Molecular markers related to the low-temperature tolerance trait of Trachinotus ovatus and their applications

By discovering 7 SNP sites related to the low-temperature tolerance trait of the golden pompeople, the early screening of individuals with low-temperature tolerance in golden pompeople individuals was solved, and the traditional breeding methods were long cycles, low efficiency and poor accuracy were achieved, and an efficient and accurate breeding process was achieved.

CN119979731BActive Publication Date: 2025-06-20SANYA INST OF OCEANOGRAPHY OCEAN UNIV OF CHINA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510479960.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-06-20
Estimated Expiration
2045-04-17

AI Technical Summary

Technical Problem

The traditional golden pompa cold-resistant breeding methods have a long cycle, low efficiency and poor accuracy. They cannot accurately judge the individual's low temperature tolerance genetic potential in early stages, and it is difficult to quickly screen a large number of young fish.

Method used

By discovering seven SNP sites related to the low-temperature tolerance trait of the golden pompeople, these SNP sites were used for genotyping, and individuals with low-temperature tolerance were screened early.

Benefits of technology

It has achieved the evaluation and screening of its low-temperature tolerance potential in the young golden pombe during the stage and even the embryonic stage, shortening the breeding cycle and improving the breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119979731B_ABST
    Figure CN119979731B_ABST
Patent Text Reader

Abstract

The present invention discloses molecular markers related to the low-temperature tolerance trait of Trachinotus ovatus and their applications, belonging to the technical field of molecular biology. The molecular markers include 7 SNP loci, namely SNP1 to SNP7. The SNP1 to SNP7 loci are sequentially located at the 3888th, 4043rd, 4055th, 4181st, 4850th, 5212th, and 5502nd positions of the gene sequence shown in SEQ ID NO.1. The SNP1 to SNP7 loci respectively have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism, and A / G polymorphism. Research shows that the molecular markers are closely related to the low-temperature tolerance trait of Trachinotus ovatus. Using these molecular markers, the low-temperature tolerance ability of Trachinotus ovatus can be accurately evaluated and screened at an early stage, providing a powerful tool for the breeding of cold-resistant varieties of Trachinotus ovatus, improving the breeding efficiency, reducing the breeding risk, and having important economic value and application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and specifically relates to molecular markers related to the low-temperature tolerance trait of Trachinotus ovatus and their applications. Background Art

[0002] Trachinotus ovatus ( Trachinotus ovatus ), scientific name Trachinotus ovatus, belongs to Osteichthyes ( Osteichthyes ), Perciformes ( Perciformes ), Carangidae ( Carangidae ), Trachinotus ( Trachinotus ), and has the advantages of fast growth rate, delicious meat, high economic value, etc., and is widely cultured in the southern coastal areas of China. With the rapid development of the Trachinotus ovatus aquaculture industry, the requirements for its aquaculture environment and variety quality are also increasing day by day.

[0003] Temperature is one of the important environmental factors affecting the growth and survival of Trachinotus ovatus. The suitable growth water temperature of Trachinotus ovatus is between 22 - 28°C. When the water temperature is lower than 16°C, the food intake of Trachinotus ovatus will significantly decrease, and the growth rate will slow down; when the water temperature is lower than 12°C, Trachinotus ovatus will show varying degrees of frostbite or even death. In the south of China, extremely low-temperature weather occasionally occurs in winter. If indoor industrial aquaculture is carried out in the northern regions, a large amount of energy is required to maintain the water temperature in winter. Therefore, improving the low-temperature tolerance ability of Trachinotus ovatus is of great significance for expanding the aquaculture area, reducing the aquaculture cost, and reducing the economic losses caused by low temperature.

[0004] The traditional breeding method for cold-resistant Trachinotus ovatus varieties mainly relies on phenotypic selection, that is, by observing phenotypic traits such as the survival situation and growth performance of Trachinotus ovatus individuals in a low-temperature environment to screen individuals with low-temperature tolerance ability. However, phenotypes are easily affected by environmental factors and have low accuracy. For example, under different aquaculture water bodies and water quality conditions, the low-temperature tolerance performance of Trachinotus ovatus individuals may vary, making it difficult to accurately reflect their genetic essence. Secondly, phenotypic selection needs to be observed under low-temperature stress conditions after Trachinotus ovatus grows to a certain stage, with a long cycle and high cost. Moreover, when Trachinotus ovatus grows to the stage where low-temperature stress experiments can be carried out, a large amount of aquaculture resources have already been consumed. If the selected individuals have poor genetic potential, it will cause waste of resources. In addition, the traditional breeding method cannot accurately judge the low-temperature tolerance genetic potential of individuals at an early stage and cannot quickly screen a large number of juvenile fish, resulting in low breeding efficiency.

[0005] With the development of molecular biology techniques, it has become possible to carry out marker-assisted selection breeding using molecular markers closely related to target traits. Molecular markers directly reflect the genetic differences of biological individuals at the DNA level, are generally not affected by environmental factors, and have the advantages of high stability and accuracy. By searching for molecular markers related to the low-temperature tolerance trait of golden pompano, it is possible to evaluate and screen the low-temperature tolerance potential of golden pompano at the juvenile stage or even the embryonic stage, greatly shortening the breeding cycle, improving the breeding efficiency, and reducing the breeding risk. At present, the research on molecular markers related to the low-temperature tolerance trait of golden pompano is relatively scarce, and there is no systematic and effective molecular marker applied to the breeding of cold-resistant varieties of golden pompano. Therefore, carrying out research in this area has important practical significance. Summary of the Invention

[0006] In view of the deficiencies of the prior art, the present invention aims to provide molecular markers closely related to the low-temperature tolerance trait of golden pompano, as well as a detection method and application based on these molecular markers, to solve the problems of long cycle, low efficiency, and poor accuracy existing in the traditional breeding methods for cold-resistant varieties of golden pompano, and to achieve early and accurate screening of golden pompano individuals with low-temperature tolerance ability, providing an effective technical means for the breeding of cold-resistant varieties of golden pompano.

[0007] The technical solution of the present invention mainly includes the following content:

[0008] On the one hand, the present invention relates to the application of SNP loci in breeding low-temperature tolerant golden pompano, including a total of 7 SNP loci, namely SNP1 to SNP7. The SNP1 to SNP7 loci are sequentially located at positions 3888, 4043, 4055, 4181, 4850, 5212, and 5502 of the gene sequence shown in SEQ ID NO.1. The SNP1 to SNP7 loci respectively have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism, and A / G polymorphism in sequence.

[0009] Furthermore, if the bases of the SNP1 to SNP7 loci are in the homozygous genotype of T, T, G, T, G, T, A in sequence, the low-temperature tolerance performance of the said golden pompano is superior to other genotypes.

[0010] Furthermore, the said other genotypes are the homozygous genotype of C, A, A, G, C, C, G in sequence of the bases of the SNP1 to SNP7 loci or the homozygous genotype of C, T, G, G, G, T, A in sequence of the bases of the SNP1 to SNP7 loci.

[0011] In a second aspect, the present invention also includes the use of SNP loci in the preparation of products for breeding cold-tolerant golden pompano. The SNPs include a total of 7 SNP loci, namely SNP1 to SNP7. The SNP1 to SNP7 loci are sequentially located at positions 3888, 4043, 4055, 4181, 4850, 5212, and 5502 of the gene sequence shown in SEQ ID NO.1. The SNP1 to SNP7 loci respectively have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism, and A / G polymorphism in sequence. If the bases of the SNP1 to SNP7 loci are the homozygous genotype of T, T, G, T, G, T, A in sequence, then the cold tolerance of the golden pompano is better than that of other genotypes.

[0012] In a third aspect, the present invention relates to a method for screening cold-tolerant golden pompano, which identifies the cold-tolerant traits of golden pompano by detecting the SNP loci described above. When the bases of the SNP1 to SNP7 loci are the homozygous genotype of T, T, G, T, G, T, A in sequence, then the cold tolerance of the golden pompano is better than that of other genotypes.

[0013] In a fourth aspect, the present invention relates to a method for cultivating a cold-tolerant golden pompano strain, including the following steps: taking golden pompano, determining the genotypes of the SNP1 to SNP7 loci by genotyping technology; selecting broodstock with the homozygous genotype of T, T, G, T, G, T, A for the bases of the SNP1 to SNP7 loci to mate and obtaining cold-tolerant golden pompano.

[0014] Advantages of the present invention:

[0015] The present invention discovers that 7 SNP loci are closely associated with the cold tolerance of golden pompano. Using the SNP molecular markers provided by the present invention, the cold tolerance potential of golden pompano can be evaluated and screened at the juvenile stage or even the embryonic stage of golden pompano, avoiding the drawback that traditional phenotypic selection can only be carried out when golden pompano grows to a certain stage, greatly shortening the breeding cycle and improving the breeding efficiency.

[0016] The proposal of the present invention helps to cultivate cold-tolerant golden pompano varieties and improve the economic benefits of the aquaculture industry. Description of the drawings

[0017] Figure 1 : Haplotype distribution map of 7 SNP loci. ALLELE: Allele, Hap001: Hap1 haplotype, Hap002: Hap2 haplotype, Hap003: Hap3 haplotype. The numbers in the "freq" column on the right respectively represent the frequencies of the corresponding haplotypes.

[0018] Figure 2: Statistical distribution chart of haplotypes Hap1, Hap2, and Hap3. Ordinate (Y-axis): represents "Coldtolerance" (cold tolerance), and the ordinate values are used to measure the degree of cold tolerance. The abscissa (X-axis) represents different haplotype categories. The median of the cold tolerance data in the Hap001(21) group is relatively high, indicating that the overall cold tolerance level of individuals with this haplotype is relatively high. The medians of the cold tolerance data in the Hap002(14) and Hap003(13) groups are relatively low, indicating that the overall cold tolerance levels of individuals with these two haplotypes are relatively low. There are significant differences in cold tolerance between the Hap001 group and the Hap002 and Hap003 groups, meaning that the cold tolerance of individuals with different haplotypes is significantly different. Detailed implementation manner

[0019] To better understand the technical content of the present invention, the following further describes the present invention in conjunction with specific embodiments and drawings.

[0020] Example 1

[0021] Genotyping: Extract the DNA of Trachinotus ovatus using the phenol / chloroform method. After detecting by 1% agarose gel electrophoresis, quantify the DNA using Qubit; break the DNA, with the break range of about 350bp; complete the construction of the re-sequencing library using the standard library construction process; after Qubit quantification, sequence the library passing the quality inspection using the Illumina HiSeq X Ten platform, with the sequencing depth of 5×. After sequencing is completed, filter the Raw data (raw sequencing data) to obtain Clean data (filtered valid data), use the BWA software to construct the reference sequence index, align the Clean data to the Trachinotus ovatus reference genome sequence, and use the samtools software to count the sequencing depth, coverage rate, and alignment rate; use the GATK software for SNP calling (SNP interpretation) to obtain the gene analysis results and generate a vcf file, and use the plink software to perform quality control on the SNP sites, with the quality control conditions of maf>0.05 and the missing rate<0.1. After obtaining the high-quality SNP data set, perform self-filling on the missing genotypes.

[0022] Method for measuring the cold tolerance of Trachinotus ovatus: After the water temperature drops to 14°C, start timing. If the loss of equilibrium (LOE) appears after 1 hour, the cold tolerance is recorded as 1, and so on. If the loss of equilibrium appears after 20 hours, the cold tolerance is recorded as 20.

[0023] The low-temperature tolerance traits of Trachinotus ovatus were measured, and at the same time, combined with whole-genome resequencing, the potential SNP loci and candidate associated genes for low-temperature tolerance traits were analyzed. Genome-wide association study (GWAS) was performed using the mixed linear model (MLM). The results showed that the significant signals with log10( P >5) above the threshold line in the Manhattan plot were mainly concentrated on chromosomes Chr01, Chr05, Chr09, Chr10, and Chr20.

[0024] Based on the significant SNP loci associated by the above GWAS, LDblock analysis (linkage disequilibrium block analysis) was performed on the annotated upstream and downstream genes to see if there were highly linked Block regions. The analysis results showed that there was a significantly associated LDblock region on chromosome 10. The Top SNP locus (Chr10:16408500) was located in the intron of the gene TovChr10G006150, which encodes the α2δ-3 subunit of the L-type calcium channel, regulates the activity of calcium ion channels, and participates in physiological processes such as cell electrical signal transmission, muscle contraction, and hormone secretion. The calcium ion signaling pathway is crucial for maintaining neuronal excitability and muscle contraction ability under low-temperature conditions, and it may enhance the low-temperature tolerance of cells by regulating calcium ion balance. Subsequently, amino acid mutation analysis was performed on the SNP loci in the coding region, and the results found that they were all synonymous mutations, and no non-synonymous mutations were found. Subsequently, haplotype analysis of this gene was carried out. The analysis results showed that 3 main haplotypes were identified, covering 7 SNP loci. Among them, the frequency of haplotype Hap1 was the highest, and it showed a significant positive correlation with the low-temperature tolerance trait compared with Hap2 and Hap3. The above results indicate that the Hap1 haplotype is one of the key haplotypes for Trachinotus ovatus to tolerate low temperature, providing an important clue for further understanding the genetic mechanism of the low-temperature tolerance trait of Trachinotus ovatus.

[0025] The first SNP among the above-mentioned 7 SNP loci is located at position 16437696 on chromosome 10 (i.e., the 3888th position of SEQ ID NO.1), and there is a C / T polymorphism at this locus. The second SNP is located at position 16437851 on chromosome 10 (i.e., the 4043rd position of SEQ ID NO.1), and there is a T / A polymorphism at this locus. The third SNP locus is located at position 16437863 on chromosome 10 (i.e., the 4055th position of SEQ ID NO.1), and there is a G / A polymorphism at this locus. The fourth SNP locus is located at position 16437989 on chromosome 10 (i.e., the 4181st position of SEQ ID NO.1), and there is a G / T polymorphism at this locus. The fifth SNP locus is located at position 16438658 on chromosome 10 (i.e., the 4850th position of SEQ ID NO.1), and there is a G / C polymorphism at this locus. The sixth SNP locus is located at position 16439020 on chromosome 10 (i.e., the 5212th position of SEQ ID NO.1), and there is a T / C polymorphism at this locus. The seventh SNP locus is located at position 16439310 on chromosome 10 (i.e., the 5502nd position of SEQ ID NO.1), and there is an A / G polymorphism at this locus.

[0026] In the haplotype Hap1, the bases at the above 7 loci are T, T, G, T, G, T, A (the corresponding homozygous genotypes are TT, TT, GG, TT, GG, TT, AA); in the haplotype Hap2, the bases at the above 7 loci are C, A, A, G, C, C, G (the corresponding homozygous genotypes are CC, AA, AA, GG, CC, CC, GG); in the haplotype Hap3, the bases at the above 7 loci are C, T, G, G, G, T, A (the corresponding homozygous genotypes are CC, TT, GG, GG, GG, TT, AA).

[0027] Gene sequence (SEQ ID NO.1):

[0028] C GTCCCTGCAAGACACTTATTTGAAAGGATTGATAAAGGATAGCTATCACAGTTGCTGAGTAGTGATCATTAAGGTGCTTTAGCAATATCACATGAGCTACACAGACATGTTTTTGGGGAGATCCAAACTTTTAAGCATAGTAATAATTCTAACA T TGCACTTAGTA G CTTAAAAACTGCACAAGTGGCCCAGTAATACCCACAGACACTGACACCCACTATGTTCAGTCCTTTCAGGTAGCAGCTAAGGGCTGGGTTCTGTAGCTGGGCTTTGAACTGGGCATTAGAGCCAC GTAACACCAATGTGGATAAAGACAGGCGCACCTTTCCTTGGCCCATTCTGACTTTTCATGGACAATAATGATTCTGAAGATTAAAAAAAAATAATACTGAAGATGAAGATGATTATATGTGGCTGGGGTTGTAATGAAATGTTTGTCTAATGATCTTTTTTTTCATGTTGAGAAAAAAATAAGTTCTAGTATATATATATGAAGAGAAAAAAAAGTTTTATTTATGATTTGCAAGTGGTACCCATAAACTGTGACTATGAGATTTTGAGTCCTCTGACGTGAGTGGTTATAAATATTTGAGCTTTGCCTTATTGAACGATATTGGTCCTGTTTGTGTACTTTTGAAATAAAATGATGTTTAAAATCTATGCTGTTGTTGAGAGGCTCTTTAGCAAAGCAGACCTTGAAAAGAACAATAGACATCATATGAAGGATTCTCGCTATAGATTGTCTGTTGTTGCTGGCAGATGAATACAGTATCTGCTTAAATGGTCGGGGAAATGTTTGGCTGCTTTTTGCCCTCCACATGAGATGTGAGATGTGGCAGGCTTGTGTGTGTGTGTGTGTGTGTGTGCACATATGCAAGTATTTGTGTGTGTTCATCTGGTGTTTTCCTCTTCTGTCATTCATATACGCCTCTCCCCCAGAGGCTTATCCCCCACACAAAGA GAGACAATAAAGACCATGACACTGAAATCGAAGGCCAACCACAACATACATCTGTACTTGTTTAGGAAATGGACACAAACAATCAAACTTTCTGACAAACATACCCATGTGCACATACATGCAAGGACAGGATTACTGTGCCATGCCAGATCAACTCTTGGTTGAGTGTCTGTGTGTTCATACATAGGAGCACAATAAGTGAATAAATGAAAAAAAGAAACCAACTAAAAGTTCTCTGTCAATGTCAGAAGGAGGCCACTCCGCTGTGGACTCTGTCAACACCAAGGGCCCTGTGGTCAACAATGGGACATGCTTAGACTCCATCTCTTTCTCCATCTCTCAGCTCGCCAGTTCCACTTACC T CCCACCCCACTTTCCTCCTCCACTGACAAGGTAATTCTCACCATCCTCATGCTCTAAACTATTCTCTACCGTTTCACTGATCTTGTCCCTCGAGCAGAACTGTGTGACTCTCTAATCATTCTCAGTTCATCCTGCTCTTCCCCTTGTTCTGGTCCAAAGACTCCCTGGTGGGTCATTTATCACTGCATAATGGGATTGGAGCTGTTTTGAGTCAACACGCATCTAATCCGGTCTGTGATTCCTTCCTGTTTGCCAGATGAGTTATGGGAAAGTGCATCCAATAGGCTAC A TGTACAAAAGGCAGACTTGGGAAAGCAATCTTCTTTCTGGGGAGATGCCACAATGGCAGCCCTGTTGCCACCTCGGGGCCCTGTGAGTGATAAATGCTCATCTCTGTTTTCTGTAAGCTGTTTTCCCCCACACACAGGTGCT

[0029] Note: The underlined and bolded positions in SEQ ID NO.1 above represent the positions of SNP sites.

[0030] Breeding method for cold-tolerant Trachinotus ovatus strain in Example 2

[0031] Take the golden pompano and determine the genotypes of the above 7 SNP loci in the golden pompano through genotyping technology. During the breeding season of the golden pompano, select broodstock with excellent genotypes (that is, the homozygous genotypes of SNP1-SNP7 loci are T, T, G, T, G, T, A in sequence) for mating. The offspring fish hatched are superior to the offspring fish of ordinary mating combinations in terms of low-temperature tolerance.

[0032] The above are only partial embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall fall within the protection scope of the present invention.

Claims

1. Application of SNP loci in breeding cold-resistant golden pomfret, characterized in that: There are 7 SNP sites, including SNP1 to SNP7. SNP1 to SNP7 sites are located at positions 3888, 4043, 4055, 4181, 4850, 5212 and 5502 of the gene sequence shown in SEQ ID NO.1, and SNP1 to SNP7 sites have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism, respectively.

2. The use according to claim 1, characterized in that: If the bases at the SNP1 to SNP7 sites are, in sequence, T, T, G, T, G, T, and A homozygous genotypes, the low temperature resistance of the golden pomfret is better than that of other genotypes.

3. The use according to claim 2, characterized in that: The other genotypes are homozygous genotypes in which the bases at SNP1 to SNP7 are C, A, A, G, C, C, G in sequence, or homozygous genotypes in which the bases at SNP1 to SNP7 are C, T, G, G, G, T, A in sequence.

4. Application of SNP loci in the preparation of products for breeding low-temperature resistant golden pomfret, characterized in that: There are 7 SNP sites, including SNP1 to SNP7, which are located at positions 3888, 4043, 4055, 4181, 4850, 5212 and 5502 of the gene sequence shown in SEQ ID NO.

1.

5. The use according to claim 4, characterized in that: The SNP1~SNP7 sites have C / T polymorphism, T / A polymorphism, G / A polymorphism, G / T polymorphism, G / C polymorphism, T / C polymorphism and A / G polymorphism respectively.

6. The use according to claim 4, characterized in that: If the bases at the SNP1 to SNP7 sites are, in sequence, T, T, G, T, G, T, and A homozygous genotypes, the low temperature resistance of the golden pomfret is better than that of other genotypes.

7. A method for screening low-temperature resistant golden pomfret, characterized in that: The cold resistance trait of golden pomfret is identified by detecting the SNP sites described in claim 1. When the bases of the SNP1-SNP7 sites are homozygous genotypes of T, T, G, T, G, T, and A in sequence, the cold resistance of the golden pomfret is better than that of other genotypes.

8. A method for breeding a low-temperature resistant golden pomfret strain, characterized in that: The following steps are involved: Take golden pomfret, determine the genotype of the SNP1-SNP7 sites described in claim 1 by genotyping technology; select broodstock with homozygous genotypes of T, T, G, T, G, T, and A at the SNP1-SNP7 sites in sequence for mating, and obtain low-temperature-resistant golden pomfret.

Citation Information

Patent Citations

  • SNP molecular marker related to hypoxia resistance trait of Trachinotus ovatus and application of SNP molecular marker

    CN113151492A

  • SNP site related to growth traits of trachinotus ovatus and application of SNP site

    CN119685493A