Trachinotus ovatus low-temperature tolerance character related molecular marker and application thereof

Abstract

The invention discloses a molecular marker related to the low-temperature tolerance character of trachinotus ovatus and application of the molecular marker, and belongs to the technical field of molecular biology. The molecular marker comprises seven SNP sites, namely SNP1-SNP7, the SNP1-SNP7 sites are sequentially located at the 3888 site, the 4043 site, the 4055 site, the 4181 site, the 4850 site, the 5212 site and the 5502 site of a gene sequence shown in SEQ ID NO.1, and the SNP1-SNP7 sites sequentially and respectively have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism. Researches show that the molecular marker is closely related to the low-temperature tolerance character of the trachinotus ovatus, the low-temperature tolerance capacity of the trachinotus ovatus can be accurately evaluated and screened in the early stage by utilizing the molecular marker, a powerful tool is provided for breeding cold-resistant varieties of the trachinotus ovatus, the breeding efficiency is improved, the breeding risk is reduced, and the molecular marker has important economic value and application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to molecular markers related to low temperature tolerance traits of golden pomfret and applications thereof. Background Art

[0002] Golden Pomfret Trachinotus ovatus ), scientific name Oval pomfret, belongs to the class of bony fishes ( Osteichthyes ), Perciformes ( Perciformes )、Crocuta ( Carangidae ), Pomfret ( Trachinotus ), with the advantages of fast growth, delicious meat and high economic value, it is widely cultivated in the coastal areas of southern my country. With the rapid development of golden pomfret farming, the requirements for its breeding environment and variety quality are also increasing.

[0003] Temperature is one of the important environmental factors that affect the growth and survival of golden pomfret. The suitable water temperature for the growth of golden pomfret is between 22 and 28℃. When the water temperature is lower than 16℃, the food intake of golden pomfret will be significantly reduced and the growth rate will slow down; when the water temperature is lower than 12℃, golden pomfret will suffer from varying degrees of frostbite or even die. In southern my country, extreme low temperatures occasionally occur in winter. If indoor factory farming is carried out in northern China, it will also consume a lot of energy to maintain water temperature in winter. Therefore, improving the low temperature tolerance of golden pomfret is of great significance for expanding the breeding area, reducing breeding costs, and reducing economic losses caused by low temperatures.

[0004] The traditional method of breeding cold-resistant varieties of golden pomfret mainly relies on phenotypic selection, that is, by observing the survival, growth performance and other phenotypic traits of golden pomfret individuals in a low-temperature environment to screen individuals with low-temperature tolerance. However, the phenotype is easily affected by environmental factors and has low accuracy. For example, under different aquaculture water bodies and water quality conditions, the low-temperature tolerance performance of golden pomfret individuals may vary, making it difficult to accurately reflect their genetic nature. Secondly, phenotypic selection requires observation under low-temperature stress conditions after the golden pomfret grows to a certain stage, which has a long cycle and high cost. Moreover, when the golden pomfret grows to the stage where low-temperature stress experiments can be carried out, a large amount of aquaculture resources have been consumed. If the genetic potential of the screened individuals is not good, it will cause a waste of resources. In addition, traditional breeding methods cannot accurately judge the genetic potential of individuals for low-temperature tolerance at an early stage, cannot quickly screen a large number of fry, and have low breeding efficiency.

[0005] With the development of molecular biology technology, it has become possible to use molecular markers closely related to target traits for assisted selection breeding. Molecular markers directly reflect the genetic differences of biological individuals at the DNA level, are generally not affected by environmental factors, and have the advantages of high stability and accuracy. By looking for molecular markers related to the low-temperature tolerance trait of golden pomfret, its low-temperature tolerance potential can be evaluated and screened at the juvenile stage or even the embryonic stage of golden pomfret, which can greatly shorten the breeding cycle, improve breeding efficiency, and reduce breeding risks. At present, there are relatively few studies on molecular markers related to the low-temperature tolerance trait of golden pomfret, and there is no systematic and effective molecular marker applied to the breeding of cold-resistant varieties of golden pomfret. Therefore, conducting research in this area is of great practical significance. Summary of the invention

[0006] In view of the deficiencies in the prior art, the present invention aims to provide molecular markers closely related to the low temperature tolerance trait of golden pomfret, as well as detection methods and applications based on the molecular markers, to solve the problems of long cycle, low efficiency, poor accuracy, etc. in the traditional method for breeding cold-resistant golden pomfret varieties, to achieve early and accurate screening of golden pomfret individuals with low temperature tolerance, and to provide effective technical means for the breeding of cold-resistant golden pomfret varieties.

[0007] The technical solution of the present invention mainly includes the following contents: On the one hand, the present invention relates to the application of SNP sites in breeding cold-resistant golden pomfret, including 7 SNP sites SNP1 to SNP7, wherein the SNP1 to SNP7 sites are located at positions 3888, 4043, 4055, 4181, 4850, 5212 and 5502 of the gene sequence shown in SEQ ID NO.1, and the SNP1 to SNP7 sites have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism, respectively.

[0008] Furthermore, if the bases at the SNP1 to SNP7 sites are, in sequence, T, T, G, T, G, T, and A homozygous genotypes, the low temperature resistance of the golden pomfret is better than that of other genotypes.

[0009] Furthermore, the other genotypes are homozygous genotypes in which the bases at SNP1 to SNP7 are C, A, A, G, C, C, G in sequence, or homozygous genotypes in which the bases at SNP1 to SNP7 are C, T, G, G, G, T, A in sequence.

[0010] In a second aspect, the present invention also includes the use of SNP sites in the preparation of products for breeding cold-resistant golden pomfret, wherein the SNPs include 7 SNP sites, SNP1 to SNP7, and the SNP1 to SNP7 sites are located at positions 3888, 4043, 4055, 4181, 4850, 5212 and 5502 of the gene sequence shown in SEQ ID NO.1. The SNP1 to SNP7 sites have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism, respectively. If the bases of the SNP1 to SNP7 sites are T, T, G, T, G, T, A homozygous genotypes, the cold resistance of the golden pomfret is better than that of other genotypes.

[0011] In a third aspect, the present invention relates to a method for screening cold-resistant golden pomfret, which identifies the cold-resistant trait of golden pomfret by detecting the SNP sites. When the bases of the SNP1 to SNP7 sites are homozygous genotypes of T, T, G, T, G, T, and A in sequence, the cold-resistant performance of the golden pomfret is better than that of other genotypes.

[0012] In a fourth aspect, the present invention relates to a method for breeding a cold-resistant golden pomfret strain, comprising the following steps: taking golden pomfret, and determining the genotype of the SNP1-SNP7 sites by genotyping technology; selecting broodstock whose bases at the SNP1-SNP7 sites are homozygous genotypes of T, T, G, T, G, T, and A in sequence for mating to obtain cold-resistant golden pomfret.

[0013] Beneficial effects of the present invention: The present invention found that 7 SNP sites are closely associated with the low temperature tolerance of golden pomfret. The SNP molecular markers provided by the present invention can be used to evaluate and screen the low temperature tolerance potential of golden pomfret in the juvenile stage or even in the embryonic stage, avoiding the disadvantage that traditional phenotypic selection requires golden pomfret to grow to a certain stage before screening, greatly shortening the breeding cycle and improving the breeding efficiency.

[0014] The invention is helpful to cultivate low-temperature-resistant golden pomfret varieties and improve the economic benefits of the breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Haplotype distribution diagram of 7 SNP loci. ALLELE: allele, Hap001: Hap1 haplotype, Hap002: Hap2 haplotype, Hap003: Hap3 haplotype. The numbers in the "freq" column on the right represent the frequencies of the corresponding haplotypes.

[0016] Figure 2:Distribution statistics of haplotypes Hap1, Hap2 and Hap3. Vertical axis (Y axis): represents "Coldtolerance", and the vertical axis value is used to measure the degree of cold tolerance. The horizontal axis (X axis) represents different haplotype categories. The median of cold tolerance data of the Hap001 (21) group is relatively high, indicating that the overall level of cold tolerance of individuals of this haplotype is relatively high. The median of cold tolerance data of the Hap002 (14) and Hap003 (13) groups is relatively low, indicating that the overall level of cold tolerance of individuals of these two haplotypes is relatively low. There is a significant difference in cold tolerance between Hap001 and Hap002 and Hap003 groups, which means that the cold tolerance of individuals of different haplotypes is significantly different. DETAILED DESCRIPTION

[0017] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0018] Example 1 Genotyping: The DNA of golden pomfret was extracted by phenol / chloroform method, detected by 1% agarose gel electrophoresis, and quantified by Qubit. The DNA was sheared with a shearing range of about 350bp. The resequencing library was constructed using the standard library construction process. After Qubit quantification, the library that passed the quality inspection was sequenced using the Illumina HiSeq X Ten platform with a sequencing depth of 5×. After sequencing, the Raw data was filtered to obtain the Clean data (valid data after filtering), and the reference sequence index was constructed using the BWA software. The Clean data was aligned to the golden pomfret reference genome sequence, and the sequencing depth, coverage, and alignment rate were calculated using the samtools software. The SNP calling was performed using the GATK software to obtain the gene analysis results and generate the vcf file. The SNP sites were quality controlled using the plink software. The quality control conditions were maf>0.05 and the missing rate <0.1. After obtaining a high-quality SNP data set, the missing genotypes were self-filled.

[0019] Method for measuring the cold tolerance of golden pomfret: start timing after the water temperature drops to 14°C. If a loss of equilibrium (LOE) appears after 1 hour, the cold tolerance is recorded as 1. Similarly, if a loss of equilibrium appears after 20 hours, the cold tolerance is recorded as 20.

[0020] The low temperature tolerance of golden pomfret was determined, and combined with whole genome resequencing, the potential SNP sites and candidate associated genes of low temperature tolerance were analyzed. GWAS whole genome association analysis was performed using mixed linear model (MLM). The results showed that the significant signal log10( P >5) Mainly concentrated in chromosomes Chr01, Chr05, Chr09, Chr10, and Chr20.

[0021] Based on the significant SNP sites associated with the above GWAS, LDblock analysis (linkage disequilibrium block analysis) was performed on the annotated upstream and downstream genes to see if there were highly linked blocks. The analysis results showed that there was a significantly associated LDblock region on chromosome 10. The Top SNP site (Chr10:16408500) was located in the intron of the gene TovChr10G006150, which encodes the α2δ-3 subunit of the L-type calcium channel, regulates the activity of calcium ion channels, and participates in physiological processes such as cell electrical signal transmission, muscle contraction, and hormone secretion. The calcium ion signaling pathway is crucial for maintaining neuronal excitability and muscle contraction ability under low temperature conditions, and it may enhance the cell's tolerance to low temperature by regulating calcium ion balance. Subsequently, we performed amino acid mutation analysis on the SNP sites in the coding region, and found that they were all synonymous mutations, and no non-synonymous mutations were found. Subsequently, we conducted haplotype analysis on the gene, and the results showed that three major haplotypes were identified, covering seven SNP sites, among which haplotype Hap1 had the highest frequency, and its low temperature tolerance trait showed a significant positive correlation compared with Hap2 and Hap3. The above results show that the Hap1 haplotype is one of the key haplotypes for the low temperature tolerance of the oval pomfret, providing important clues for a deeper understanding of the genetic mechanism of the low temperature tolerance trait of the oval pomfret.

[0022] The first SNP of the 7 SNP sites mentioned above is located at position 16437696 of chromosome 10 (i.e., position 3888 of SEQ ID NO.1), and there is a C / T polymorphism at this site. The second SNP is located at position 16437851 of chromosome 10 (i.e., position 4043 of SEQ ID NO.1), and there is a T / A polymorphism at this site. The third SNP site is located at position 16437863 of chromosome 10 (i.e., position 4055 of SEQ ID NO.1), and there is a G / A polymorphism at this site. The fourth SNP site is located at position 16437989 of chromosome 10 (i.e., position 4181 of SEQ ID NO.1), and there is a G / T polymorphism at this site. The fifth SNP site is located at position 16438658 of chromosome 10 (i.e., position 4182 of SEQ ID NO.1), and there is a G / T polymorphism at this site. NO.1, position 4850), which has a G / C polymorphism, the sixth SNP site is located at position 16439020 of chromosome 10 (i.e., position 5212 of SEQ ID NO.1), which has a T / C polymorphism, and the seventh SNP site is located at position 16439310 of chromosome 10 (i.e., position 5502 of SEQ ID NO.1), which has an A / G polymorphism.

[0023] In the haplotype Hap1, the bases of the above 7 sites are T, T, G, T, G, T, A (the corresponding homozygous genotypes are TT, TT, GG, TT, GG, TT, AA); in the haplotype Hap2, the bases of the above 7 sites are C, A, A, G, C, C, G (the corresponding homozygous genotypes are CC, AA, AA, GG, CC, CC, GG); in the haplotype Hap3, the bases of the above 7 sites are C, T, G, G, G, T, A (the corresponding homozygous genotypes are CC, TT, GG, GG, GG, TT, AA).

[0024] Gene sequence (SEQ ID NO.1): C GTCCCTGCAAGACACTTATTTGAAAGGATTGATAAAGGATAGCTATCACAGTTGCTGAGTAGTGATCATTAAGGTGCTTTAGCAATATCACATGAGCTACACAGACATGTTTTTGGGGAGATCCAAACTTTTAAGCATAGTAATAATTCTAACA T TGCACTTAGTA G CTTAAAAACTGCACAAGTGGCCCAGTAATACCCACAGACACTGACACCCACTATGTTCAGTCCTTTCAGGTAGCAGCTAAGGGCTGGGTTCTGTAGCTGGGCTTTGAACTGGGCATTAGAGCCAC GTAACACCAATGTGGATAAAGACAGGCGCACCTTTCCTTGGCCCATTCTGACTTTTCATGGACAATAATGATTCTGAAGATTAAAAAAAAAATAAATACTGAAGATGAAGATGATTATATGTGGCTGGGGTTGTAATGAAATGTTTGTCTAATGATCTTTTTTTTCATGTTGAGAAAAAAATAAGTTCTAGTATATATATATGAAGAGAAAAAAAAGTTTTATTTATGATTTGCAAGTGGTACCCATAAACTGTGACTATGAGATTTTGAGTCCTCTGACGTGAGTGGTTATAAATATTTGAGCTTTGCCTTATTGAACGATATTGGTCCTGTTTGT GTACTTTTGAAATAAAATGATGTTTAAAATCTATGCTGTTGTTGAGAGGCTCTTTAGCAAAGCAGACCTTGAAAAGAACAATAGACATCATATGAAGGATTCTCGCTATAGATTGTCTGTTGTTGCTGGCAGATGAATACAGTATCTGCTTAAATGGTCGGGGAAATGTTTGGCTGCTTTTTGCCCTCCACATGAGATGTGAGATGTGGCAGGCTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGCACATATGCAAGTATTTGTGTGTGTTCATCTGGTGTTTTCCTCTTCTGTCATTCATATACGCCTCTCCCCCAGAGGCTTATCCCCACACAAAGA GAGACAATAAAGACCATGACACTGAAATCGAAGGCCAACCACAACATACATCTGTACTTGTTTAGGAAATGGACACAAACAATCAAACTTTCTGACAAACATACCCATGTGCACATACATGCAAGGACAGGATTACTGTGCCATGCCAGATCAACTCTTGGTTGAGTGTCTGTGTGTTCATACATAGGAGCACAATAAGTGAATAAATGAAAAAAAGAAACCAACTAAAAGTTCTCTGTCAATGTCAGAAGGAGGCCACTCCGCTGTGGACTCTGTCAACACCAAGGGCCCTGTGGTCAACAATGGGACATGCTTAGACTCCATCTCTTTCTCCATCTCTCAGCTCGCCAGTTCCACTTACC T CCCACCCCACTTTCCTCCTCCACTGACAAGGTAATTCTCACCATCCTCATGCTCTAAACTATTCTCTACCGTTTCACTGATCTTGTCCCTCGAGCAGAACTGTGTGACTCTCTAATCATTCTCAGTTCATCCTGCTCTTCCCCTTGTTCTGGTCCAAAGACTCCCTGGTGGGTCATTTATCACTGCATAATGGGATTGGAGCTGTTTTGAGTCAACACGCATCTAATCCGGTCTGTGATTCCTTCCTGTTTGCCAGATGAGTTATGGGAAAGTGCATCCAATAGGCTAC A TGTACAAAAGGCAGACTTGGGAAAGCAATCTTCTTTCTGGGGAGATGCCACAATGGCAGCCCTGTTGCCACCTCGGGGCCCTGTGAGTGATAAATGCTCATCTCTGTTTTCTGTAAGCTGTTTTCCCCCACACACAGGTGCT Note: The underlined and bolded parts in SEQ ID NO.1 above represent the positions of SNP sites.

[0025] Example 2 Breeding Method of Low-Temperature Tolerant Trachinotus ovatus Strains Take golden pomfret and determine the genotype of the above 7 SNP loci of golden pomfret by genotyping technology. In the breeding season of golden pomfret, select the parent fish with excellent genotype (i.e., SNP1~SNP7 loci are T, T, G, T, G, T, A homozygous genotypes in sequence) for mating. The hatched offspring fish are better than the offspring fish of the ordinary mating combination in terms of low temperature tolerance.

[0026] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. Application of SNP loci in breeding cold-resistant golden pomfret, characterized in that: There are 7 SNP sites, including SNP1 to SNP7. SNP1 to SNP7 sites are located at positions 3888, 4043, 4055, 4181, 4850, 5212 and 5502 of the gene sequence shown in SEQ ID NO.1, and SNP1 to SNP7 sites have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism, respectively.

2. The use according to claim 1, characterized in that: If the bases at the SNP1 to SNP7 sites are, in sequence, T, T, G, T, G, T, and A homozygous genotypes, the low temperature resistance of the golden pomfret is better than that of other genotypes.

3. The use according to claim 2, characterized in that: The other genotypes are homozygous genotypes in which the bases at SNP1 to SNP7 are C, A, A, G, C, C, G in sequence, or homozygous genotypes in which the bases at SNP1 to SNP7 are C, T, G, G, G, T, A in sequence.

4. Application of SNP loci in the preparation of products for breeding low-temperature resistant golden pomfret, characterized in that: There are 7 SNP sites, including SNP1 to SNP7, which are located at positions 3888, 4043, 4055, 4181, 4850, 5212 and 5502 of the gene sequence shown in SEQ ID NO.

1.

5. The use according to claim 4, characterized in that: The SNP1~SNP7 sites have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism respectively.

6. The use according to claim 4, characterized in that: If the bases at the SNP1 to SNP7 sites are, in sequence, T, T, G, T, G, T, and A homozygous genotypes, the low temperature resistance of the golden pomfret is better than that of other genotypes.

7. A method for screening low-temperature resistant golden pomfret, characterized in that: The cold resistance trait of golden pomfret is identified by detecting the SNP sites described in claim 1. When the bases of the SNP1-SNP7 sites are homozygous genotypes of T, T, G, T, G, T, and A in sequence, the cold resistance of the golden pomfret is better than that of other genotypes.

8. A method for breeding a low-temperature resistant golden pomfret strain, characterized in that: The following steps are involved: Take golden pomfret, determine the genotype of the SNP1-SNP7 sites described in claim 1 by genotyping technology; select broodstock with homozygous genotypes of T, T, G, T, G, T, and A at the SNP1-SNP7 sites in sequence for mating, and obtain low-temperature-resistant golden pomfret.

Images