Primer sequence for identifying heterotrophic nitrification-aerobic denitrification functional gene haoB and PCR (Polymerase Chain Reaction) identification method thereof

Abstract

The invention discloses a primer sequence for identifying a heterotrophic nitrification-aerobic denitrification functional gene haoB and a PCR (Polymerase Chain Reaction) identification method thereof, belonging to the field of molecular biology. The invention provides a gene sequence of a heterotrophic nitrification-aerobic denitrification functional gene haoB and a primer sequence capable of identifying the heterotrophic nitrification-aerobic denitrification functional gene haoB, the primer is used for carrying out PCR (Polymerase Chain Reaction) identification work, and the heterotrophic nitrification-aerobic denitrification functional gene haoB can be amplified; therefore, whether the strain has the heterotrophic nitrification-aerobic denitrification function or not can be identified.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and specifically relates to a primer sequence for identifying a functional gene haoB of heterotrophic nitrification-aerobic denitrification and a PCR identification method thereof. Background Art

[0002] Since researchers first discovered the heterotrophic nitrification-aerobic denitrification process in the 1980s, this biological denitrification pathway has attracted widespread attention. Heterotrophic nitrification-aerobic denitrification bacteria can use organic carbon to oxidize ammonia nitrogen to hydroxylamine under aerobic conditions, which is then further oxidized to nitrate and finally converted into nitrogen gas through denitrification. To date, more than 100 strains of heterotrophic nitrification-aerobic denitrification bacteria have been isolated and identified. Researchers usually use methods such as substrate degradation tests, nitrogen balance tests, enzyme activity assays, and polymerase chain reaction (PCR) amplification of functional genes to infer the denitrification pathway of the strain. However, these methods may lead to inaccurate inferences about the heterotrophic nitrification-aerobic denitrification pathway.

[0003] The inference method based on substrate degradation experiments is to judge the denitrification pathway by comparing the degradation of ammonia (nitrite, nitrate and their mixtures) in the presence and absence of organic matter. If the degradation of ammonia (nitrite and / or nitrate) depends on organic matter, the process is considered to be heterotrophic nitrification. However, this method may misjudge simultaneous nitrification and denitrification bacteria as heterotrophic nitrification-aerobic denitrification bacteria. Although nitrogen balance experiments can indicate that nitrogen loss has occurred in the system, they cannot distinguish specific denitrification pathways. In functional gene amplification experiments, researchers usually rely on functional gene amplification of classical nitrifying bacteria (such as amoA and hao genes) and denitrifying bacteria (such as napA / narG and nirS / nirK genes) to infer the heterotrophic nitrification-aerobic denitrification ability of strains. If a strain has both classical genes for nitrification and denitrification, it is identified as a heterotrophic nitrification-aerobic denitrification strain. However, genomic studies have shown that many strains with heterotrophic nitrification-aerobic denitrification phenotypes lack functional genes for traditional denitrification pathways. Therefore, it is particularly important to conduct an in-depth analysis of the biochemical mechanism of heterotrophic nitrification-aerobic denitrification.

[0004] Previous studies have shown that the nitrogen metabolism pathway of heterotrophic nitrification-aerobic denitrification bacteria usually includes the conversion of ammonia to hydroxylamine, which is then oxidized to nitrite, nitric oxide, nitrous oxide, and nitrogen gas. Compared with the process of ammonia conversion to hydroxylamine, the process of hydroxylamine conversion to nitrite has been less studied. Hydroxylamine oxidase is a key enzyme that catalyzes the conversion of hydroxylamine to nitrite and is also a core step in the heterotrophic nitrification-aerobic denitrification pathway. However, to date, only four hao gene sequences have been included in the National Center for Biotechnology Information (NCBI) database. Given the large number of unknown gene clusters found in existing genome studies, researchers speculate that the hydroxylamine oxidation process may be an important entry point for discovering characteristic genes of heterotrophic nitrification-aerobic denitrification bacteria.

[0005] The present invention starts from the genome and transcriptome data of a pure heterotrophic nitrification-aerobic denitrification strain, and obtains a gene haoB responsible for encoding hydroxylamine to nitrite by performing primer design, gene cloning technology, protein expression and protein function verification on unknown genes in the heterotrophic nitrification process. According to this gene, the primer sequence of the gene haoB for identifying the heterotrophic nitrification-aerobic denitrification is determined. At the same time, PCR amplification is performed using the primers to amplify the functional gene haoB of the heterotrophic nitrification-aerobic denitrification, so as to identify whether the strain has the heterotrophic nitrification-aerobic denitrification function. Summary of the invention

[0006] The invention provides a gene sequence of a functional gene haoB of heterotrophic nitrification-aerobic denitrification.

[0007] >haoB

[0008] ATGATTCGTGAAGTTGAAGGTGACATTCTGCTTTCCGGGGCCCAGGTGATCGCCCACGGCATCGCGCCCCAGGACCATTTCGACAGCGGCCTGGCCCTCGCCTTGCGCGAACGCTGGCCGTCGATGG TTCGCGACTACCGGCATGCCGCCCATGCCAGGGCGCCCGAGCCGGGCGGCATCTGGGTCTGGGCCGGGGTCGACGAGCAGGGCAAGACCCAGTGCATCGTCAACCTGATCACCCAGGGCATGCTGCA CAGCGGTCGCAGCGCCAAGCCGGGCAAGGCGAGCCTGGAGGATGTCGGCCATGCCCTGCGCGAGCTGGCCCGCTATGTGCGCAGCGAAGGGGTGAGCAGCCTGGCTCTGCCCTGCGTGGCGACGGGA GTGGGCGGGCTGGACTGGTCCGAGGTCAAGCCGCTGGTGGTTCGCCACCTGGGCGACCTGGAGATCCCGGTGATTCTCTACGAGGTCTATCGCAAGGGCGTGGCGGCCGAGGAAAAGCTGGCCTGA.

[0009] The primer sequence for identifying the functional gene haoB of heterotrophic nitrification-aerobic denitrification is as follows: upstream primer haoB-F: CGCGGATCCATGATTCGTGAAGTTGAAGGTGAC, downstream primer haoB-R: CCCAAGCTTGGCCAGCTTTTCCTCGG (5'-3'). The PCR identification work can be carried out using the primers to amplify the functional gene haoB of heterotrophic nitrification-aerobic denitrification, thereby identifying whether the strain has the function of heterotrophic nitrification-aerobic denitrification.

[0010] The inventive principle of the present invention is described below. The experimental methods used in the following description are all conventional methods unless otherwise specified; the materials, reagents, etc. used can be obtained through commercial channels unless otherwise specified.

[0011] Through the results of the genome and transcriptome of the pure heterotrophic nitrification-aerobic denitrification strain Pseudomonas aeruginosa SNDPR-01, it was concluded that the strain had several genes that were significantly expressed but whose specific functions were unknown during the heterotrophic nitrification process. We designed primers, cloned genes, expressed proteins, and verified protein functions for these unknown genes, thereby obtaining a primer sequence for identifying the heterotrophic nitrification-aerobic denitrification functional gene haoB. At the same time, PCR amplification was performed using this primer. According to the appearance of a band at the 507bp position after gel electrophoresis, it can be judged that it has the heterotrophic nitrification-aerobic denitrification functional gene haoB.

[0012] (1) Primer design method

[0013] The restriction endonucleases in the restriction endonuclease library built into the primer design software snapgene 4.3.6 were used to analyze the restriction spectrum of the gene sequence of unknown function, and the restriction sites of each sequence and the names of the enzymes that can be cut by the restriction endonucleases were obtained, and the enzymes that cannot cut the sequence were obtained. When designing primers, the restriction sites (BamH I and Hind III) that cannot be cut by the sequence were inserted at both ends of the sequence, and the protective bases corresponding to the restriction endonucleases were added to both ends of the primers.

[0014] (2) Gene cloning process

[0015] First, PCR amplification of the target gene: PCR amplification reaction uses 20 μL amplification system, including 0.4 μL upstream primer, 0.4 μL downstream primer, 10 μL 2×EasyTaq PCR SuperMix (TaKaRaRR300A), 8.2 μL sterile water and 1.0 μL DNA solution. The prepared amplification system is placed in a gradient PCR instrument, and the amplification conditions are set as follows: 94°C preheating for 2 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 2 min, denaturation, annealing, extension stage repeated 35 cycles, and final extension at 72°C for 7 min. After obtaining the PCR amplification product, use a pipette to draw 18 microliters (μL) and inject it into the agarose gel hole (agarose gel preparation method: weigh 1.2g agarose and dissolve it in 120ml TAE buffer, heat it in a microwave oven until it is completely dissolved, then cool the dissolved agarose solution to 40-60°C, pour the solution into the gel mold, insert the comb, wait for it to solidify, pull out the comb after solidification, put the gel mold into the electrophoresis tank of the electrophoresis instrument, add TAE buffer to the tank until it covers the agarose gel hole), and draw 5 microliters (μL) of DNA marker (TaKaRa3428A) and inject it in the same way as a blank control group. Set the electrophoresis instrument parameters to 120V, take out the gel after 25 minutes, and observe it under a UV excitation lamp (wavelength 302nm, UV lamp power 8W).

[0016] Next, the target gene after PCR amplification was cut and recovered from the gel. After the DNA fragment was run on agarose gel electrophoresis, the target band was cut out under ultraviolet observation, and the gel recovery kit (TaKaRa9762) was used to recover the cut gel product.

[0017] Next, the target gene and plasmid were double-digested with a fast-cutting enzyme, and the digestion products were subjected to electrophoresis. After electrophoresis, the digestion products were recovered from the gel (TaKaRa9762). The target gene and plasmid were double-digested and connected (TaKaRa6023), and the digested target gene and the digested plasmid were connected. After connection, the transformation test of E. coli was performed. The connection product was transformed into E. coli DH5α, and after the clones grew out, the clones were selected for sequencing verification, and the recombinant plasmid with the correct sequencing results was selected.

[0018] (3) Protein expression steps

[0019] The recombinant plasmid with the correct sequencing results was transformed into protein-deficient Escherichia coli BL21 (DE3), and protein induction was first performed. The induced protein was subjected to protein electrophoresis experiment. First, the separation gel (prepared according to the method in the kit MF422-plus-01) was prepared and poured into the gel plate. After standing and solidifying for 30 minutes, the water was absorbed with filter paper. Then, the concentrated gel (prepared according to the method in the kit MF422-plus-01) was prepared and poured into the gel plate to the highest point, and the comb was inserted vertically to form a solidified state. Then, the protein electrophoresis tank was assembled and the protein electrophoresis buffer (10×Tris-glycine-SDS electrophoresis buffer) was added, and the comb was pulled out vertically upward. The next step is to add the prepared sample to each comb hole (the sample for protein electrophoresis has been pre-treated: boil 8 microliters (μL) of sample + 2 microliters (μL) of M5 non-reducing 5× protein loading buffer at 100°C for 10 minutes and store in an ice bath). First, electrophoresis is performed at 80V for 30 minutes. When the sample passes through the concentrated gel, switch to 120V electrophoresis for about 2 hours. Wait until the sample reaches the bottom of the gel to complete. Finally, take out the gel plate, cut off the comb teeth, put the gel into the staining box and stain it in a shaker (80rpm, 30°C, stain: MF768-01). When the bands on the gel are clearly visible, take out the gel and take pictures to record the results of the protein gel run. The appearance of bands at the expected position (15kD-25kD) indicates that the protein has been successfully expressed. The protein electrophoresis diagram is as follows Figure 2 .

[0020] (4) Steps for protein function verification

[0021] After the protein-expressing recombinant strain was induced (final concentration of inducer isopropyl-β-D-thiogalactoside: 1 mM, induction temperature: 28°C, induction time: 16 h), the bacteria were added to the culture medium with only ammonia nitrogen (concentration: 20 mg / L), hydroxylamine (concentration: 5 mg / L), nitrite (concentration: 20 mg / L), and nitrate (concentration: 20 mg / L) as nitrogen sources, respectively. The temperature, pH and rotation speed (temperature 25°C, pH=7.5, shaker speed: 200 rpm) were kept consistent. At the same time, the amounts of ammonia nitrogen, hydroxylamine, nitrite and nitrate in the system at different time periods were detected, and an empty plasmid was used as a control. It was found that the strain after induced expression did not function in the culture medium containing only ammonia nitrogen, nitrite and nitrate nitrogen (the concentrations of ammonia nitrogen, nitrite and nitrate nitrogen in these three culture media did not change after 6 hours). Only in the culture medium containing only hydroxylamine, the concentration of hydroxylamine was found to decrease, nitrite was generated, and then nitrate nitrogen was quickly generated. Therefore, the protein encoded by this gene plays a role in the process of hydroxylamine to nitrite after transformation into Escherichia coli, and the gene was named haoB. The results of protein function verification are shown in Figure 1. Figure 3 .

[0022] (5) Steps to determine the specificity, universality and stability of haoB gene primers

[0023] The first is to determine the specificity. The gel-cut products after PCR amplification using primers are sequenced and compared with the original gene sequence. If the two are completely matched, it means that the gene primers are specific. The next step is to verify the universality. The remaining pure heterotrophic nitrification-aerobic denitrification bacteria are PCR amplified using haoB primers. The universality of the primers is determined by the appearance of a band at the 507bp position after gel electrophoresis. The next step is to verify the stability of the primers. The heterotrophic nitrification-aerobic denitrification bacteria are added to the activated sludge, and the mixed system is PCR amplified using haoB primers. Similarly, the appearance of a band at the 507bp position after gel electrophoresis indicates that the primers are stable.

[0024] Through the above steps, primers for identifying the functional gene haoB of heterotrophic nitrification-aerobic denitrification were obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the gene development tree of haoB gene.

[0026] Figure 2 The protein electrophoresis results of the protein encoded by the haoB gene are shown in Figure 1. Marker is the protein molecular weight standard. Lane 1 represents the supernatant, lane 2 represents the precipitate, and lane 3 represents the whole cell fluid.

[0027] Figure 3 This is the functional verification result of the protein encoded by haoB gene.

[0028] Figure 4 The PCR amplification results of haoB in pure bacteria and in the mixed system of pure bacteria added to activated sludge are shown in Figure 2.

[0029] Figure (1) shows the amplification results of Exiguobacterium mexicanum SND-01: Marker is a DNA molecular weight standard, the first line represents the amplification result in pure bacteria, the second line represents the amplification result in activated sludge, and the third line represents the amplification result of pure bacteria + activated sludge: (2) shows the amplification results of Halomonas venusta SND-01: the first line represents the amplification result in pure bacteria, the second line represents the amplification result in activated sludge, and the third line represents the amplification result of pure bacteria + activated sludge. DETAILED DESCRIPTION

[0030] The following are the primers of heterotrophic nitrification-aerobic denitrification functional gene hao and the specific implementation method of PCR amplification.

[0031] (1) haoB gene sequence:

[0032] ATGATTCGTGAAGTTGAAGGTGACATTCTGCTTTCCGGGGCCCAGGTGATCGCCCACGGCATCGCGCCCCAGGACCATTTCGACAGCGGCCTGGCCCTCGCCTTGCGCGAACGCTGGCCGTCGATG GTTCGCGACTACCGGCATGCCGCCCATGCCAGGGCGCCCGAGCCGGGCGGCATCTGGGTCTGGGCCGGGGTCGACGAGCAGGGCAAGACCCAGTGCATCGTCAACCTGATCACCCAGGGCATGCTGC ACAGCGGTCCAGCGCCAAGCCGGGCAAGGCGAGCCTGGAGGATGTCGGCCATGCCCTGCGCGAGCTGGCCCGCTATGTGCGCAGCGAAGGGGTGAGCAGCCTGGCTCTGCCCTGCGTGGCGACGGG AGTGGGCGGGCTGGACTGGTCCGAGGTCAAGCCGCTGGTGGTTCGCCACCTGGGCGACCTGGAGATCCCGGTGATTCTCTACGAGGTCTATCGCAAGGGCGTGGCGGCCGAGGAAAAGCTGGCCTGA

[0033] (2) Primer information:

[0034] Upstream primer haoB-F:CGCGGATCCATGATTCGTGAAGTTGAAGGTGAC,

[0035] Downstream primer haoB-R:CCCAAGCTTGGCCAGCTTTTCCTCGG (5'-3').

[0036] (3) PCR reaction system: A 20 μL amplification system was used, including 0.4 μL upstream primer, 0.4 μL downstream primer, 10 μL 2×EasyTaq PCR SuperMix, 8.2 μL sterile water and 1.0 μL DNA template.

[0037] (4) The PCR reaction process was as follows: preheating at 94°C for 2 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 2 min. The denaturation, annealing, and extension stages were repeated for 35 cycles, followed by a final extension at 72°C for 7 min and storage at 4°C.

[0038] (5) Gel electrophoresis and observation: After PCR amplification, take 18 μL of PCR amplification product and load it on agarose gel. Load DL5000 marker (DNA molecular weight standard) on the far left, 120V voltage, electrophoresis for 25 minutes, turn off the power, and then observe under ultraviolet excitation light. According to the electrophoresis results, compared with the DNA molecular weight standard marker, a band appears at the 507bp position, which can be judged that it has the functional gene haoB of heterotrophic nitrification-aerobic denitrification.

[0039] The above content is only a preferred specific embodiment presented in this application, however, the protection scope of this application is not limited thereto. Any changes or alternatives that can be easily conceived by any technician with relevant knowledge in this technical field based on the technical framework disclosed in this application should be deemed to fall within the protection scope of this application.

[0040] Example 1

[0041] Application of primer sequences of gene haoB in pure strains of heterotrophic nitrification-aerobic denitrification.

[0042] The strains Exiguobacterium mexicanum SND-01 (patent publication date: August 11, 2023, publication number: CN113186114A) and Halomonas venusta SND-01 (patent publication date: March 22, 2024, publication number: CN115181694A) were amplified using the gene primers of the present invention under the following amplification conditions: preheating at 94°C for 2 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 2 min, denaturation, annealing, and extension stages were repeated for 35 cycles, and then finally extended at 72°C for 7 min. A band appeared at 507 bp, and this gene was successfully amplified. The electrophoresis gel image after amplification is as shown in the figure below. Figure 4 .

[0043] Example 2

[0044] Application of primers of gene haoB in adding pure heterotrophic nitrification-aerobic denitrification bacteria to the activated sludge mixed system.

[0045] The pure heterotrophic nitrification-aerobic denitrification strains Exiguobacterium mexicanum SND-01 (patent publication date: August 11, 2023, publication number: CN113186114A) and Halomonas venusta SND-01 (patent publication date: March 22, 2024, publication number: CN115181694A) were respectively added to a common activated sludge system (the original activated sludge ammonia nitrogen removal rate reached 90%, and it had good denitrification performance), and the gene primers of the present invention were applied. The amplification conditions were: preheating at 94°C for 2min, denaturation at 95°C for 30s, annealing at 58°C for 30s, and extension at 72°C for 2min. After 35 cycles of denaturation, annealing, and extension, the final extension was performed at 72°C for 7min. A band appeared at 507bp, and this gene was successfully amplified. The electrophoresis gel image after amplification is as shown in the figure below. Figure 4 .

Claims

1. A gene sequence of a functional gene haoB for heterotrophic nitrification-aerobic denitrification, characterized in that: The gene sequence is as follows: ATGATTCGTGAAGTTGAAGGTGACATTCTGCTTTCCGGGGCCCAGGTGATCGCCCACGGCATCGCGCCCCAGGACCATTTCGACAGCGGCCTGGCCCTCGCCTTGCGCGAACGCTGGCCGTCGATGG TTCGCGACTACCGGCATGCCGCCCATGCCAGGGCGCCCGAGCCGGGCGGCATCTGGGTCTGGGCCGGGGTCGACGAGCAGGGCAAGACCCAGTGCATCGTCAACCTGATCACCCAGGGCATGCTGCA CAGCGGTCGCAGCGCCAAGCCGGGCAAGGCGAGCCTGGAGGATGTCGGCCATGCCCTGCGCGAGCTGGCCCGCTATGTGCGCAGCGAAGGGGTGAGCAGCCTGGCTCTGCCCTGCGTGGCGACGGGA GTGGGCGGGCTGGACTGGTCCGAGGTCAAGCCGCTGGTGGTTCGCCACCTGGGCGACCTGGAGATCCCGGTGATTCTCTACGAGGTCTATCGCAAGGGCGTGGCGGCCGAGGAAAAGCTGGCCTGA.

2. A primer sequence for preparing the gene sequence as claimed in claim 1, characterized in that: Upstream primer haoB-F: CGCGGATCCATGATTCGTGAAGTTGAAGGTGAC, downstream primer haoB-R: CCCAAGCTTGGCCAGCTTTTCCTCGG (5'-3').

3. A method for identifying the functional gene haoB of heterotrophic nitrification-aerobic denitrification by PCR amplification using the primer sequence as claimed in claim 2, characterized in that: After gel electrophoresis, a band appeared at the 507bp position, thus judging that it had the functional gene haoB for heterotrophic nitrification-aerobic denitrification.

Images