Mycobacterium tuberculosis isoniazid drug resistance related gene Rv2670c and application of mutation site thereof

Abstract

The invention relates to the technical field of biology, and discloses an isoniazid drug resistance related gene Rv2670c of mycobacterium tuberculosis and application of a mutation site of the isoniazid drug resistance related gene Rv2670c. According to the invention, a new gene Rv2670c related to the isoniazide sensitivity change in a mycobacterium tuberculosis genome is found, and a new base mutation site (the 14th base C of the gene Rv2670c is mutated into T) capable of influencing the isoniazide sensitivity of mycobacterium tuberculosis in the mycobacterium tuberculosis genome is verified; the invention provides a novel detection method and a detection technology for judging the drug resistance of mycobacterium tuberculosis to isoniazide, which can be used for preparing tuberculosis diagnostic reagents and designing antituberculosis drugs. The newly found mutation site is combined with the existing product for application, so that the accuracy and the comprehensiveness of the isoniazide drug resistance detection of the mycobacterium tuberculosis are improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene associated with isoniazid resistance in Mycobacterium tuberculosis. Rv2670c and application of its mutation sites. Background Art

[0002] Tuberculosis is a serious infectious disease caused by Mycobacterium tuberculosis. It is highly contagious and lethal.

[0003] The emergence of drug-resistant tuberculosis has further increased the difficulty of tuberculosis prevention and control. The treatment success rate of multidrug-resistant tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB) is low, the cure rate is low and the mortality rate is high, causing serious harm to human health.

[0004] Detecting the sensitivity of Mycobacterium tuberculosis to isoniazid is crucial for the effective treatment of tuberculosis. Isoniazid is one of the first-line anti-tuberculosis drugs and has important guiding significance for the diagnosis and selection of treatment options for drug-resistant tuberculosis. Accurate and rapid detection of drug-resistant strains can help clinicians adjust treatment plans in a timely manner and avoid the use of ineffective drugs, thereby improving the success rate of treatment and reducing the spread of drug-resistant strains. WHO recommends that all tuberculosis patients be tested for rifampicin and isoniazid resistance to ensure that patients can receive the most appropriate treatment.

[0005] At present, the common mutation sites used for molecular detection of isoniazid resistance in Mycobacterium tuberculosis are mainly concentrated in katG (Rv1908c) , inhA(Rv1484), fabG1(Rv1483) and ahpC(Rv2428) Among them, katG The 315th site of the gene is a hotspot for mutations that has been studied extensively. For example, the AGC→ACC mutation (serine to threonine) is the most common isoniazid resistance-related mutation, accounting for more than 50% of isoniazid-resistant strains, and mainly corresponds to high-concentration isoniazid resistance (MIC ≥ 2 μg / ml) (Reference: Study on the correlation between rifampicin and isoniazid resistance-related gene mutations and resistance levels in Mycobacterium tuberculosis, Chinese Journal of Anti-Tuberculosis, 2021, 43(3): 248-254 doi: 10.3969 / j.issn.1000-6621.2021.03.010). In addition, inhA Mutations in the promoter region of genes play an important role in the detection of isoniazid resistance, especially inhA Mutation at position -15, such as -15C→T. inhAOther mutation sites of the gene, such as Gly5Ser, Glu7Ala, Gly8Ala, Arg16Gly, etc., are also associated with isoniazid resistance (Reference: Research Progress on Isoniazid-Resistant Genes and Mutations in Mycobacterium tuberculosis, Chinese and Foreign Health Digest, 2013 (10) doi: 10.3969 / j.issn.1672-5085.2013.10.463). fabG1 Mutations in the promoter region of genes, especially fabG1 The C-15T mutation is relatively common. ahpC Although gene mutations are rare, mutations in its promoter region (such as -46G→A) are also considered to be associated with isoniazid resistance. ndh, oxyR - ahpC, kasA Mutations in the serotype-dependent gene have also been found to be associated with isoniazid resistance. The detection of these mutation sites provides an important basis for the molecular diagnosis of isoniazid resistance in Mycobacterium tuberculosis.

[0006] The molecular mechanism of isoniazid resistance is complex and involves mutations in multiple genes. Although some gene mutation sites associated with isoniazid resistance have been identified (such as katG 315, inhA Promoter and ahpC Promoter, etc.), but these common mutation sites cannot cover all drug resistance situations. There are other less common mutation sites, or other mutations that have not yet been identified or non-gene mutations that cause drug resistance. This diversity leads to the inability of detection methods and tools based on the currently discovered isoniazid resistance-related mutation sites to fully detect drug resistance in clinical practice, thus affecting the sensitivity and accuracy of the detection.

[0007] In addition, different resistance gene mutations may lead to different degrees of resistance. katG The S315T mutation in the gene is often associated with high-level isoniazid resistance, while inhA The C-15T mutation in the gene promoter region may lead to low-level drug resistance. Different levels of drug resistance will inevitably affect the choice of later treatment options, resulting in a more complicated treatment process.

[0008] Therefore, continuously discovering and verifying new isoniazid resistance-related genes and mutation sites and applying them in clinical testing has become an inevitable choice to improve the sensitivity of isoniazid resistance detection in tuberculosis patients, shorten the diagnosis and treatment time of patients, and quickly formulate precise treatment plans.

[0009] Rv2670c is a gene in Mycobacterium tuberculosis that encodes a hypothetical protein. Rv2670cIn CRISPRi screening experiments, it showed sensitivity to certain drugs, suggesting that its expression may be related to the resistance of Mycobacterium tuberculosis to drugs. Rv2670c A study on the effect of isoniazid sensitivity of Mycobacterium tuberculosis on clinical isolates of Mycobacterium tuberculosis was reported. Rv2670c The gene sequence was relatively conservative and no obvious gene polymorphism was found, which indicated that the gene had high stability among different strains. Summary of the invention

[0010] The purpose of the present invention is to provide a gene related to isoniazid resistance of Mycobacterium tuberculosis Rv2670c and application of its mutation sites.

[0011] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a gene Rv2670c The invention relates to an application of a marker of isoniazid resistance of Mycobacterium tuberculosis in the preparation of a product for detecting isoniazid resistance of Mycobacterium tuberculosis.

[0012] The gene Rv2670c A gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO:4; or (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:4.

[0013] Furthermore, the gene Rv2670c The 14th base of the gene mutated from C to T (correspondingly, Rv2670c The fifth amino acid of the encoded protein mutated from alanine A to valine V), corresponding to isoniazid-resistant strains of Mycobacterium tuberculosis.

[0014] In a second aspect, the present invention provides a gene related to isoniazid resistance of Mycobacterium tuberculosis Rv2670c The mutation site is a gene in the genome of the standard strain of Mycobacterium tuberculosis H37Rv Rv2670c The 14th base C of the gene is mutated to T; or, The mutation site is the mutation of base G to A at position 2986827 on the genome of the standard strain of Mycobacterium tuberculosis H37Rv; The reference sequence number of the Mycobacterium tuberculosis standard strain H37Rv genome is RefSeq NC_000962.3.

[0015] In a third aspect, the present invention provides use of the mutation site as a marker of isoniazid resistance of Mycobacterium tuberculosis in the preparation of a product for detecting isoniazid resistance of Mycobacterium tuberculosis.

[0016] In a fourth aspect, the present invention provides primers for detecting the mutation site.

[0017] In a fifth aspect, the present invention provides a detection reagent or a kit containing the primers.

[0018] In a sixth aspect, the present invention provides the use of the primers or a detection reagent or kit containing the primers in detecting the resistance of Mycobacterium tuberculosis to isoniazid (including non-disease diagnosis and treatment purposes).

[0019] In a seventh aspect, the present invention provides a method for rapid screening of isoniazid resistance in Mycobacterium tuberculosis (including non-disease diagnosis and treatment purposes), amplifying a gene of the Mycobacterium tuberculosis genome Rv2670c , and detect genes Rv2670c Whether the 14th base C mutates to T is used to determine the resistance of Mycobacterium tuberculosis to isoniazid.

[0020] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The present invention discovered a new gene in the genome of Mycobacterium tuberculosis that is related to changes in isoniazid sensitivity— Rv2670c ; (II) The present invention verifies a new base mutation site (gene Rv2670c The 14th base C mutated to T); (III) The present invention provides a new detection method and detection technology for determining the resistance of Mycobacterium tuberculosis to isoniazid by detecting the above-mentioned new base mutation site carried by Mycobacterium tuberculosis; (IV) The present invention provides an application in the preparation of tuberculosis diagnostic reagents and anti-tuberculosis drug design based on the above-mentioned new isoniazid resistance-related gene and a new base mutation site located on the gene that can affect the sensitivity of the strain to isoniazid. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the structure of the expression vector pMV261 in a preferred embodiment of the present invention.

[0022] Figure 2 mc carrying the pMV261_Rv2670c_M plasmid in a preferred embodiment of the present invention 2 155 bacterial solution was diluted 10 4 After fold increase, the strain could still grow in an environment with an isoniazid concentration of 4ug / ml.

[0023] Figure 3A , Figure 3B and Figure 3CIn the preferred embodiment of the present invention, Rv2670c Distribution of gene mutations.

[0024] Figure 4 The drug and concentration distribution (ug / ml) of the Mycobacterium tuberculosis MYCOTBI drug sensitivity plate in the preferred embodiment of the present invention. OFL: ofloxacin, MXF: moxifloxacin, RIF: rifampicin, AMI: amikacin, STR: streptomycin, RFB: rifabutin, PAS: para-aminosalicylic acid, ETH: ethionamide, CYC: cycloserine, INH: isoniazid, KAN: kanamycin, EMB: ethambutol, POS: growth control.

[0025] Figure 5 In the preferred embodiment of the present invention, 6 strains carry Rv2670c The sensitivity of clinical strains with mutations at the 14th base of the gene to isoniazid. The green box is the detection area of ​​isoniazid, the red circle is the MIC of isoniazid, and the blue circle indicates that the MIC of isoniazid for this strain has exceeded the maximum detection range. Among them, a: AH20030 drug sensitivity result chart; b: AH21040 drug sensitivity result chart; c: AH21069 drug sensitivity result chart; d: GS06037 drug sensitivity result chart; e: JL06048 drug sensitivity result chart; f: XJ20554 drug sensitivity result chart. DETAILED DESCRIPTION

[0026] The first object of the present invention is to provide a new gene in the genome of Mycobacterium tuberculosis that is related to the change of isoniazid sensitivity and the mutation site on the gene.

[0027] The second object of the present invention is to provide an application of the mutation site as a detection target in the field of molecular drug resistance detection of Mycobacterium tuberculosis, especially for detecting high-concentration isoniazid resistance.

[0028] The third object of the present invention is to provide a rapid screening method for isoniazid resistance of Mycobacterium tuberculosis, which can be used as a means of diagnosing drug-resistant tuberculosis (resistance to isoniazid).

[0029] The fourth object of the present invention is to provide a new target for anti-tuberculosis drugs that can be used to treat tuberculosis.

[0030] In order to screen new genes related to isoniazid resistance in the Mycobacterium tuberculosis genome, enrich the existing targets for isoniazid molecular resistance detection in Mycobacterium tuberculosis, improve the sensitivity and detection rate of detection, and achieve rapid and accurate treatment of tuberculosis patients.

[0031] The present invention adopts the following technical solution: First, the discovery of new genes and mutation sites related to isoniazid resistance in the genome of Mycobacterium tuberculosis.

[0032] The data of Mycobacterium tuberculosis strains with both whole genome sequencing information and isoniazid phenotypic resistance test results were retrieved from public databases. After bioinformatics analysis, the results showed that Rv2670c Gene, sequence as SEQ ID NO:1 ( Rv2670c :1-1110bp) or its base complementary sequence SEQ ID NO:2 (H37Rv:2985731-2986840bp), and a base mutation on its gene ( Rv2670c The 14th base on the gene, that is, the 2986827th base on the H37Rv genome) is associated with isoniazid sensitivity.

[0033] Second, Rv2670c Biological verification of the effects of genes and mutation sites on isoniazid sensitivity.

[0034] Build and carry Rv2670c The recombinant plasmid pMV261_Rv2670c_W carrying the wild-type sequence of the gene (SEQ ID NO: 1) Rv2670c The recombinant plasmid pMV261_Rv2670c_M with a mutant gene sequence (the 14th base C mutated to T, SEQ ID NO: 3) was introduced into the Mycobacterium smegmatis mc 2 155, detection of Mycobacterium smegmatis containing different plasmids 2 155Differences in sensitivity to isoniazid.

[0035] Third, screening for carriers in clinical strains Rv2670c A strain with a mutation at the 14th base of the gene.

[0036] Through bioinformatics analysis, the clinical strains of Mycobacterium tuberculosis that have been preserved in our laboratory and have completed whole genome sequencing were screened for carriers. Rv2670c strains with mutations in the 14th base of the gene, and amplifying the strains obtained by screening Rv2670c The complete gene sequence was compared and the mutation of the 14th base was analyzed through sequencing.

[0037] Fourth, evaluate the carrying Rv2670c Susceptibility of clinical strains with mutation at base 14 of the gene to isoniazid.

[0038] The carriers obtained by screening Rv2670c The clinical strain with a mutation at the 14th base of the gene was tested for its sensitivity to isoniazid using a microplate susceptibility test method to verify Rv2670cEffect of mutation at position 14 of the gene on the sensitivity to isoniazid.

[0039] Molecular resistance testing for isoniazid usually relies on katG , inhA , fabG1, kasA, ndh and ahpC etc. Mutation analysis of genes and their promoter regions. Although, e.g. katG The S315T mutation is one of the main markers of drug resistance, but mutations in other genes cannot be ignored, and specific mutations may be associated with drug resistance patterns in specific regions. Due to the diversity and complexity of drug-resistant mutations, the detection of a single gene or mutation site is no longer sufficient to fully assess drug resistance, so comprehensive multi-gene and multi-site analysis is needed to improve the accuracy and reliability of diagnosis. Although this method can cover most clinically relevant isoniazid resistance, there are still cases of missed diagnoses, especially for those caused by atypical or rare mutations.

[0040] By continuously adding new resistance-related genes and mutation sites, the detection range of existing molecular diagnostic tools will be more comprehensive and reduce false negative results. Rv2670c The gene and its 14th base mutation have not been used in any molecular detection products for isoniazid resistance that are currently on the market. Rv2670c The detection of the gene and its 14th base mutation (base 2986827 of the H37Rv genome) in combination with existing products will inevitably improve the accuracy and comprehensiveness of isoniazid resistance detection in Mycobacterium tuberculosis.

[0041] At the same time, the isoniazid resistance concentration caused by the base mutations listed in the present invention is not less than 2ug / ml, which belongs to high-concentration isoniazid resistance according to the relevant regulations of the World Health Organization (WHO). Therefore, the base mutations listed in the present invention are related to high-concentration isoniazid resistance, which can distinguish low-level and high-level isoniazid resistance, clearly guide the selection of clinical drug dosages, timely adjust the first-line medication regimen for isoniazid-resistant patients, and reduce the risk of treatment failure and drug side effects.

[0042] Tuberculosis is an important chronic, infectious disease worldwide, and its epidemiological monitoring has always been the focus of tuberculosis prevention and control. By analyzing newly discovered drug-resistant mutation sites, a more sophisticated drug-resistant strain transmission network can be constructed, "super spreaders" or drug-resistant hotspots can be identified, the geographical distribution and prevalence of new mutations can be monitored in real time, and potential drug-resistant outbreaks can be warned. The discovery and functional research of new drug-resistant genes may also reveal new drug targets and provide potential design targets for the development of new anti-tuberculosis drugs.

[0043] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0044] The Mycobacterium smegmatis used in the following examples 2 155 was purchased from the American type culture collection (ATCC).

[0045] Example 1 Discovery of new genes and mutation sites associated with isoniazid resistance in the genome of Mycobacterium tuberculosis

[0046] Data on Mycobacterium tuberculosis strains with both whole genome sequencing information and isoniazid phenotypic resistance test results were retrieved from the public database of NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov). Based on bioinformatics analysis, after removing mutation sites with low sequencing quality, removing mutation sites unique to different strains, removing rare mutation sites, removing mutation sites not related to drug resistance, and removing uninterpretable drug sensitivity results, and eliminating redundant data such as genes and mutation sites related to isoniazid resistance in the currently known Mycobacterium tuberculosis genome, combined with the isoniazid resistance phenotypic test results of each selected strain, a total of 2588 strains of strain data were included. After comparison and analysis, it was found that 55 of the strains had the same mutation site in the corresponding H37Rv genome. Rv2670c The 14th base C in the gene mutated to T (i.e., the 2986827th base in the H37Rv genome, G mutated to A), and the isoniazid phenotypic resistance test result was resistant (R); the whole genome sequencing data of the remaining 2533 strains showed that the 14th base in the Rv2670c gene was C (i.e., the corresponding bases at the 2986827th base in the H37Rv genome were all G), no mutation occurred, and the isoniazid phenotypic resistance test result was resistant or sensitive (R or S); that is, when Rv2670c When the 14th base C on the gene mutates to T (i.e. the corresponding 2986827th base G on the H37Rv genome mutates to A), Mycobacterium tuberculosis becomes resistant to isoniazid, as shown in Tables 1 and 2.

[0047] Rv2670c Mycobacterium tuberculosis ( Mycobacterium tuberculosis) A gene on the reference strain H37Rv genome (RefSeq NC_000962.3), located at chromosome position 2985731-2986840bp, with a nucleotide sequence length of 1110 bp. The encoding product of this gene contains 369 amino acids, and the sequence is shown in SEQ ID NO:4. Rv2670c The specific function of this gene has not been fully elucidated. It is speculated that it encodes a transmembrane protein or enzyme that may be involved in cell wall synthesis, drug efflux or other important physiological processes.

[0048] Table 1 Rv2670c Base sites of genes associated with isoniazid resistance

[0049] Table 2 Rv2670c Base sites of genes associated with isoniazid resistance

[0050] Example 2 Rv2670c Functional verification of genes and mutation sites affecting isoniazid sensitivity Mycobacterium smegmatis ( Mycobacterium smegmatis ) is a non-pathogenic mycobacterium that is widely used as a model strain for studying the gene function of Mycobacterium tuberculosis because of its high genetic similarity with Mycobacterium tuberculosis and high operational safety. 2 155 was used as a model strain to verify the biological functions of the newly discovered mutation sites.

[0051] 1. Rv2670c Gene wild type and Rv2670c Construction of gene mutation recombinant plasmid Respectively Rv2670c The wild-type sequence of the gene (SEQ ID NO: 1) and Rv2670c The mutant gene sequence (C at position 14 mutated to T, SEQ ID NO: 3) was synthesized in vitro and ligated to the pMV261 plasmid (gift from Howard Hughes Medical Institute at Albert Einstein College of Medicine). BamH Ⅰ and EcoR I between the restriction sites, construct Rv2670c Gene wild-type recombinant plasmid pMV261_Rv2670c_W and Rv2670c The gene mutant recombinant plasmid pMV261_Rv2670c_M was introduced into E. coli for storage. Figure 1 shown.

[0052] 2. Recombinant plasmid recovery and extraction A small amount of E. coli containing the recombinant plasmid was picked up, streaked onto a solid LB plate containing kanamycin (50 μg / ml), and cultured in a 37°C constant temperature incubator for 12-16 hours.

[0053] Pick a single clone colony and inoculate it into 5 ml LB liquid medium containing kanamycin (50 μg / ml), and place it in a constant temperature shaker at 37°C and 180 rpm for overnight culture. Extract the recombinant plasmid according to the instructions of the Tiangen Plasmid Extraction Kit (DP103-03).

[0054] 3. Mycobacterium smegmatis mc 2 155 Preparation of competent cells Pick the mc grown on the LB solid plate 2 155 single clones were inoculated into 5 ml 7H9 liquid culture medium and cultured at 37°C, 180 rpm, with shaking until the OD600 value was about 0.6.

[0055] Take the above bacterial solution and inoculate it into 200 ml 7H9 liquid culture medium (containing 1‰ Tween 80) at a ratio of 1:100, and culture at 37℃ with shaking until the OD600 value reaches about 0.6.

[0056] Incubate the culture on ice for 1-2 h.

[0057] The cells were collected by centrifugation at 5000 rpm for 10 min at 4°C and the supernatant was discarded.

[0058] Resuspend the cells in 100 ml of pre-cooled 10% sterile glycerol.

[0059] The cells were collected by centrifugation at 5000 rpm for 10 min at 4°C and the supernatant was discarded.

[0060] Repeat washing the bacteria three times, and reduce the volume of 10% sterile glycerol used to 50ml, 25ml, and 12.5ml respectively. Finally, use 5ml of pre-cooled 10% sterile glycerol to resuspend the bacteria, gently pipette to mix, and dispense 200ul into 1.5ml Eppendorf tubes. Store at -80℃ for later use.

[0061] 4. Construction of recombinant plasmids (two recombinant plasmids pMV261_Rv2670c_W, pMV261_Rv2670c_M and pMV261 empty plasmid) by electroporation to overexpress Mycobacterium smegmatis: Mycobacterium smegmatis 2 After thawing the 155 competent cells on ice, add 5ul of each of the three plasmid DNAs mentioned above, mix gently, and incubate on ice for 10min.

[0062] Transfer the above mixture to a pre-cooled 2 mm electroporation cup, wipe off the moisture on the outside of the electroporation cup, set the electroporation instrument parameters to voltage 2.5 KV, resistance 1000 Ω, capacitance 25 µF, and click electroporation.

[0063] After electroporation, the mixture was transferred to a 1.5 ml EP tube, 1 ml of 7H9 liquid culture medium was added, and the tube was placed in a shaker at 37°C and 180 rpm for 4 h to recover.

[0064] Centrifuge at 5000rpm for 10min, discard part of the supernatant, keep 200µl of the resuspended bacteria, spread on an LB solid plate containing kanamycin (50ug / ml), place in a 37℃ constant temperature incubator and culture for 3-5 days to observe whether there is colony growth.

[0065] 5. Identification of Recombinant Plasmids Overexpressing Mycobacterium smegmatis Pick a single colony of the constructed recombinant plasmid overexpressing Mycobacterium smegmatis into 5 ml of fresh 7H9 liquid culture medium, place it in a shaker at 37°C, 180rpm for 2 days, and then perform PCR identification of the bacterial solution. The primers used for identification are pMV261F:GTCATGGGCCGAACATACT, pMV261R:GTAACATCAGAGATTTTGAGACAC (SEQ ID NO: 5-6). The PCR product was sent to the company for sequencing, and the sequencing results were consistent with H37Rv Rv2670c Gene sequences were compared to confirm the successful construction of recombinant plasmids overexpressing Mycobacterium smegmatis mc 2 155_pMV261 (carrying pMV261 empty plasmid), mc 2 155_pMV261_Rv2670c_W (carrying Rv2670c Wild-type gene SEQ ID NO: 1), mc 2 155_pMV261_Rv2670c_M (carrying Rv2670c Mutant gene SEQ ID NO: 3).

[0066] 6. Plate susceptibility test to detect the sensitivity of recombinant plasmid-overexpressing Mycobacterium smegmatis to isoniazid Preparation of isoniazid susceptibility plates containing different concentrations. Prepare 10mg / ml isoniazid solution and 100mg / ml kanamycin solution; use sterile culture dishes to prepare 7H10 plates with the following isoniazid concentrations: isoniazid (0ug / ml): kanamycin (50ug / ml), isoniazid (1ug / ml): kanamycin (50ug / ml), isoniazid (2ug / ml): kanamycin (50ug / ml), isoniazid (4ug / ml): kanamycin (50ug / ml).

[0067] Cultivation of recombinant plasmid-overexpressed Mycobacterium smegmatis. Fresh monoclonal colonies of the three recombinant plasmid-overexpressed Mycobacterium smegmatis were picked from the 7H10 solid plate and placed in 5 ml 7H9 liquid culture medium (kanamycin 50 μg / mL) at 37°C and 180 rpm for shaking culture until the logarithmic growth phase, and the OD600 of the bacterial solution was adjusted to about 0.2.

[0068] Dilution of recombinant plasmid overexpressing Mycobacterium smegmatis samples. In a 1ml 96-well deep-well plate, 7H9 medium (kanamycin 50ug / ml) was used to dilute the three recombinant plasmid overexpressing Mycobacterium smegmatis bacterial suspensions in a gradient dilution multiple of 10 1 , 10 2 , 10 3 , 10 4 .

[0069] Three recombinant plasmids overexpressed 10 1 , 10 2 , 10 3 , 10 4 Dilute the bacterial solution and apply 10ul of the solution on 7H10 culture dishes containing different concentrations of isoniazid. Seal the culture dishes, culture at 37℃ for 3-5 days, and observe the results.

[0070] It was observed that mc carrying the pMV261_Rv2670c_M plasmid 2 155 bacterial solution was diluted 10 4 After fold increase, it can still grow in an environment with an isoniazid concentration of 4ug / ml; however, mc carrying pMV261_Rv2670c_W plasmid and pMV261 empty plasmid 2 155 bacterial solution diluted 10 2 After 2 times, the growth was significantly inhibited in the environment of isoniazid concentration of 2ug / ml, and no growth was observed in the environment of isoniazid concentration of 4ug / ml; that is, when Rv2670c When the 14th base C on the gene mutates to T (i.e. the 2986827th base G on the H37Rv genome mutates to A), the sensitivity of Mycobacterium tuberculosis to isoniazid decreases and it exhibits drug resistance characteristics, such as Figure 2 shown.

[0071] Example 3 Carrying Rv2670c Screening of clinical strains for mutations at base 14 of the gene The original sequencing data of clinical strains of Mycobacterium tuberculosis that have completed whole genome sequencing were obtained from the data storage of our laboratory; the reference strain H37Rv genome sequence of Mycobacterium tuberculosis was downloaded from the NCBI database (RefSeq NC_000962.3); Rv2670c Gene annotation information, clear Rv2670cThe location and sequence characteristics of the gene in the reference genome; the original sequencing data of the clinical strain of Mycobacterium tuberculosis after quality control were compared with the reference genome of Mycobacterium tuberculosis; the Rv2670c The variation of gene region is found according to gene annotation information. Rv2670c The mutation record at the 14th base of the gene was used to extract the information of strains carrying the mutation at this site.

[0072] After whole genome comparison and analysis, 6 strains were screened out from the clinical strains whose whole genome sequencing had been completed by the Tuberculosis Control Room of the Institute of Infectious Disease Prevention and Control, Chinese Center for Disease Control and Prevention. Rv2670c The clinical strains in which the C at the 14th base of the gene mutated to T (i.e., the G at the 2986827th base on the H37Rv genome mutated to A) are AH20030, AH21040, AH21069, GS06037, JL06048, and XJ20554.

[0073] 1. Scrape a loop of fresh culture of the above 6 clinical strains and place them in screw-cap centrifuge tubes containing 200ulTE respectively; inactivate at 80℃ for 30min; lyse the bacteria at 100℃ for 10min; centrifuge the screw-cap centrifuge tubes at 12000rpm for 10min, and collect the supernatant as amplification template.

[0074] 2. Use the above template to amplify the corresponding clinical strains Rv2670c The primers used for amplification and sequencing of the full-length gene were Rv2670cF: TGGAGCTGTCCAAGCTGTACCT, Rv2670cR1: TCCAAGCTGCTGATGAAGTTCGC or Rv2670cR2: TGAATACCGCCATGTCACGGTCAA (SEQ ID NO: 7-9). When the amplification efficiency of primers Rv2670cF / Rv2670cR1 was poor, primers Rv2670cF / Rv2670cR2 were used for amplification. The PCR amplification product was sent to the company for sequencing, and the sequencing results were consistent with those of H37Rv Rv2670c Gene sequences were compared to identify mutation sites.

[0075] 3. After amplification, sequencing and analysis, it was found that 6 strains, including AH20030, AH21040, AH21069, GS06037, JL06048 and XJ20554, all carried complete Rv2670c gene, and the 14th base C mutated to T, while the reference genome H37Rv Rv2670c There is no mutation at the 14th base of the gene, such as Figure 3A , Figure 3B and Figure 3C shown.

[0076] Example 4 Carrying Rv2670c Susceptibility of clinical strains with mutation at base 14 of gene to isoniazid The Mycobacterium tuberculosis MYCOTBI drug sensitivity test panel produced by Thermo Fisher Scientific was used to test the six strains of AH20030, AH21040, AH21069, GS06037, JL06048, and XJ20554. Rv2670c The sensitivity of clinical strains with gene mutations to isoniazid, the composition of the drug sensitivity panel is as follows Figure 4 shown.

[0077] 1. Take 2 ml of sterile saline into a sterile ultrasonic dispersion tube.

[0078] 2. Use a sterile inoculation loop to scrape a certain amount of the strain to be tested that has been cultured for no more than 14 days and add it to an ultrasonic dispersion tube containing physiological saline.

[0079] 3. Ultrasonic dispersion for 30 seconds, after the bacterial suspension has settled naturally for 15 minutes, the concentration of the bacterial suspension is adjusted to 0.5 McFarland units.

[0080] 4. Transfer 100ul of bacterial suspension to 10ml of Mycobacterium tuberculosis MYCOTBI culture medium and vortex to mix for 30s.

[0081] 5. Use a multichannel pipette to transfer 100ul to each well of the Mycobacterium tuberculosis MYCOTBI Antibiotic Susceptibility Test Plate.

[0082] 6. Cover all wells with adhesive sealing film. Make sure all wells are completely covered to ensure adequate sealing.

[0083] 7. Incubate the drug-sensitive plate at 35-37°C in an aerobic environment for 14 days and check its growth. When colonies grow in the growth control wells, the lowest antibiotic concentration represented by the drug-containing wells where colony growth is significantly inhibited is the minimum inhibitory concentration (MIC) of the antibiotic.

[0084] 8. According to the regulations of the World Health Organization (WHO), the American Clinical and Laboratory Standards Institute (CLSI) and related literature reports, when the MIC of Mycobacterium tuberculosis to isoniazid is greater than 0.2ug / ml, it can be judged as resistant (R), and when the MIC of Mycobacterium tuberculosis to isoniazid is greater than or equal to 2ug / ml, it can be judged as high-concentration resistance.

[0085] 9. Based on the Mycobacterium tuberculosisMYCOTBI drug sensitivity test panel produced by Thermo Fisher Scientific, the sensitivity of six clinical strains, including AH20030, AH21040, AH21069, GS06037, JL06048, and XJ20554, to isoniazid was tested. It was found that the above six strains carried Rv2670c Clinical strains with mutations at base 14 of the gene all showed high-concentration resistance to isoniazid. The data are summarized in Table 3. The drug sensitivity results are shown in Figure 5 As shown in the above results, when the Mycobacterium tuberculosis genome Rv2670c When the 14th base C of the gene mutates to T (that is, the 2986827th base G on the H37Rv genome corresponding to the Mycobacterium tuberculosis mutates to A), the strain exhibits high-concentration resistance to isoniazid.

[0086] Table 3 Carrying Rv2670c Susceptibility of strains with mutation at base 14 of the gene to isoniazid

[0087] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Genes Rv2670c Use of a marker of isoniazid resistance of Mycobacterium tuberculosis in the preparation of a product for detecting isoniazid resistance of Mycobacterium tuberculosis; The gene Rv2670c A gene encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO:4; or (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

4.

2. The use according to claim 1, characterized in that: The gene Rv2670c The 14th base of the gene mutated from C to T, corresponding to the isoniazid-resistant strain of Mycobacterium tuberculosis.

3. Genes associated with isoniazid resistance in Mycobacterium tuberculosis Rv2670c Use of mutation sites as markers of isoniazid resistance of Mycobacterium tuberculosis in the preparation of products for detecting isoniazid resistance of Mycobacterium tuberculosis; The mutation site is a gene in the genome of the standard strain of Mycobacterium tuberculosis H37Rv Rv2670c The 14th base C of the gene is mutated to T; or, The mutation site is the mutation of base G to A at position 2986827 on the genome of the standard strain of Mycobacterium tuberculosis H37Rv; The gene Rv2670c As described in claim 1; The reference sequence number of the Mycobacterium tuberculosis standard strain H37Rv genome is RefSeq NC_000962.

3.

4. Used to detect isoniazid resistance-related genes in Mycobacterium tuberculosis Rv2670c Primers for the mutation site; The mutation site is a gene in the genome of the standard strain of Mycobacterium tuberculosis H37Rv Rv2670c The 14th base C of the gene is mutated to T; or, The mutation site is the mutation of base G to A at position 2986827 on the genome of the standard strain of Mycobacterium tuberculosis H37Rv; The gene Rv2670c As described in claim 1; The reference sequence number of the Mycobacterium tuberculosis standard strain H37Rv genome is RefSeq NC_000962.

3.

5. A detection reagent or kit containing the primers according to claim 4.

6. Use of the primer according to claim 4 or the detection reagent or kit according to claim 5 in detecting the drug resistance of Mycobacterium tuberculosis to isoniazid; The applications are for non-disease diagnosis and treatment purposes.

7. A rapid screening method for isoniazid resistance of Mycobacterium tuberculosis, characterized in that: Amplification of genes from the Mycobacterium tuberculosis genome Rv2670c , and detect genes Rv2670c Whether the 14th base of the strain C mutates to T is used to determine the resistance of Mycobacterium tuberculosis to isoniazid; The gene Rv2670c As described in claim 1; The method is for non-disease diagnosis and treatment purposes.

Images