Primer sequence for identifying heterotrophic nitrification-aerobic denitrification functional gene haoA and PCR (Polymerase Chain Reaction) identification method thereof

Abstract

The invention discloses a primer sequence for identifying a heterotrophic nitrification-aerobic denitrification functional gene haoA and a PCR (Polymerase Chain Reaction) identification method thereof, belonging to the field of molecular biology. The invention provides a gene sequence of a heterotrophic nitrification-aerobic denitrification functional gene haoA and a primer sequence capable of identifying the heterotrophic nitrification-aerobic denitrification functional gene haoA, the primer is used for carrying out PCR (Polymerase Chain Reaction) identification work, and the heterotrophic nitrification-aerobic denitrification functional gene haoA can be amplified; therefore, whether the strain has the heterotrophic nitrification-aerobic denitrification function or not can be identified.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and specifically relates to a primer sequence for identifying a functional gene haoA of heterotrophic nitrification-aerobic denitrification and a PCR identification method thereof. Background Art

[0002] To date, researchers have isolated and identified more than 100 heterotrophic nitrification-aerobic denitrification strains. Researchers usually use methods such as substrate degradation tests, nitrogen balance tests, enzyme activity assays, and polymerase chain reaction (PCR) amplification of functional genes to infer the denitrification pathway of strains. However, these methods may lead to inaccurate inferences about the heterotrophic nitrification-aerobic denitrification pathway. The inference of the heterotrophic nitrification-aerobic denitrification pathway based on substrate degradation experiments compares the degradation of ammonia (nitrite, nitrate, and mixtures thereof) in the presence and absence of organic matter under aerobic conditions. If the degradation of ammonia (nitrite and / or nitrate) depends on organic matter, the nitrogen removal pathway is considered to be heterotrophic nitrification. However, this method has the potential to misidentify simultaneous nitrification and denitrification bacteria as heterotrophic nitrification-aerobic denitrification bacteria. Nitrogen balance experiments only indicate that nitrogen loss has occurred in the system, but cannot distinguish which denitrification pathway is responsible. In functional gene amplification experiments, researchers rely on the amplification of functional genes of classic nitrifying bacteria (amoA and hao) and denitrifying bacteria (napA / narG and nirS / nirK) to speculate on the heterotrophic nitrification-aerobic denitrification process of the strain. If the strain has both nitrification and denitrification classic genes, it is identified as a heterotrophic nitrification-aerobic denitrification strain. However, genomic studies have shown that most strains with heterotrophic nitrification-aerobic denitrification phenotypes lack functional genes involved in traditional denitrification. Therefore, the biochemical decoding of heterotrophic nitrification-aerobic denitrification is particularly important.

[0003] Previous studies have shown that the common nitrogen metabolism pathway of heterotrophic nitrification-aerobic denitrification bacteria includes the conversion of ammonia to hydroxylamine, which is then oxidized to nitrite, nitric oxide, nitrous oxide, and nitrogen gas. Compared with the process of ammonia conversion to hydroxylamine, the process of hydroxylamine conversion to nitrite has received little attention. Hydroxylamine oxidase catalyzes the conversion of hydroxylamine to nitrite and is a key step in the heterotrophic nitrification-aerobic denitrification pathway. To date, only four hao gene sequences have been included in the database of the National Center for Biotechnology Information (NCBI). Considering the large number of unknown gene clusters found in existing genome studies, researchers speculate that this process may be the starting point for the discovery of potential characteristic genes of heterotrophic nitrification-aerobic denitrification bacteria.

[0004] The present invention starts from the genome and transcriptome data of a pure heterotrophic nitrification-aerobic denitrification strain, and obtains a gene haoA responsible for encoding hydroxylamine to nitrite by performing primer design, gene cloning technology, protein expression and protein function verification on unknown genes in the heterotrophic nitrification process. According to this gene, the primer sequence of the gene haoA for identifying heterotrophic nitrification-aerobic denitrification is determined. At the same time, PCR amplification is performed using the primers to amplify the functional gene haoA of heterotrophic nitrification-aerobic denitrification, so as to identify whether the strain has the function of heterotrophic nitrification-aerobic denitrification. Summary of the invention

[0005] The present invention provides a gene sequence of a functional gene haoA of heterotrophic nitrification-aerobic denitrification, and a primer sequence for identifying the functional gene haoA of heterotrophic nitrification-aerobic denitrification.

[0006] >haoA gene sequence

[0007] ATGTCCCTACGTCCCACCCTCGCCCTGCTCGCCCTCGTCAGCCTGCCGCTGATGGCCGCCCAGAACGACCCTCAGCCCAGCAGCAAGGAACTGATGAAGGAGCACCAGGCGCAGATCCAGAACGACCTGGCCGACGTCGACTACAAGCGCAAGCGCATCGTCGAGGCCAACATGAACCTCACCGACCAGGAAGGCGAGAAGTTCTGGCCGATCTACAACACCTACCGCACCGAGTCGGACAAGCTCAGCAAG GAAACCCTCAAGCTCCTGCTCGACTACGCCCAGGCCTACAACAGCGGCAACGTCAGCGACGACCAGGCGAGCAAGCTGATCGAGCGTGTCGACGACCTCCAGGAGGACCGTCTGGAACTGCGCGAC AAGTACGTCAAGCGCATCGCCAAGAACGTCTCGCCCAAGCGCGCCATGCGCTTCCTGCAGATCGAGATCCAGCTCGACGCCATCGCCACCTGGAGATCGGCCGTCAGGTACCGCTGGTCGAGTAA

[0008] The primer sequences are: upstream primer haoA-F: CGCGGATCCATGTCCCTACGTCCCACCC, downstream primer haoA-R: CCCAAGCTTCTCGACCAGCGGTACCTGA (5'-3'). The use of the primers in PCR identification can amplify the heterotrophic nitrification-aerobic denitrification functional gene haoA, thereby identifying whether the strain has the heterotrophic nitrification-aerobic denitrification function.

[0009] The inventive principle of the present invention is described below. The experimental methods used in the following description are all conventional methods unless otherwise specified; the materials, reagents, etc. used can be obtained through commercial channels unless otherwise specified.

[0010] Through the results of the genome and transcriptome of the pure heterotrophic nitrification-aerobic denitrification strain Pseudomonas aeruginosa SNDPR-01, it was concluded that the strain had several genes that were significantly expressed but whose specific functions were unknown during the heterotrophic nitrification process. We designed primers, cloned genes, expressed proteins, and verified protein functions for these unknown genes, thereby obtaining a primer sequence for identifying the heterotrophic nitrification-aerobic denitrification functional gene haoA. At the same time, PCR amplification was performed using this primer. According to the appearance of a band at the 504bp position after gel electrophoresis, it can be judged that it has the heterotrophic nitrification-aerobic denitrification functional gene haoA.

[0011] (1) Primer design method

[0012] The restriction endonucleases in the restriction endonuclease library built into the primer design software snapgene 4.3.6 were used to analyze the restriction spectrum of the gene sequence of unknown function, and the restriction sites of each sequence and the names of the enzymes that can be cut by the restriction endonucleases were obtained, and the enzymes that cannot cut the sequence were obtained. When designing primers, the restriction sites (BamH I and Hind III) that cannot be cut by the sequence were inserted at both ends of the sequence, and the protective bases corresponding to the restriction endonucleases were added to both ends of the primers.

[0013] (2) Gene cloning process

[0014] First, PCR amplification of the target gene: PCR amplification reaction uses 20 μL amplification system, including 0.4 μL upstream primer, 0.4 μL downstream primer, 10 μL 2×EasyTaq PCR SuperMix (TaKaRaRR300A), 8.2 μL sterile water and 1.0 μL DNA solution. The prepared amplification system is placed in a gradient PCR instrument, and the amplification conditions are set as follows: 94°C preheating for 2 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 2 min, denaturation, annealing, extension stage repeated 35 cycles, and final extension at 72°C for 7 min. After obtaining the PCR amplification product, use a pipette to draw 18 microliters (μL) and inject it into the agarose gel hole (agarose gel preparation method: weigh 1.2g agarose and dissolve it in 120ml TAE buffer, heat it in a microwave oven until it is completely dissolved, then cool the dissolved agarose solution to 40-60°C, pour the solution into the gel mold, insert the comb, wait for it to solidify, pull out the comb after solidification, put the gel mold into the electrophoresis tank of the electrophoresis instrument, add TAE buffer to the tank until it covers the agarose gel hole), and draw 5 microliters (μL) of DNA marker (TaKaRa3428A) and inject it in the same way as a blank control group. Set the electrophoresis instrument parameters to 120V, take out the gel after 25 minutes, and observe it under a UV excitation lamp (wavelength 302nm, UV lamp power 8W).

[0015] Next, the target gene after PCR amplification was cut and recovered from the gel. After the DNA fragment was run on agarose gel electrophoresis, the target band was cut out under ultraviolet observation, and the gel recovery kit (TaKaRa9762) was used to recover the cut gel product.

[0016] Next, the target gene and plasmid were double-digested with a fast-cutting enzyme, and the digestion products were subjected to electrophoresis. After electrophoresis, the digestion products were recovered from the gel (TaKaRa9762). The target gene and plasmid were double-digested and connected (TaKaRa6023), and the digested target gene and the digested plasmid were connected. After connection, the transformation test of E. coli was performed. The connection product was transformed into E. coli DH5α, and after the clones grew out, the clones were selected for sequencing verification, and the recombinant plasmid with the correct sequencing results was selected.

[0017] (3) Protein expression steps

[0018] The recombinant plasmid with the correct sequencing results was transformed into protein-deficient Escherichia coli BL21 (DE3), and protein induction was first performed. The induced protein was subjected to protein electrophoresis experiment. First, the separation gel (prepared according to the method in the kit MF422-plus-01) was prepared and poured into the gel plate. After standing and solidifying for 30 minutes, the water was absorbed with filter paper. Then, the concentrated gel (prepared according to the method in the kit MF422-plus-01) was prepared and poured into the gel plate to the highest point, and the comb was inserted vertically to form a solidified state. Then, the protein electrophoresis tank was assembled and the protein electrophoresis buffer (10×Tris-glycine-SDS electrophoresis buffer) was added, and the comb was pulled out vertically upward. Next, add the prepared sample to each comb hole (the sample for protein electrophoresis has been pre-treated: boil 8 microliters (μL) of sample + 2 microliters (μL) of M5 non-reducing 5× protein loading buffer at 100°C for 10 minutes and store in an ice bath). First, electrophoresis is performed at 80V for 30 minutes. When the sample passes through the concentrated gel, switch to 120V electrophoresis for about 2 hours. Wait until the sample reaches the bottom of the gel to complete. Finally, take out the gel plate, cut off the comb teeth, put the gel into the staining box and stain it in a shaker (80rpm, 30°C, stain: MF768-01). When the bands on the gel are clearly visible, take out the gel and take pictures to record the results of the protein gel run. The appearance of a band at the expected position (15kD-25kD) indicates that the protein is successfully expressed. The protein electrophoresis diagram is as follows: Figure 2 .

[0019] (4) Steps for protein function verification

[0020] After the protein-expressing recombinant strain was induced (final concentration of inducer isopropyl-β-D-thiogalactoside: 1mM, induction temperature: 28℃, induction time: 16h), the bacteria were added to the culture medium with only ammonia nitrogen (concentration: 20mg / L), hydroxylamine (concentration: 5mg / L), nitrite (concentration: 20mg / L), and nitrate (concentration: 20mg / L) as nitrogen sources, and the temperature, pH and speed (temperature 25℃, pH=7.5, shaker speed: 200rpm) were kept consistent. At the same time, the amount of ammonia nitrogen, hydroxylamine, nitrite and nitrate in the system at different time periods was detected, and the empty plasmid was used as a control. It was found that the strain after induced expression did not play a role in the culture medium with only ammonia nitrogen, nitrite and nitrate nitrogen (the concentrations of ammonia nitrogen, nitrite and nitrate nitrogen in these three culture media did not change after 6h). Only in the culture medium with only hydroxylamine, the concentration of hydroxylamine was found to decrease, and nitrite was generated, and then nitrate nitrogen was generated quickly. Therefore, the protein encoded by this gene plays a role in the process of hydroxylamine to nitrosamine after transformation into E. coli, and the gene was named haoA. The results of protein function verification are shown in Figure 3 .

[0021] (5) Steps to determine the specificity, universality and stability of haoA gene primers

[0022] The first is to determine the specificity. The gel-cut products after PCR amplification using primers are sequenced and compared with the original gene sequence. If the two are completely matched, it means that the gene primers are specific. The next step is to verify the universality. The remaining pure heterotrophic nitrification-aerobic denitrification bacteria are PCR amplified using the primer haoA. The universality of the primers is determined by the appearance of a band at the 504bp position after gel electrophoresis. The next step is to verify the stability of the primers. The heterotrophic nitrification-aerobic denitrification bacteria are added to the activated sludge, and the mixed system is PCR amplified using the primer haoA. Similarly, the appearance of a band at the 504bp position after gel electrophoresis indicates that the primer is stable.

[0023] Through the above steps, primers for identifying the functional gene haoA of heterotrophic nitrification-aerobic denitrification were obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The gene tree of haoA gene

[0025] Figure 2 The protein electrophoresis results of the protein encoded by the haoA gene (Marker is the protein molecular weight standard, lane 1 represents the supernatant, lane 2 represents the precipitate, and lane 3 represents the whole cell fluid)

[0026] Figure 3 Functional verification results of the protein encoded by the haoA gene

[0027] Figure 4 The amplification results of haoA in pure bacteria and in a mixed system of pure bacteria added to activated sludge

[0028] Among them, (1) is the amplification result of Exiguobacterium mexicanum SND-01: Marker is the DNA molecular weight standard, the first line represents the amplification result in pure bacteria, the second line represents the amplification result in activated sludge, and the third line represents the amplification result of pure bacteria + activated sludge: (2) is the amplification result of Halomonas venusta SND-01: the first line represents the amplification result in pure bacteria, the second line represents the amplification result in activated sludge, and the third line represents the amplification result of pure bacteria + activated sludge. DETAILED DESCRIPTION

[0029] The following are the primers of heterotrophic nitrification-aerobic denitrification functional gene hao and the specific implementation method of PCR amplification.

[0030] (1) haoA gene sequence:

[0031] ATGTCCCTACGTCCCACCCTCGCCCTGCTCGCCCTCGTCAGCCTGCCGCTGATGGCCGCCCAGAACGACCCTCAGCCCAGCAGCAAGGAACTGATGAAGGAGCACCAGGCGCAGATCCAGAACGACCTGGCCGACGTCGACTACAAGCGCAAGCGCATCGTCGAGGCCAACATGAACCTCACCGACCAGGAAGGCGAGAAGTTCTGGCCGATCTACAACACCTACCGCACCGAGTCGGACAAGCTCAGCAAG GAAACCCTCAAGCTCCTGCTCGACTACGCCCAGGCCTACAACAGCGGCAACGTCAGCGACGACCAGGCGAGCAAGCTGATCGAGCGTGTCGACGACCTCCAGGAGGACCGTCTGGAACTGCGCGAC AAGTACGTCAAGCGCATCGCCAAGAACGTCTCGCCCAAGCGCGCCATGCGCTTCCTGCAGATCGAGATCCAGCTCGACGCCATCGCCACCTGGAGATCGGCCGTCAGGTACCGCTGGTCGAGTAA

[0032] (2) Primer information:

[0033] Upstream primer haoA-F:CGCGGATCCATGTCCCTACGTCCCACCC,

[0034] Downstream primer haoA-R:CCCAAGCTTCTCGACCAGCGGTACCTGA (5'-3').

[0035] (3) PCR reaction system: A 20 μL amplification system was used, including 0.4 μL upper primer, 0.4 μL lower primer, 10 μL 2×EasyTaq PCR SuperMix, 8.2 μL sterile water and 1.0 μL DNA template.

[0036] (4) The PCR reaction process was as follows: preheating at 94°C for 2 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 2 min. The denaturation, annealing, and extension stages were repeated for 35 cycles, followed by a final extension at 72°C for 7 min and storage at 4°C.

[0037] (5) Gel electrophoresis and observation: After PCR amplification, take 18 μL of PCR amplification product and load it on agarose gel. Load DL5000 marker (DNA molecular weight standard) on the far left, 120V voltage, electrophoresis for 25 minutes, turn off the power, and then observe under ultraviolet excitation light. According to the electrophoresis results, compared with the DNA molecular weight standard marker, a band appears at the 504bp position, which can be judged that it has the functional gene haoA of heterotrophic nitrification-aerobic denitrification.

[0038] The above content is only a preferred specific embodiment presented in this application, however, the protection scope of this application is not limited thereto. Any changes or alternatives that can be easily conceived by any technician with relevant knowledge in this technical field based on the technical framework disclosed in this application should be deemed to fall within the protection scope of this application.

[0039] Example 1

[0040] Application of primer sequences of gene haoA in pure strains of heterotrophic nitrification-aerobic denitrification.

[0041] The strains Exiguobacterium mexicanum SND-01 (patent publication date: August 11, 2023, publication number: CN113186114A) and Halomonas venusta SND-01 (patent publication date: March 22, 2024, publication number: CN115181694A) are pure heterotrophic nitrification-aerobic denitrification strains. The gene primers of the present invention are used and the amplification conditions are adopted: 94°C preheating for 2min, 95°C denaturation for 30s, 55°C annealing for 30s, 72°C extension for 2min, denaturation, annealing, and extension stages are repeated for 35 cycles, and then the final extension is performed at 72°C for 7min. A band appears at 504bp, and this gene is successfully amplified. The electrophoresis gel image after PCR amplification is as follows Figure 4 .

[0042] Example 2

[0043] Application of primers of gene haoA in adding pure heterotrophic nitrification-aerobic denitrification bacteria to the activated sludge mixed system.

[0044] The pure heterotrophic nitrification-aerobic denitrification strains Exiguobacterium mexicanum SND-01 (patent publication date: August 11, 2023, publication number: CN113186114A) and Halomonas venusta SND-01 (patent publication date: March 22, 2024, publication number: CN115181694A) were respectively added to a common activated sludge system (the original activated sludge ammonia nitrogen removal rate reached 90%, and it had good denitrification performance), and the gene primers of the present invention were applied. The amplification conditions were: preheating at 94°C for 2min, denaturation at 95°C for 30s, annealing at 55°C for 30s, and extension at 72°C for 2min. After 35 cycles of denaturation, annealing, and extension, the final extension was performed at 72°C for 7min. A band appeared at 504bp, and this gene was successfully amplified. The electrophoresis gel image after PCR amplification is as shown in the figure below. Figure 4 .

Claims

1. A gene sequence of a functional gene haoA for heterotrophic nitrification-aerobic denitrification, characterized in that: The gene sequence is as follows: ATGTCCCTACGTCCCACCCTCGCCCTGCTCGCCCTCGTCAGCCTGCCGCTGATGGCCGCCCAGAACGACCCTCAGCCCAGCAGCAAGGAACTGATGAAGGAGCACCAGGCGCAGATCCAGAACGACCTGGCCGACGTCGACTACAAGCGCAAGCGCATCGTCGAGGCCAACATGAACCTCACCGACCAGGAAGGCGAGAAGTTCTGGCCGATCTACAACACCTACCGCACCGAGTCGGACAAGCTCAGCAAG GAAACCCTCAAGCTCCTGCTCGACTACGCCCAGGCCTACAACAGCGGCAACGTCAGCGACGACCAGGCGAGCAAGCTGATCGAGCGTGTCGACGACCTCCAGGAGGACCGTCTGGAACTGCGCGAC AAGTACGTCAAGCGCATCGCCAAGAACGTCTCGCCCAAGCGCGCCATGCGCTTCCTGCAGATCGAGATCCAGCTCGACGCCATCGCCACCCTGGAGATCGGCCGTCAGGTACCGCTGGTCGAGTAA.

2. A primer sequence for preparing the gene sequence as claimed in claim 1, characterized in that: Upstream primer haoA-F: CGCGGATCCATGTCCCTACGTCCCACCC, downstream primer haoA-R: CCCAAGCTTCTCGACCAGCGGTACCTGA (5'-3').

3. A method for identifying the functional gene haoA of heterotrophic nitrification-aerobic denitrification by PCR amplification using the primer sequence as claimed in claim 2, characterized in that: After gel electrophoresis, a band appeared at the 504bp position, thus judging that it had the functional gene sequence haoA for heterotrophic nitrification-aerobic denitrification.

Images