mg / kg), 4% paraformaldehyde (in 0.1 M phosphate buffer, pH 7.4) was perfused into the animals through the heart, and then fixed and the brain tissue was removed.

[0127] result

[0128] 1. Down-regulated miRs during apoptosis in PD models

[0129] Figure 1 The results show that among the up-regulated and down-regulated miRNAs, the miRs expressed were highly down-regulated during apoptosis in the PD model. In particular, miR494-3p, which has not been reported to be associated with Parkinson's disease, repeatedly showed a significant decrease in each experiment. Figure 1The miRs showing downregulation of expression above -2.0 (more than 30%) based on the log ratio are listed. In particular, bioinformatics data analysis showed that miR-1244 targets the protein "TBC1 domain family member 2B". Importantly, the miRNA acts as an essential regulator, targeting one of the genes specifically expressed during neuronal apoptosis in Parkinson's disease (A Network View on Parkinson's Disease, Comput Struct Biotechnol J. 2013;7:e201304004).

[0130] 2. Upregulated miRs during apoptosis in PD models

[0131] Figure 2 Among the above up-regulated and down-regulated miRNAs, the miRs that are highly up-regulated during apoptosis in PD model cells are shown.

[0132] 3. miR sequence

[0133] The sequence information of the above-mentioned up-regulated and down-regulated miRNAs is as follows:

[0134] In the apoptotic step of cells in the PD model, the highly downregulated miRNAs were hsa-miR-494-3p (sequence 1: UGAAACAUACACGGGAAACCUC), hsa-miR-1244 (sequence 2: AAGUAGUUGGUUUGUAUGAGAUGGUU), hsa-miR-6768-5p (sequence 3: CACACAGGAAAAGCGGGGCCCUG), hsa-miR-4324 (sequence 4: CCCUGAGACCCUAACCUUAA), hsa-miR-4726-5p (sequence 5: AGGGCCAGAGGAGCCUGGAGUGG), and hsa-miR-501-5p (sequence 6: AAUCCUUUGUCCCUGGGUGAGA).

[0135] During apoptosis of cells in the PD model, the highly upregulated miRNAs were hsa-miR-1226-5p (sequence 7: GUGAGGGCAUGCAGGCCUGGAUGGGG), hsa-miR-4767 (sequence 8: CGCGGGCGCUCCUGGCCGCCGCC), and hsa-miR-3064-5p (sequence 9: UCUGGCUGUUGUGGUGUGCAA).

[0136] 4. H&E staining

[0137] In the evaluation of the efficacy in the brain, the cell viability of the substantia nigra pars compacta, the main lesion of Parkinson's disease, was confirmed and compared by H&E staining.

[0138] 1) Tissue fixation: inactivate the enzymes in the cells, convert the components in the tissue into an insoluble state through coagulation or precipitation, immerse the tissue in the fixative and fix it at 4°C for one day or more to preserve the structure well.

[0139] 2) Dehydration and washing: Remove water and remove the solvent used to remove water. This is to make it easier for paraffin to penetrate into the sub-tissue.

[0140] 3) Preparation of paraffin blocks: Use paraffin to shape the inside and outside of the tissue, so that the tissue or cell structure does not deform.

[0141] 4) Preparation of slides: Use a microtome to cut the paraffin block into 10 μm thick serial coronal sections to prepare silane-coated slides.

[0142] 5) Staining: After processing, the paraffin was removed to preserve the tissue and the nuclei were stained with Harris hematoxylin and counterstained with eosin Y.

[0143] 6) Cells are stained blue, and contrast-stained areas are pink.

[0144] 5. Effect of miRNA on neuronal apoptosis inhibition

[0145] like Figures 3 to 9 As confirmed by the internal control injected with 6-OHDA only ( Figure 3 ), not only did neuronal apoptosis occur, but the size of the tissue also shrank excessively due to tissue deformation. On the contrary, in the case of miR494-3p ( Figure 4 )、miR1244( Figure 5 )、miR4324( Figure 6 )、miR4726-5p( Figure 7 )、miR6768-5p( Figure 8 ) or miR501-5p ( Fig. 9 ) in the experimental group, it was confirmed that neurons were still alive. Thus, it was proved that the miRNA of the present invention has an excellent effect of preventing neuronal apoptosis.

[0146] Although specific parts of the present invention are described in detail, it is obvious to those skilled in the art that such specific techniques are only preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the essential scope of the present invention is defined by the appended claims and their equivalent technical solutions.

[0147] Sequence Listing Free Text

[0148] <110> National University Industry-Academic Cooperation Group

[0149] <120> miRNA as a biomarker for Parkinson's disease and diagnostic kit using the same

[0150] <130> PCT541

[0151] <150> KR 10-2017-0091417

[0152] <151> 2017-07-19

[0153] <150> KR 10-2017-0116583

[0154] <151> 2017-09-12

[0155] <150> KR 10-2017-0132866

[0156] <151> 2017-10-12

[0157] <150> KR 10-2017-0132867

[0158] <151> 2017-10-12

[0159] <150> KR 10-2017-0132868

[0160] <151> 2017-10-12

[0161] <150> KR 10-2017-0132869

[0162] <151> 2017-10-12

[0163] <150> KR 10-2017-0132870

[0164] <151> 2017-10-12

[0165] <160> 9

[0166] <170> KoPatentIn 3.0

[0167] <210> 1

[0168] <211> twenty two

[0169] <212> RNA

[0170] <213> Homo sapiens

[0171] <400> 1

[0172] ugaaacauac acgggaacc uc

[0173] <210> 2

[0174] <211> 26

[0175] <212> RNA

[0176] <213> Man(Homo sapiens)

[0177] <400> 2

[0178] the 26th of August

[0179] <210> 3

[0180] <211> 23

[0181] <212> RNA

[0182] <213> Man(Homo sapiens)

[0183] <400> 3

[0184] cacacagga aagcggggcc cug

[0185] <210> 4

[0186] <211> 20

[0187] <212> RNA

[0188] <213> Man(Homo sapiens)

[0189] <400> 4

[0190] cccugagacc 20 square feet

[0191] <210> 5

[0192] <211> 23

[0193] <212> RNA

[0194] <213> Man(Homo sapiens)

[0195] <400> 5

[0196] agggccagag gagccuggag ugg

[0197] <210>6

[0198] <211>22

[0199] <212>RNA

[0200] <213>Homo sapiens

[0201] <400>6

[0202] aauccuuugu cccuggguga ga 22

[0203] <210>7

[0204] <211>26

[0205] <212>RNA

[0206] <213>Homo sapiens

[0207] <400>7

[0208] gugagggcau gcaggccugg augggg 26

[0209] <210>8

[0210] <211>23

[0211] <212>RNA

[0212] <213>Homo sapiens

[0213] <400>8

[0214] cgcgggcgcu ccuggccgcc gcc 23

[0215] <210>9

[0216] <211>21

[0217] <212>RNA

[0218] <213>Homo sapiens

[0219] <400>9

[0220] ucuggcuguu guggugugca a 21。

Claims

1. Use of a nucleic acid capable of specifically binding to miR-3064-5p in the preparation of a preparation providing information for diagnosing Parkinson's disease, wherein: (a) comparing the expression level of miR-3064-5p contained in a sample obtained from a subject with the expression level of miR-3064-5p contained in a normal sample; and (b) the expression level of miR-3064-5p contained in the sample of the subject is higher than the expression level of miR-3064-5p contained in the normal sample, Wherein the sample is a blood, plasma or serum sample.

2. The use according to claim 1, wherein: (a) further comparing the expression level of at least one miRNA selected from miR-1226-5p and miR-4767 contained in the sample obtained from the subject with the expression level of the selected miRNA contained in a normal sample; and (b) the expression level of the selected miRNA contained in the sample of the subject is higher than the expression level of the selected miRNA contained in the normal sample, Wherein the sample is a blood, plasma or serum sample.

3. The use according to claim 1, wherein: (a) further comparing the expression level of at least one miRNA selected from the group consisting of miR-494-3p, miR-501-5p, miR-1244, miR-4324, and miR-4726-5p contained in the sample obtained from the subject with the expression level of the selected miRNA contained in a normal sample; and (b) the expression level of the selected miRNA contained in the sample of the subject is lower than the expression level of the selected miRNA contained in the normal sample, Wherein the sample is a blood, plasma or serum sample.

4. Use of a nucleic acid that can specifically bind to miR-3064-5p in the preparation of a kit for diagnosing Parkinson's disease.

5. A method for screening substances that induce Parkinson's disease, comprising: (i) treating cells expressing miR-3064-5p with a Parkinson's disease inducing candidate substance, and quantifying the expression level of miR-3064-5p in the treated cells; and (ii) When the expression level of miR-3064-5p is upregulated in the treated cells, the candidate substance is judged to be a Parkinson's disease inducing substance.

6. A method for screening a therapeutic agent for Parkinson's disease, comprising: (i) treating cells expressing miR-3064-5p with a candidate therapeutic agent for Parkinson's disease, and quantifying the expression level of miR-3064-5p in the treated cells; and (ii) When the expression level of miR-3064-5p is downregulated in the treated cells, the candidate therapeutic agent is judged to be a Parkinson's disease therapeutic agent.

Images