Primer combination and freeze-drying reagent for ALDH2 gene rs671 polymorphism nucleic acid detection

Abstract

The invention discloses a primer combination and a freeze-drying reagent for ALDH2 gene rs671 polymorphism nucleic acid detection. The primer combination comprises a forward primer F, a reverse primer R, a first probe WP and a second probe MP. The primer sequences designed for the specific polymorphic site of the ALDH2 (rs671) gene can accurately distinguish different genotypes, non-specific amplification does not exist between the primers, and the primer sequence has high sensitivity and specificity. According to the detection reagent, nucleic acid does not need to be extracted, a sample can be directly used for amplification after nucleic acid release, the operation steps are simplified, the detection time is short, a sample detection result can be obtained within 30 minutes, and the detection efficiency is improved.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a primer combination and a freeze-dried reagent for detecting ALDH2 gene rs671 polymorphic nucleic acid. Background Art

[0002] Human acetaldehyde dehydrogenase (ALDH) is a tetramer protein that catalyzes the oxidation of acetaldehyde and other aliphatic aldehydes. At present, 19 ALDH isoenzymes have been found, mainly ALDH1 to 4, among which ALDH2 is the most important. It has a high expression level in the liver and stomach and is one of the most important enzymes in the ethanol metabolism and nitroglycerin metabolism pathways. ALDH2 gene polymorphism is closely related to the occurrence and development of many diseases, such as alcoholic liver disease and cardiovascular disease. Accurate detection of ALDH2 gene polymorphism is of great significance for the prevention, diagnosis and treatment of diseases.

[0003] The ALDH2 gene is located on human chromosome 12. Due to the presence of polymorphisms in the ALDH2 gene (such as rs671, G1510A, Glu504Lys), glutamic acid at position 504 of the amino acid sequence is replaced by lysine (Glu504Lys). The wild type with catalytic activity is called the G allele (ALDH2*1), and the variant with inactive catalytic ability is called the A allele (ALDH2*2). The ALDH2 gene is mainly responsible for the metabolism of acetaldehyde, and mutations will significantly reduce the enzyme activity of ALDH2. Individuals carrying the rs671A allele (i.e., the E504K mutation) usually show decreased alcohol metabolism ability and are prone to the phenomenon of "blushing after drinking". Acetaldehyde accumulates in the body, leading to discomfort. The carrier rate of the ALDH2*2 allele in Asian populations is 30% to 50%. Patients with angina pectoris carrying the ALDH2*2 allele should switch to other emergency drugs as much as possible to avoid the ineffectiveness of sublingual nitroglycerin.

[0004] At present, commonly used ALDH2 gene (rs671) polymorphism detection methods include PCR-RFLP, Sanger sequencing, gene chips, etc. However, these methods have problems such as complex operation, long detection time, and high cost. In addition, most ALDH2 (rs671) gene polymorphism detection reagents on the market are suitable for blood samples, which are inconvenient to sample and have wounds. The ALDH2 gene plays a key role in the alcohol metabolism process, and its polymorphism is closely related to the individual's tolerance to alcohol and susceptibility to certain diseases. Accurate and convenient detection of the ALDH2 gene is of great significance to personalized medicine, health management and other fields. Traditional gene detection methods often have problems such as complex operation, long detection cycle, high sample requirements, and poor reagent stability, which are not conducive to storage and transportation. Therefore, it is very necessary to develop an efficient, stable and non-professional ALDH2 gene detection reagent and supporting sample processing method. Summary of the invention

[0005] In view of the defects in the prior art, the present invention provides a primer combination and a lyophilized reagent for detecting the rs671 polymorphism nucleic acid of the ALDH2 gene.

[0006] The present invention provides a primer combination for detecting rs671 polymorphic nucleic acid of ALDH2 gene, the primer combination comprising a forward primer F, a reverse primer R, a first probe WP and a second probe MP, and the primer combination is any one of the following groups:

[0007] (1) F: sequence as shown in SEQ ID NO.1, R: sequence as shown in SEQ ID NO.2, WP: sequence as shown in SEQ ID NO.3, MP: sequence as shown in SEQ ID NO.4;

[0008] (2) F: sequence as shown in SEQ ID NO.5, R: sequence as shown in SEQ ID NO.6, WP: sequence as shown in SEQ ID NO.7, MP: sequence as shown in SEQ ID NO.8;

[0009] (3) F: sequence as shown in SEQ ID NO.9, R: sequence as shown in SEQ ID NO.10, WP: sequence as shown in SEQ ID NO.11, MP: sequence as shown in SEQ ID NO.12; preferably, combination (3).

[0010] The above-mentioned specific primer pair sequence is designed according to the specific polymorphic site of the ALDH2 gene to ensure that different genotypes can be accurately distinguished and is used for specific amplification of the ALDH2 (rs671) gene fragment.

[0011] In some embodiments, the molar ratio of F, R, WP and MP is (1-3): (1-3): 1: 1; preferably (2-3): (2-3): 1: 1, and more preferably 2: 2: 1: 1.

[0012] In some embodiments, the fluorescent label of the first probe WP is FAM, and the fluorescent label of the second probe MP is VIC, wherein the excitation wavelength and emission wavelength of FAM and VIC are different to achieve independent detection of signals.

[0013] The invention provides an amplification system for detecting rs671 polymorphic nucleic acid of an ALDH2 gene. The amplification system comprises a buffer system for amplification and the primer combination.

[0014] In some embodiments, the amplification program of the amplification system is:

[0015] (1) Initial denaturation: 95°C, 3 min;

[0016] (2) Pre-deformation cycle: 95 °C, 5 s, 60 °C, 5 s, 5 cycles in total;

[0017] (3) Amplification cycles: 95°C, 5 s, 58-62°C, 5 s, read fluorescence signal, a total of 40 cycles.

[0018] The invention provides a freeze-dried reagent, comprising the primer combination.

[0019] The reagent of the present invention is in a freeze-dried form, which can effectively reduce the errors generated in the reagent configuration process while saving the reagent configuration time. In addition, the reagent transportation process can get rid of cold chain transportation and reduce transportation and storage costs.

[0020] In some embodiments, the lyophilized reagent further comprises a reaction premix and a lyophilization protectant.

[0021] In some embodiments, the reaction premix includes any one or more of a polymerase, dNTPs, or an enzyme buffer.

[0022] In some embodiments, the lyophilization protective agent includes: 3-6 w / v% dextran, 1-5 w / v% PEG8000, 0.2-1 w / v% glycine and 0.5-3 w / v% gelatin. The compounding of the protective reagent components of the present invention can ensure that the detection reagent is not damaged during the lyophilization process and improve the stability of the reagent.

[0023] The present invention also provides the use of the primer combination or the amplification system or the freeze-dried reagent in preparing a product for detecting the rs671 polymorphic nucleic acid of the ALDH2 gene.

[0024] In summary, compared with the prior art, the present invention achieves the following technical effects:

[0025] 1. The primer sequences designed for the specific polymorphic site of the ALDH2 gene (rs671) of the present invention can accurately distinguish different genotypes, there is no nonspecific amplification between primers, and it has high sensitivity and specificity.

[0026] 2. The detection reagent of the present invention does not require the extraction of nucleic acid. After the nucleic acid is released, the sample can be directly used for amplification, which simplifies the operation steps and shortens the detection time. The detection result of the sample can be obtained within 30 minutes, which significantly improves the detection efficiency.

[0027] 3. The test sample type is an oral swab, which is convenient, fast and non-invasive. In addition, the reagent of the present invention is in a freeze-dried form, which can effectively reduce the error generated during the reagent configuration process and save reagent configuration time. In addition, the reagent does not need cold chain transportation during transportation, thereby reducing transportation and storage costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0029] Figure 1 The freeze-dried reagent is packaged into eight connected tubes and then freeze-dried into balls;

[0030] Figure 2 This is the amplification result of the wild-type sample T1-T3 in Example 2 of the present invention;

[0031] Figure 3 This is the amplification result of the T1-T3 heterozygous sample in Example 2 of the present invention;

[0032] Figure 4 This is the amplification result of the homozygous sample T1-T3 in Example 2 of the present invention;

[0033] Figure 5 This is the sample amplification result of Example 3 of the present invention with an annealing temperature of 58°C;

[0034] Figure 6 This is the sample amplification result of Example 3 of the present invention with an annealing temperature of 60°C;

[0035] Figure 7 This is the sample amplification result of Example 3 of the present invention with an annealing temperature of 62°C;

[0036] Figure 8These are the amplification results of eight samples in Example 4 of the present invention. DETAILED DESCRIPTION

[0037] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0038] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used are all commercially available unless otherwise specified.

[0039] Example 1

[0040] According to ALDH2 (rs671) GenBank: JX878429.1 (SEQ ID NO.13), ALDH2 (rs671) primer set T1 to T3 were designed, and the sequences are shown in Table 1:

[0041] Table 1 ALDH2 (rs671) amplification primer sequences

[0042]

[0043] SEQ ID NO.13:

[0044] TAAAGACTTTGGGGCAATACAGGGGGTCCTGGGAGTGTAACCCATAACCCCCAAGAGTGATTTCTGCAATCTCGTTTCAAATTACAGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCT GCAGGCATACACTGAAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGCTTGAGGGTCTGCTGGTGGCTCGGAGCCTGCTGGGGGATTGGGGTCTGTTGGGGGCTCGGGGCCTGCCAGAGGTTCAGGACCTGCCGGGGACTCAGGGCCTGCTGGAAGTTCA

[0045] Example 2

[0046] The final concentration ratio of F:R:WP:MP of ALDH2 (rs671) primer sets T1 to T3 was set to 2:2:1:1 to prepare ALDH2 (rs671) Primer Mix, and freeze-dried according to the freeze-drying procedure after preparation according to the system in Table 2. After freeze-drying, the mixture was divided into eight tubes for later use. Figure 1 As shown. 20 μL of ALDH2 samples treated with nucleic acid release agent were re-dissolved respectively, including 1 wild-type, 1 heterozygous, and 1 homozygous sample. The mixed reaction system was placed in a PCR instrument and amplified with the following program (95℃3min; 95℃5s, 60℃5s, 5 cycles; 95℃5s, 60℃5s reading fluorescence, 40 cycles).

[0047] Table 2 Freeze-drying system

[0048] Reagent components concentration Volume (μL) dNTP 10mM 1 5×PCR Buffer / 4 ALDH2(rs671) Primer Mix / 1.5 Taq enzyme 8U 0.5 2× Lyoprotectant / 10 Enzyme-free water Top up to 20

[0049] Note: Taq enzyme is a high concentration enzyme and does not contain glycerol.

[0050] 5×PCR Buffer contains: 100mM Tris-HCl, 5mM MgCl2, 100mM KCl, and 0.5% BSA.

[0051] Lyoprotectant components: dextran 3% (w / v), PEG 8000 5% (w / v), glycine 0.5% (w / v), gelatin 1% (w / v).

[0052] The freeze-drying procedure is as follows: vacuum degree 0Pa; -50℃, 120min, vacuum degree 0Pa; -45℃, 180min, vacuum degree 10Pa; -35℃, 420min, vacuum degree 10Pa; -30℃, 240min, vacuum degree 10Pa; -20℃, 120min, vacuum degree 10Pa; -10℃, 60min, vacuum degree 10Pa; 0℃, 60min, vacuum degree 10Pa; 28℃, 60min, vacuum degree 10Pa.

[0053] Reagent preparation: Primers were diluted to 50 μM for use.

[0054] Sample selection: Eight human oral swab samples (including wild type, heterozygous type and homozygous type) were obtained by sequencing to determine the ALDH2 (rs671) genotype.

[0055] Sample collection and processing: Collect oral swab samples: Use a special oral swab to gently scrape epithelial cells from the inner wall of the subject's mouth, put them into 200μL nucleic acid releaser, mix them, and store them for later use.

[0056] Nucleic acid releasers: including sodium deoxycholate 0.5% (w / v), Tris-HCl buffer 20mM (pH7.5), HEPES (pH 7.2), Tween-20 0.1% (v / v), TritonX-100 0.5% (v / v) and Surfactin 0.05% (w / v), SDS 0.2% (w / v) and 8-hydroxyquinoline 0.05% (w / v), etc.

[0057] Fluorescence PCR amplification instrument: amplification was performed using WZ GR-8B fluorescence quantitative PCR instrument.

[0058] The results are shown in Table 3 and Figures 2 to 4 As shown:

[0059] Table 3 Fluorescence PCR results of different ALDH2 (rs671) primer sets

[0060]

[0061] The results showed that primers and probes in groups T1-T3 could accurately identify the genotypes of ALDH2. The Ct value of group T3 was smaller than that of groups T1 and T2, indicating that the amplification effect of primers and probes in group T3 was better.

[0062] Example 3

[0063] The ALDH2 (rs671) Primer Mix was prepared with the final concentration ratio of ALDH2 (rs671) primer set T3 F: R: WP: MP set to 1: 1: 1: 1, 2: 2: 1: 1 and 3: 3: 1: 1, and then freeze-dried according to the freeze-drying procedure after preparation according to the system in Table 2. After freeze-drying, it was divided into eight tubes and reconstituted with 20 μL of ALDH2 wild-type, heterozygous and homozygous samples treated with nucleic acid release agent, respectively. The mixed reaction system was placed in a PCR instrument for amplification, and amplification was performed in the following procedures (95°C for 3 min; 95°C for 5 s, 60°C for 5 s, 5 cycles; 95°C for 5 s, 60°C for 5 s, fluorescence reading, 40 cycles).

[0064] Table 4 Fluorescence PCR results of different ALDH2 (rs671) primer sets

[0065]

[0066] The larger the Ct value, the more cycles are required to achieve a detectable fluorescent signal in the PCR reaction, and the lower the efficiency of the PCR reaction. The results show that the above three sets of primer-probe ratios can accurately detect the various ALDH2 genotypes, among which the Ct value is relatively large when the primer-probe ratio is 1:1:1:1, and the Ct value of the 2:2:1:1 group is close to 3:3:1:1, which is better than the amplification effect of the primer-probe ratio of 1:1:1:1. By optimizing the primer-probe ratio, the detection sensitivity of the target nucleic acid can be significantly improved, and a lower concentration of template can be detected. In addition, from the perspective of economic benefits, the primer-probe ratio of 2:2:1:1 was selected for subsequent experiments.

[0067] Example 4

[0068] ALDH2 (rs671) Primer Mix was prepared with a final concentration ratio of 2:2:1:1 for the ALDH2 (rs671) primer set T3 F:R:WP:MP, and freeze-dried according to the freeze-drying procedure after preparation according to the system in Table 2. After freeze-drying, it was divided into eight tubes and reconstituted with 20 μL of three ALDH2 heterozygous samples treated with nucleic acid release agent, respectively. The mixed reaction system was placed in a PCR instrument for amplification, and amplification was performed in the following procedures (95℃3min; 95℃5s, 60℃5s, 5 cycles; 95℃5s, 58℃ / 60℃ / 62℃5s reading fluorescence, 40 cycles).

[0069] The results are shown in Table 5 and Figures 5 to 7 As shown:

[0070] Table 5 Optimization results of annealing temperature in amplification program

[0071]

[0072] The results showed that the Ct value was smaller when the annealing temperature was 60℃ than that at 58℃ and 62℃, indicating that the optimal annealing temperature of this group of primer probes was 60℃.

[0073] Example 5

[0074] The ALDH2 (rs671) Primer Mix was prepared with the final concentration ratio of ALDH2 (rs671) primer set T3 F: R: WP: MP set to 2: 2: 1: 1, and freeze-dried according to the freeze-drying procedure after preparation according to the system in Table 2. After freeze-drying, it was divided into eight tubes and reconstituted with 8 20 μL ALDH2 samples treated with nucleic acid release agent. The 8 samples were sequenced to determine the ALDH2 genotype. After fully mixing, amplification was performed in the following procedure (95℃3min; 95℃5s, 60℃5s, 5 cycles; 95℃5s, 60℃5s reading fluorescence, 40 cycles).

[0075] The results are shown in Table 6 and Figure 8 As shown:

[0076] Table 6 Comparison of amplification and sequencing results of eight samples

[0077]

[0078]

[0079] The results showed that the test results of the 8 samples were completely consistent with the sequencing results, indicating that the designed ALDH2 primer probe has good specificity.

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer combination for detecting the rs671 polymorphism of the ALDH2 gene, characterized in that: The primer combination includes a forward primer F, a reverse primer R, a first probe WP and a second probe MP, and the primer combination is any one of the following groups: (1) F: sequence as shown in SEQ ID NO.1, R: sequence as shown in SEQ ID NO.2, WP: sequence as shown in SEQ ID NO.3, MP: sequence as shown in SEQ ID NO.4; (2) F: sequence as shown in SEQ ID NO.5, R: sequence as shown in SEQ ID NO.6, WP: sequence as shown in SEQ ID NO.7, MP: sequence as shown in SEQ ID NO.8; (3) F: sequence as shown in SEQ ID NO.9, R: sequence as shown in SEQ ID NO.10, WP: sequence as shown in SEQ ID NO.11, MP: sequence as shown in SEQ ID NO.

12.

2. The primer combination according to claim 1, characterized in that The molar ratio of F, R, WP and MP is (1-3): (1-3): 1:

1.

3. The primer combination according to claim 1, characterized in that The fluorescent label of the first probe WP is FAM, and the fluorescent label of the second probe MP is VIC.

4. An amplification system for detecting the rs671 polymorphism of the ALDH2 gene, characterized in that: The amplification system comprises: a buffer system for amplification and the primer combination according to any one of claims 1 to 3.

5. A freeze-dried reagent, characterized in that: The invention comprises the primer combination according to any one of claims 1 to 3.

6. The freeze-dried reagent according to claim 5, characterized in that The freeze-dried reagent also includes a reaction premix and a freeze-dried protective agent.

7. The freeze-dried reagent according to claim 6, characterized in that The reaction premix solution includes any one or more of polymerase, dNTP or enzyme buffer.

8. The freeze-dried reagent according to claim 6, characterized in that The freeze-drying protective agent comprises: 3-6 w / v% dextran, 1-5 w / v% PEG 8000, 0.2-1 w / v% glycine and 0.5-3 w / v% gelatin.

9. Use of the primer combination according to any one of claims 1 to 3, the amplification system according to claim 4, or the freeze-dried reagent according to any one of claims 5 to 8 in the preparation of a product for detecting the rs671 polymorphism of the ALDH2 gene.

Images