Specific recognition primer and identification method of lactobacillus casei

Abstract

The invention relates to a specific recognition primer and an identification method of lactobacillus casei. The primer comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer comprises a sequence as shown in SEQ ID NO.1 or a sequence with the homology not lower than 90% of the sequence as shown in SEQ ID NO.1, and the reverse primer comprises a sequence as shown in SEQ ID NO.2 or a sequence with the homology not lower than 90% of the sequence as shown in SEQ ID NO.2. According to the invention, genomes of lactobacillus casei and similar strains thereof are deeply analyzed, a specific target fragment is excavated, and a specific amplification primer is ingeniously designed, so that nucleic acid in lactobacillus casei can be amplified in a high-sensitivity and specific manner, and the method can be applied to high-sensitivity and specific selection and identification of lactobacillus casei.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a specific recognition primer and an identification method of Lactobacillus casei. Background Art

[0002] Lactobacillus casei is a beneficial microorganism widely found in the human oral cavity, intestines, and dairy products such as milk and cheese. It is an edible species. With the continuous deepening of research, the significant probiotic effects of Lactobacillus casei in nutrition, immunity, and disease prevention have become more and more the focus of research, development, and production. Research and development of functional health foods using Lactobacillus casei have important significance and economic value.

[0003] Since Lactobacillus casei was proposed as a new species in 1971, its classification has been changing. In the early classification system, Lactobacillus casei contained 5 subspecies, but after some new taxonomic studies, some of the subspecies were renamed as Lactobacillus rhamnosus and Lactobacillus paracasei. These changes in naming are more likely to confuse researchers. Due to the close relationship between Lactobacillus casei and Lactobacillus paracasei, many model strains of Lactobacillus casei have been found to be Lactobacillus paracasei, which has brought great troubles and challenges to the research and development of Lactobacillus casei.

[0004] In addition, some subspecies of Lactobacillus casei have been reclassified as other strains, which has also led to a decrease in the richness of Lactobacillus casei in environmental samples. Since Lactobacillus casei and Lactobacillus rhamnosus and Lactobacillus paracasei are similar in bacterial morphology, physiological and biochemical characteristics, and their 16s rDNA sequences also have a high degree of homology, traditional screening and identification methods are often cumbersome and complicated to operate, and require repeated verification by multiple methods, and the screening success rate is low. Therefore, efficient and rapid identification of Lactobacillus casei has become one of the hot spots in the field of Lactobacillus casei research. For example, CN116121423A discloses a primer probe, a kit and a method for rapid identification of Lactobacillus casei, wherein the primer probe comprises any one or two of the following primer pairs: 1142-aF: 5'-CTAAGGTAGCTGATCGGTGGCACGATC-3', 1142-aR: 5'-CACTCTTGCCAATGGTCATCGCTG-3'; 1142-2-F: 5'-CAATCCATCAGTCAGAATGT GGAAGC-3', 1142-2-R: 5'-CGAATGCACATGAGGATATCATTT CAGC-3'; the primer probe and the kit product can quickly detect whether the product contains Lactobacillus casei.

[0005] In summary, the development of more specific detection methods to efficiently and quickly identify Lactobacillus casei is of great significance in the field of Lactobacillus casei research. Summary of the invention

[0006] In view of the deficiencies in the prior art and actual needs, the present invention provides a specific recognition primer and identification method for Lactobacillus casei to solve the problems that it is difficult to select and identify Lactobacillus casei from samples, and the process is cumbersome and time-consuming.

[0007] To achieve this object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a specific identification primer for Lactobacillus casei, wherein the primer comprises a forward primer and a reverse primer, wherein the nucleic acid sequence of the forward primer comprises a sequence shown in SEQ ID NO.1 or a sequence having a homology thereto of not less than 90% (for example, it may be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, etc.), and the nucleic acid sequence of the reverse primer comprises a sequence shown in SEQ ID NO.2 or a sequence having a homology thereto of not less than 90% (for example, it may be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, etc.).

[0009] The present invention deeply analyzes the genome of Lactobacillus casei and similar bacterial species, mines specific target fragments, and cleverly designs specific amplification primers, which can achieve high-sensitivity and specific amplification of nucleic acids in Lactobacillus casei, thereby being applicable to high-sensitivity and specific detection of Lactobacillus casei.

[0010] SEQ ID NO. 1: 5'-AGTTTTGGTCGATGAACGG-3'.

[0011] SEQ ID NO. 2: 5'-CACCTTCCTCCGGGTTTGTC-3'.

[0012] In addition, relevant technical personnel in this professional field should understand that the specific primers provided by the present invention should not be limited to specific sequences. Primer sequences that are subjected to simple base modifications (deletion, replacement or addition, etc.) based on the primer sequences provided by the present invention and have similar amplification results are also within the scope of protection of the present invention.

[0013] In a second aspect, the present invention provides use of the specific recognition primers for Lactobacillus casei described in the first aspect in preparing a product for detecting Lactobacillus casei.

[0014] In a third aspect, the present invention provides a kit for detecting Lactobacillus casei, wherein the kit comprises the specific recognition primers for Lactobacillus casei described in the first aspect.

[0015] Preferably, the kit further comprises a PCR amplification reagent.

[0016] Preferably, the PCR amplification reagent includes DNA polymerase, dNTPs, Mg 2+ Or at least one of the PCR reaction buffers.

[0017] It is understandable that corresponding reagents for PCR amplification can be selected according to reagent requirements.

[0018] In a third aspect, the present invention provides use of the specific recognition primers for Lactobacillus casei described in the first aspect in detecting Lactobacillus casei.

[0019] In a fourth aspect, the present invention provides a method for identifying Lactobacillus casei in a sample, the method comprising:

[0020] Take a sample to be tested, collect bacteria in the sample, use the bacteria or the genomic DNA of the bacteria as a template, prepare a PCR amplification system with the specific recognition primers of Lactobacillus casei described in the first aspect, perform PCR amplification, and determine whether the sample to be tested contains Lactobacillus casei according to the amplification result.

[0021] Preferably, the PCR amplification further comprises the step of performing agarose gel electrophoresis on the PCR product.

[0022] Preferably, the reaction procedure of the PCR amplification includes:

[0023] Pre-denaturation at 94-95°C for 3-10 min;

[0024] 94-95°C denaturation for 15-30s, 54-58°C annealing for 15-30s, 70-73°C extension for 20-45s, 30-35 cycles;

[0025] Final extension at 70-73°C for 5-8 min.

[0026] Preferably, the size of the product amplified by PCR is 1142 bp. If a product fragment of the expected size is obtained, it indicates that the sample to be tested contains Lactobacillus casei, otherwise it does not contain Lactobacillus casei (or is not detected).

[0027] In the present invention, based on the designed specific primers, non-nucleic acid extraction-based specific identification can be further performed, and the bacteria can be directly used as an amplification template, which can effectively solve the current problems of difficulty in selecting and identifying Lactobacillus casei from environmental samples and the cumbersome and time-consuming process.

[0028] Compared with the prior art, the present invention has at least the following beneficial effects:

[0029] The invention designs primers for specifically detecting Lactobacillus casei, can amplify the sequence of Lactobacillus casei with high sensitivity and specificity, further develops a method for specifically identifying Lactobacillus casei in a non-nucleic acid extraction manner, simplifies the experimental steps, eliminates the need for nucleic acid extraction, reduces reaction time and cost, and is easy for experimenters to master. The method can be used to quickly identify whether food and probiotic preparations contain Lactobacillus casei, thereby preventing some strains with excellent characteristics from being misappropriated; in addition, the method can also perform preliminary identification on complex mixed bacteria in collected samples, thereby providing a basis for further separating and screening Lactobacillus casei from the samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The electrophoresis result diagram of using the primers of the present invention to amplify the known Lactobacillus casei;

[0031] Figure 2 The electrophoresis result diagram of amplifying known Lactobacillus casei using the primers of the present invention and primers subjected to base mutation based on the primers;

[0032] Figure 3 The primers of the present invention and other primers are used to amplify the electrophoresis detection results of known Lactobacillus casei and Lactobacillus paracasei;

[0033] Figure 4 The primers of the present invention are used to amplify the electrophoresis detection results of known Lactobacillus casei and other lactobacilli;

[0034] Figure 5 The electrophoresis detection result diagram of using the primers of the present invention to amplify the suspension of Lactobacillus casei with different concentration gradients and the fermented dairy products mixed with Lactobacillus casei with different concentration gradients;

[0035] Figure 6 The figure is the result of amplification electrophoresis detection of the enriched solution of the collected sample using the primers of the present invention. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0037] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0038] The culture medium formula used in the specific embodiment of the present invention is as follows.

[0039] MRS medium formula: peptone 10g / L, beef extract powder 5g / L, yeast powder 5g / L, glucose 20g / L, sodium acetate 5g / L, diammonium hydrogen citrate 2g / L, Tween 80 1g / L, potassium hydrogen phosphate 2g / L, magnesium sulfate 0.2g / L, manganese sulfate 0.05g / L and distilled water, pH 6.5, high temperature sterilization at 121℃ for 20min.

[0040] LBS medium formula: tryptone 10g / L, yeast powder 5g / L, potassium dihydrogen phosphate 6g / L, ferrous sulfate 0.034g / L, magnesium sulfate 0.575g / L, glucose 20g / L, sodium acetate 25g / L, ammonium citrate 2g / L, manganese sulfate 0.12g / L, Tween 801g / L, glacial acetic acid 1.3mL / L and distilled water, pH 5.5, additional 1.5% agar powder was added to the solid LBS medium, and sterilized at 121°C for 20min.

[0041] Example 1

[0042] The present embodiment carries out the conventional separation and identification of Lactobacillus casei.

[0043] (1) Strain isolation

[0044] Collect feces or fermented dairy product samples, place the samples in sterile sampling tubes and transport them in ice boxes, dilute them with 0.85% saline gradients under sterile conditions, select appropriate dilution gradients and spread them on LBS solid culture medium plates, and culture them at 37°C for 60 hours. Pick suspected single colonies by observing their colony morphology with the naked eye, observe them under a microscope, and perform preliminary screening and purification culture. After purification, culture them at 37°C in anaerobic tubes containing MRS liquid culture medium for 10 hours, centrifuge to remove the supernatant, resuspend them in sterile 27% glycerol aqueous solution, and store them in an ultra-low temperature refrigerator for later use.

[0045] (2) Strain identification

[0046] The target strains were isolated and screened by liquid propagation culture, and the cells were collected. The genomic DNA was extracted using a microbial genome extraction kit (Tiangen Biochemical Technology Co., Ltd., DP302). The 16S rDNA sequence was amplified using the 16S rDNA universal primers 27F and 1492R described in CN114574405A. The PCR amplification products were detected by agarose gel electrophoresis, and the PCR products were sequenced. The PCR reaction system: 10 μL of 10× buffer, 2 μL of 10 mM dNTPs, 1 μL of upstream and downstream primers, 2 μL of DNA template, 0.5 μL of Taq enzyme, ddH 2O 34μL. Pre-denaturation at 95℃ for 10min; then 35 cycles of 94℃30s, 60℃30s, 72℃1min, and then extension at 72℃ for 5min. Take 5μL of the PCR product and electrophoresed it in a 1% SYBR Green I pre-stained agarose gel at 140V for 22min. Use a gel imaging system to observe the bands and take pictures. After gel electrophoresis detection, send it to Wuhan Jinkairui Bioengineering Co., Ltd. for sequencing. The identified gene sequence was compared with the BLAST tool in the NCBI (National Center for Biotechnology Information) database, and the presence of Lactobacillus casei was finally determined based on the comparison results.

[0047] The 16S rDNA sequence of the strain to be tested has the highest matching degree with the 16S ribosomal RNA sequence of Lactobacillus casei DSM 20011=JCM 1134=ATCC393 in the NCBI database, and its homology reaches 99.93%, so the strain to be tested is named as Lactobacillus casei. However, it is worth noting that the homology of the strain to be tested and the 16S rDNA sequence of Lactobacillus paracasei NBRC 15889 in the database can also reach more than 99%, so the 16S universal primer amplification sequence sequencing comparison method cannot accurately distinguish Lactobacillus casei from other closely related strains, and there is a possibility of misjudgment in its naming.

[0048] Example 2

[0049] This example designs specific primers for Lactobacillus casei.

[0050] The NCBI database was consulted and the genome sequences of Lactobacillus casei were compared with those of 10 other strains with high homology. The comparison results were analyzed to find sequences that were highly conserved in Lactobacillus casei but different in other strains. On this basis, specific primers for identification of Lactobacillus casei were designed.

[0051] The forward primer sequence was named Lca-F1, with a nucleic acid sequence of 5′-AGTTTTGGTCGATGAACGG-3′, and the reverse primer sequence was named Lca-R1, with a nucleic acid sequence of 5′-CACCTTCCTCCGGTTTGTC-3′.

[0052] Using the designed primer sequence, a strain of Lactobacillus casei identified by 16S primer amplification sequence was re-amplified and electrophoresed. 2 O was purchased from Guangzhou Dongsheng Biotechnology Co., Ltd. (Cat. No.: P2012), and the primer sequence was synthesized by Wuhan Jinkairui Bioengineering Co., Ltd. Figure 1As shown, wherein, M: DL2000 DNA maker, lane Lca-1: PCR amplification product of the strain to be tested, it can be seen that a single band is detected by electrophoresis of the PCR amplification product of the strain to be tested, and the amplification size is consistent with the size of the target fragment, indicating that the primers designed by the present invention are correct for the amplification result of Lactobacillus casei.

[0053] Example 3

[0054] This example detects the amplification after base mutation based on the designed primer sequence.

[0055] The specific primers designed in Example 2 were used to perform single or multiple base mutations, and the primer sequences obtained were as follows:

[0056] Forward primer sequence Lca-F2: AGTTTCGGTCGATGAACGG (SEQ ID NO. 3);

[0057] Reverse primer sequence Lca-R2: CACCTTCCTCCGGTTGGTC (SEQ ID NO. 4);

[0058] Forward primer sequence Lca-F3: AGTTTCGGTCGATGAAAGG (SEQ ID NO. 5);

[0059] Reverse primer sequence Lca-R3: CACCTTCCACCGGTTGGTC (SEQ ID NO. 6).

[0060] The primers designed in Example 2 were used in different combinations with the primers after base mutation to perform PCR amplification detection on a strain of Lactobacillus casei, and the agarose gel electrophoresis results were analyzed. Figure 2 As shown, M: DL2000 DNAmaker, lane 1: primer combination Lca-F1 / Lca-R2, lane 2: primer combination Lca-F1 / Lca-R3, lane 3: primer combination Lca-F2 / Lca-R1, lane 4: primer combination Lca-F3 / Lca-R1, lane 5: primer combination Lca-F2 / Lca-R2, lane 6: primer combination Lca-F3 / Lca-R3, lane 7: primer combination Lca-F1 / Lca-R1. Lca-F1 / R1 is the specific primer combination designed in Example 2, and the others are primer combinations containing base mutations. The results showed that the brightness and size of the amplified bands of the primer combinations Lca-F1 / Lca-R3, Lca-F2 / Lca-R1, and Lca-F2 / Lca-R2 were similar to those of the primer combination Lca-F1 / Lca-R1, indicating that partial base mutations based on the primers designed in Example 2 did not affect the amplification results, and such mutant primers should be within the scope of protection of the present invention.

[0061] Example 4

[0062] This example verifies the specificity of the Lactobacillus casei detection primers.

[0063] The primer combination designed in Example 2 was tested together with the primer combination designed based on literature reports and other gene sequences. The specific sequence of the primer combination used is as follows:

[0064] Primer combination 1: Lca-F1: AGTTTTGGTCGATGAACGG, Lca-R1: CACCTTCCTCCGGTTTGTC;

[0065] Primer combination 2: Lc-F: CAAGCGTTTGCCAATGGCCG, Lc-R: TTCGGCAACCAACTTGGCGC;

[0066] Primer combination 3: IDL11F: TGGTCGGCAGAGTAACTGTTGTC, IDL04R: CCGGCAGTCTTACTAGAGTG;

[0067] Primer combination 4: dnaJPAf: CGGCTGCGAACTGCATTA, dnaJPAr: TTCCTGCTGGCACCCAAA;

[0068] Primer combination 5: 06232F:TCAACCGTGACTGGCAAGT, 06232R:AGCGGCTTGTCGAACTGA;

[0069] Primer combination 6: M13–47: CGCCAGGGTTTTCCCAGTCACGAC, M13–48: AGCGGATAACAATTTCACACAGGA;

[0070] Primer combination 7: LCgprpoA-F2: CACTCAARATGAAYACYGATGA, LCgprpoA-R2: CGTGGTGAGATTGAGCCAT;

[0071] Primer combination 8: casei-F: TGCACTGAGATTCGACTTAA, Y2-R: CCCACTGCTGCCTCCCGTAGGAGT;

[0072] Primer combination 9: PrI-F: CAGACTGAAAGTCTGACGG, CasII-R: GCGATGCGAATTTCTTTTTC;

[0073] All primer combinations were compared with the NCBI database, among which primer combination 1 amplified a size of 1142bp, primer combination 2 amplified a size of 391bp, primer combination 3 amplified a size of 712bp, primer combination 4 amplified a size of 836bp but with base mismatches, primer combinations 5 and 6 did not match the genome sequence, primer combination 7 amplified a size of 364bp, primer combination 8 amplified a size of 295bp, and primer combination 9 amplified a size of 2722bp but with base mismatches.

[0074] The specific primers designed in Example 2 and other primer combinations were used for PCR amplification detection of Lactobacillus casei and Lactobacillus paracasei, and the agarose gel electrophoresis results were analyzed. Figure 3 As shown, wherein, M: DL2000 DNAmaker, lane 1: primer combination 1, lane 2: primer combination 2, lane 3: primer combination 3, lane 4: primer combination 4, lane 5: primer combination 5, lane 6: primer combination 6, lane 7: primer combination 7, lane 8: primer combination 8, lane 9: primer combination 9. In the results, primer combinations 1, 2, 3, 7, and 8 can detect amplification in Lactobacillus casei and the band size is in line with expectations, but primer combinations 2, 3, 7, and 8 can also detect amplification in Lactobacillus paracasei. The results show that primer combination 1 can only detect a single band in Lactobacillus casei, and has stronger specificity than other primer combinations, indicating that the present invention designs a specific primer combination to achieve high-specificity detection.

[0075] To further determine the specificity of the primers designed in Example 2, PCR amplification was performed on 4 different isolated Lactobacillus casei strains and more other strains using the primers designed in Example 2. The agarose gel electrophoresis results were analyzed. Figure 4 As shown, wherein, M: DL2000 DNA maker, lane 1: Lactobacillus plantarum, lane 2: Lactobacillus salivae, lane 3: Lactobacillus oralis, lane 4: Lactobacillus rhamnosus, lane 5: Lactobacillus casei-1, lane 6: Lactobacillus casei-2, lane 7: Lactobacillus casei-3, lane 8: Lactobacillus casei-4, lane 9: Lactobacillus pentosus, lane 10: Lactobacillus paracasei, lane 11: Lactobacillus fermentans. The results showed that the amplified fragment sizes of the four strains of Lactobacillus casei were consistent with the expected fragment sizes, while no amplified fragment bands were detected for the other strains, indicating that this method can specifically identify Lactobacillus casei.

[0076] Example 5

[0077] This example tests the lower limit of detection of Lactobacillus casei in the collected samples.

[0078] The OD value of Lactobacillus casei transferred to MRS medium and cultured for 4 h was measured and diluted to 1 OD, and then graded diluted to 10-1 , 10 -2 , 10 -3 , 10 -4 OD. Then Lactobacillus casei was mixed into the collected fermented milk sample, and its final concentration in the sample also reached 10 -1 , 10 -2 , 10 -3 , 10 -4 OD. The bacterial solution samples and mixed samples were amplified using Lactobacillus casei specific primers (Lca-F1, Lca-R1) to detect the Lactobacillus casei therein. Figure 5 As shown, M: DL2000 DNA maker, lane 1: Lactobacillus casei suspension (10 -1 OD), Lane 2: Lactobacillus casei suspension (10 -2 OD), Lane 3: Lactobacillus casei suspension (10 -3 OD), Lane 4: Lactobacillus casei suspension (10 -4 OD), Lane 5: Lactobacillus casei suspension + fermented milk sample (10 -1 OD), Lane 6: Lactobacillus casei suspension + fermented milk sample (10 -2 OD), Lane 7: Lactobacillus casei suspension + fermented milk sample (10 -3 OD), Lane 8: Lactobacillus casei suspension + fermented milk sample (10 -4 OD), Lane 9: Fermented milk sample. The results showed that no amplification was detected in the original fermented milk sample. After adding different concentration gradients of Lactobacillus casei, it was found that the lowest dilution of Lactobacillus casei was 10 -4 OD can detect amplification, indicating that the detection limit of Lactobacillus casei in fermented milk samples must reach 10 -4 OD and above. This indicates that the primers designed by the present invention have high sensitivity.

[0079] Example 6

[0080] This example provides a method for identifying whether a sample contains Lactobacillus casei.

[0081] Take an appropriate amount of feces or fermented milk sample and add 10 times the volume of PBS buffer. After sufficient shaking and mixing, take 1 mL and add it to 50 mL MRS medium for enrichment overnight culture for 16 hours. Take 1 mL of bacterial solution, centrifuge and remove the supernatant, and add 1 mL ddH 2 The bacterial suspension was resuspended in 0.0% PBS and PCR amplification was performed on the bacterial suspension (the primers were designed in Example 2).

[0082] The following steps are involved:

[0083] 1) Centrifuge 1 mL of the bacterial sample to be tested that has been cultured to the logarithmic growth phase at 10,000 rpm for 1 min to precipitate the bacteria;

[0084] 2) Remove the supernatant medium and add 1 mL of ddH 2 O resuspend the bacteria;

[0085] 3) Take the resuspended bacterial suspension as a template and prepare the PCR reaction system. A 50 μL reaction system includes: 5 μL template (bacterial suspension), commercial 2× PCR premix (including DNA polymerase, dNTPs, MgCl 2 , PCR reaction buffer (including other components) 25 μL, 10 μM forward and reverse primers (Lca-F1, Lca-R1) 2 μL each, ddHO 2 O 16 μL.

[0086] 4) Perform PCR amplification reaction, the reaction procedure is: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 45 s, 35 cycles; 72°C final extension for 8 min;

[0087] 5) The PCR products were detected by gel electrophoresis and analyzed by gel imaging.

[0088] The results are as follows Figure 6 As shown, M: DL2000 DNA maker, lane 1: Lactobacillus casei control strain, lanes 2-24: bacterial suspension after enrichment and culture of collected feces samples, lanes 25-48: bacterial suspension after enrichment and culture of collected fermented milk samples, amplification bands were detected in 1 feces sample enrichment culture solution and 1 fermented milk sample enrichment culture solution, and the size was consistent with the expected fragment size, indicating that the sample contained Lactobacillus casei. The enrichment solution containing Lactobacillus casei was detected and strains were separated and identified according to the method in Example 1. After comparing the sequence amplified by 16s primers in the NCBI database, it was found that the isolated strain had the highest sequence homology with Lactobacillus casei, thereby verifying that the primers designed by the present invention can specifically detect Lactobacillus casei.

[0089] In summary, the present invention designs primers for specifically detecting Lactobacillus casei, can amplify Lactobacillus casei sequences with high sensitivity and specificity, further develops a method for specifically identifying Lactobacillus casei in a non-nucleic acid extraction manner, simplifies the experimental steps, does not require the extraction of nucleic acids, reduces the reaction time and cost, and is easy for experimenters to master. The method can be used to quickly identify whether foods and probiotic preparations contain Lactobacillus casei, thereby preventing some strains with excellent characteristics from being misappropriated; in addition, complex mixed bacterial bodies in collected samples can also be preliminarily identified, providing a basis for further separating and screening Lactobacillus casei from samples.

[0090] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A specific recognition primer for Lactobacillus casei, characterized in that, The primers include a forward primer and a reverse primer. The nucleic acid sequence of the forward primer includes the sequence shown in SEQ ID NO.1 or a sequence with a homology of not less than 90% thereto. The nucleic acid sequence of the reverse primer includes the sequence shown in SEQ ID NO.2 or a sequence with a homology of not less than 90% thereto.

2. the application of the specific recognition primer of Lactobacillus casei described in claim 1 in the product of preparing detection of Lactobacillus casei.

3. A kit for detecting Lactobacillus casei, characterized in that, The kit comprises the specific recognition primer of Lactobacillus casei according to claim 1.

4. the test kit for detecting Lactobacillus casei according to claim 3, is characterized in that, The kit also includes PCR amplification reagents.

5. the test kit for detecting Lactobacillus casei according to claim 4, is characterized in that, The PCR amplification reagent includes DNA polymerase, dNTPs, Mg 2+ Or at least one of the PCR reaction buffers.

6. the application of the specific recognition primer of Lactobacillus casei described in claim 1 in detecting Lactobacillus casei.

7. A method for identifying Lactobacillus casei in a sample, characterized in that: The method comprises: Take a sample to be tested, collect bacteria in the sample, use the bacteria or the genomic DNA of the bacteria as a template, prepare a PCR amplification system with the specific recognition primers of Lactobacillus casei according to claim 1, perform PCR amplification, and determine whether the sample to be tested contains Lactobacillus casei according to the amplification result.

8. The method for specific identification of Lactobacillus casei in a sample according to claim 7, wherein: After the PCR amplification, the method further comprises the step of performing agarose gel electrophoresis on the PCR product.

9. The method for specific identification of Lactobacillus casei in a sample according to the non-nucleic acid extraction method of claim 7 or 8, characterized in that: The reaction procedure of the PCR amplification includes: Pre-denaturation at 94-95°C for 3-10 min; 94-95°C denaturation for 15-30s, 54-58°C annealing for 15-30s, 70-73°C extension for 20-45s, 30-35 cycles; Final extension at 70-73°C for 5-8 min.

10. The method for specific identification of Lactobacillus casei in a sample by non-nucleic acid extraction according to claim 7, characterized in that: The size of the product amplified by PCR is 1142 bp. If a product fragment of the expected size is obtained, it indicates that the sample to be tested contains Lactobacillus casei, otherwise it does not contain Lactobacillus casei.

Images