Kit for visually detecting goose circovirus based on LAMP-CRISPR / Cas12a and application

Abstract

The invention relates to a reagent combination and a kit for visually detecting goose circovirus based on LAMP-CRISPR / Cas12a and application of the reagent combination and the kit, the reagent combination comprises LAMP amplification primers and crRNA, the LAMP amplification primers comprise two outer primers F3-3 and B3-3 and two inner primers FIP-3 and BIP-3, the crRNA is any one of crRNA-1 and crRNA-2, and the sequences of the LAMP amplification primers and the crRNA are shown as SEQ ID NO.9-12 and SEQ ID NO.13-14. The invention further discloses a kit for visually detecting the goose circovirus based on LAMP-CRISPR / Cas12a and application of the kit for visually detecting the goose circovirus based on LAMP-CRISPR / Cas12a. According to the method, the LAMP-CRISPR / Cas12a detection system is established by using the reagent combination, so that the rapid detection of the goose circovirus is realized. The detection method established by the invention does not need an expensive thermal cycle instrument, is simple to operate, and can achieve the purpose of rapid visual detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of livestock and poultry disease diagnosis, and relates to the detection of goose circovirus, and specifically relates to a rapid visualization detection kit and method for goose circovirus by combining a LAMP amplification method with a CRPSPR / Cas12a detection method. Background Art

[0002] Goose circovirus (GoCV) is a member of the Circoviridae family and the Circovirus genus. It is a small non-enveloped DNA virus with a covalently closed, single-stranded circular genome of about 1821 nt in size. It contains two major open reading frames (ORFs), ORF V1 encoding the replication-related structural protein (rep) and ORF C1 encoding the viral capsid protein (Cap). Goose circovirus infection was first discovered in Germany in 1999, and then cases of virus infection were reported around the world. In 2005, my country first reported goose circovirus infection in geese. The disease mainly causes growth retardation, ruffled feathers, diarrhea, lymphocytopenia and histiocytosis in tissues such as the bursa of Fabricius, thymus and spleen, and the presence of basophilic inclusion bodies in mononuclear cells in the bursa of Fabricius can be observed by projection electron microscopy, causing poor growth and immunosuppression in geese, causing serious economic losses to my country's goose farming industry.

[0003] Loop-mediated isothermal amplification (LAMP) is a commonly used isothermal amplification technology for nucleic acid. It can amplify nucleic acids with high specificity, sensitivity and high rate under isothermal conditions and get rid of the high equipment requirements of traditional PCR methods. Its principle is to use 4 main primers and DNA polymerase with strong chain displacement activity to produce multi-ring amplification products. By adding two circular primers, the amplification can be further accelerated. Because of its high amplification efficiency and large yield, it is one of the most commonly used isothermal amplification technologies in on-site instant testing in the fields of environmental monitoring, food safety testing, early disease detection and diagnosis.

[0004] Clustered Regularly Interspaced Short Palindromic Repeats / Associated Protein (CRISPR / Cas) systems have been widely used in gene editing and molecular detection. CRISPR is an adaptive defense system found in bacterial and archaeal cells against phage infection. In 2012, the CRISPR system was first demonstrated in vitro to have the ability to cleave DNA, making it a focus for the development of novel nucleic acid detection methods. In CRISPR / Cas-mediated detection systems, (CRISPR RNA) crRNA can guide Cas effector nucleases (e.g., Cas9, Cas12a, Cas12b, Cas13a, Cas14) to their target sites, where they then form a ternary target / crRNA / Cas nuclease complex. The crRNA triggers the trans-cleavage activity of the Cas protein, which can specifically target and cleave a single-stranded DNA reporter gene (ssDNA). Many CRISPR / Cas systems (e.g., CRISPR / Cas12 and CRISPR / Cas13) are highly sensitive and specific in detecting a variety of target sequences / pathogens due to their ability to efficiently cleave single-stranded DNA reporter genes. Therefore, methods combining nucleic acid amplification with CRISPR-Cas play an important role in accurate detection.

[0005] At present, the detection methods of goose circovirus mainly include serology and molecular biology such as ELISA and PCR, qPCR and other methods, which have problems such as low sensitivity, expensive instruments and professional technicians. Therefore, it is necessary to study a rapid, portable, highly sensitive, highly specific and easy-to-operate on-site detection method for goose circovirus. Summary of the invention

[0006] The purpose of the present invention is to provide a reagent combination (including a LAMP amplification primer set, a crRNA combination), a kit and a corresponding detection method for visually detecting goose circovirus based on the LAMP-CRISPR / Cas12a system, so as to realize the on-site rapid detection of goose circovirus, and then realize the early prevention and control of goose circovirus-related diseases.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A reagent combination for visually detecting goose circovirus based on LAMP-CRISPR / Cas12a, comprising a LAMP amplification primer and crRNA;

[0009] The LAMP amplification primers include an outer primer pair F3-3 and B3-3, and an inner primer pair FIP-3 and BIP-3; the nucleotide sequences of the outer primer pair F3-3 and B3-3 are respectively:

[0010] F3-3: 5'-TGGTTGTGATGTGCCTCT-3',

[0011] B3-3: 5'-GCCTGGAAGCGATACCATC-3';

[0012] The nucleotide sequences of the inner primer pair FIP-3 and BIP-3 are:

[0013] FIP-3: 5'-GTCGAACTCCGTCCGGCATTTAATGTATGTGCTGCCTTGTGT-3',

[0014] BIP-3:

[0015] 5'-TTGGTTTCCTGTTCCCGGCACAGCCCCAAACCAGGAATT-3';

[0016] The crRNA is any one of crRNA-1 and crRNA-2, and the nucleotide sequences of crRNA-1 and crRNA-2 are respectively:

[0017] crRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUCUGUUCCCGGCAAUCUGUCU-3'

[0018] crRNA-2: 5'-UAAUUUCUACUAAGUGUAGAUCCAAUCGUAUCAUGUAGUAAUCG-3'.

[0019] Preferably, the crRNA is crRNA-2.

[0020] The reagent combination further comprises a ssDNA probe, the nucleotide sequence of the ssDNA probe is 5'-TTATT-3', the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ, or the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with Biotin.

[0021] The present invention also provides a kit for visually detecting goose circovirus based on LAMP-CRISPR / Cas12a, wherein the kit comprises a LAMP amplification system and a CRISPR / Cas12a detection system;

[0022] The LAMP amplification system includes an outer primer pair F3-3 and B3-3, and an inner primer pair FIP-3 and BIP-3; the nucleotide sequences of the outer primer pair F3-3 and B3-3 are respectively:

[0023] F3-3: 5'-TGGTTGTGATGTGCCTCT-3',

[0024] B3-3: 5'-GCCTGGAAGCGATACCATC-3';

[0025] The nucleotide sequences of the inner primer pair FIP-3 and BIP-3 are:

[0026] FIP-3:

[0027] 5'-GTCGAACTCCGTCCGGCATTTAATGTATGTGCTGCCTTGTGT-3',

[0028] BIP-3:

[0029] 5'-TTGGTTTCCTGTTCCCGGCACAGCCCCAAACCAGGAATT-3';

[0030] The CRISPR / Cas12a detection system includes crRNA, wherein the crRNA is any one of crRNA-1 and crRNA-2, and the nucleotide sequences of crRNA-1 and crRNA-2 are respectively:

[0031] crRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUCUGUUCCCGGCAAUCUGUCU-3'

[0032] crRNA-2: 5'-UAAUUUCUACUAAGUGUAGAUCCAAUCGUAUCAUGUAGUAAUCG-3'.

[0033] Preferably, the crRNA is crRNA-2.

[0034] The LAMP amplification system also includes 2×LAMP Master Mix, DNA Polymerase, ddH2O, samples to be tested, and negative and positive control samples.

[0035] The CRISPR / Cas12a detection system also includes Cas12a Reaction buffer (10×), LbaCas12a, LAMP amplification product, ssDNA probe and ddH2O.

[0036] The nucleotide sequence of the ssDNA probe is 5'-TTATT-3'. The 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ, or the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with Biotin.

[0037] The kit is used for non-diagnostic detection of goose circovirus. The nucleic acid of the sample to be tested is amplified using the aforementioned LAMP amplification system, and the amplified product is then added to the CRISPR / Cas12a detection system to detect the nucleic acid. The kit can be used to visually detect goose circovirus based on LAMP-CRISPR / Cas12a.

[0038] A method for visually detecting goose circovirus based on LAMP-CRISPR / Cas12a, specifically comprising the following steps:

[0039] (1) Extract DNA from the sample to be tested;

[0040] (2) using the DNA extracted in step (1) as a template, amplifying in a LAMP amplification system;

[0041] (3) performing enzyme digestion and fluorescence detection on the LAMP amplification product obtained in step (2) in a CRISPR / Cas12a detection system;

[0042] The total volume of the LAMP amplification system is 25 μL, including 12.5 μL 2×LAMP Master Mix, 0.5 μL DNA Polymerase, 0.5 μL each of the outer primers F3-3 and B3-3, to a final concentration of 0.2 μM, 2 μL each of the inner primers FIP-3 and BIP-3, to a final concentration of 0.8 μM, 1 μL of the sample DNA to be tested, and ddH2O supplemented to 25 μL;

[0043] The total volume of the CRISPR / Cas12a detection system is 20 μL, including 2 μL of Cas12a Reaction buffer (10×), 1 μL of Lba Cas12a to a final concentration of 150 nM, 1 μL of crRNA-2 (1 μM) to a final concentration of 50 nM, 1.2 μL of ssDNA (4 μM) to a final concentration of 240 nM, 1 μL of LAMP amplification product, and ddH2O is supplemented to 20 μL.

[0044] In the CRISPR / Cas12a detection system, the concentration ratio of Lba Cas12a protein to crRNA is 1:0.5-4, and the ssDNA probe concentration is 240 nM. Preferably, the optimal final concentrations of crRNA and Lba Cas12a are 50 nM and 150 nM, respectively.

[0045] Compared with the prior art, the advantages of the present invention are: the present invention uses the reagent combination (including LAMP amplification primers and crRNA) to establish a LAMP-CRISPR / Cas12a detection system, thereby realizing rapid detection of goose circovirus.

[0046] The method for visual detection of goose circovirus based on LAMP-CRISPR / Cas12a established in the present invention has the characteristics of high sensitivity and strong specificity. According to the results of the sensitivity test, the detection limit of the detection method is 1×10 0 Copies / μL. The specificity test results showed that only goose circovirus was positive, while other viruses and negative controls were not detected, indicating that this method has high specificity.

[0047] The LAMP-CRISPR / Cas12a detection method established by the present invention was used to detect 50 goose tissue samples suspected of being infected with goose circovirus, and TaqMan qPCR was used for comparison. The results showed that the positive detection rate of the LAMP-CRISPR / Cas12a detection method established by the present invention was the same as that of TaqMan qPCR, which was 34% (17 / 50), indicating that the LAMP-CRISPR / Cas12a method is equivalent to TaqMan qPCR and can perform rapid on-site detection without expensive equipment.

[0048] The detection method established by the present invention does not require expensive thermal cyclers and is simple to operate, and can achieve the purpose of rapid visual detection. Compared with the TaqMan qPCR detection method, the detection method established by the present invention is more suitable for use at the grassroots level. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 is the result of LAMP primer screening and condition optimization; wherein, A: LAMP amplification result of primers shown in sequence SEQ ID NO.1-12,

[0050] Among them, LAMP-1 is primers F3-1, B3-1, FIP-1, BIP-1

[0051] The amplification results of the established amplification system, NTC-1 is the corresponding negative control; LAMP-2 is primers F3-2,

[0052] Amplification results of the amplification system established by B3-2, FIP-2, and BIP-2, and NTC-2 was the corresponding negative control;

[0053] LAMP-3 is the amplification result of the amplification system established with primers F3-3, B3-3, FIP-3, and BIP-3, and NTC-3 is the corresponding negative control.

[0054] B: LAMP incubation temperature optimization; C: LAMP incubation time optimization.

[0055] Figure 2 It is the crRNA screening result; A: Blue light and UV gel imaging system captures CRISPR / Cas12a reaction images under different crRNAs; B: Real-time fluorescence quantitative PCR instrument collects fluorescence intensity in real time under different crRNAs.

[0056] Figure 3 It is the optimization result of CRISPR / Cas12a-mediated cleavage experiment; A: CRISPR / Cas12a reaction image at different crRNA concentrations in blue light and ultraviolet gel imaging system; B: Real-time fluorescence quantitative PCR instrument observes fluorescence intensity and reaction rate at different crRNA concentrations; C: CRISPR / Cas12a reaction image at different Lba Cas12a concentrations in blue light and ultraviolet gel imaging system; D: Real-time fluorescence quantitative PCR instrument observes fluorescence intensity and reaction rate at different Lba Cas12a concentrations.

[0057] Figure 4 It is the specificity and sensitivity of CRISPR / Cas12a in detecting goose circovirus; wherein, A: CRISPR / Cas12a specific detection in blue light and ultraviolet gel imaging system; B: fluorescence intensity of CRISPR / Cas12a specific detection collected in real time by real-time fluorescence quantitative PCR instrument; C: CRISPR / Cas12a sensitivity detection image in blue light and ultraviolet gel imaging system; D: fluorescence intensity of sensitivity detection collected in real time by real-time fluorescence quantitative PCR instrument. DETAILED DESCRIPTION

[0058] The present invention is described in detail below with reference to the accompanying drawings and embodiments:

[0059] Main experimental materials: DNA / RNA extraction kit; 2×LAMP Master Mix; DNA Polymerase; Cas12a Reaction buffer (10×); crRNA; ssDNA; Lba Cas12a.

[0060] Main instruments: FQD-96A fluorescence quantitative PCR instrument; H203-100C dry constant temperature metal bath; nucleic acid electrophoresis instrument; gel imaging system.

[0061] Example 1 Design of LAMP primers and optimization of conditions

[0062] 1.1 Design of LAMP primers

[0063] The Cap sequence of goose circovirus was downloaded from the GenBank database, and the sequence was analyzed and aligned using MEGA 11 software. LAMP primers were designed based on the highly conserved region of the Cap gene. The primer sequences are shown in Table 1.

[0064] Table 1 LAMP primers

[0065]

[0066] 1.2 LAMP primer screening

[0067] The goose circovirus positive sample nucleic acid stored in this laboratory was used as a template, and ddH2O was set as a negative control. The LAMP primers in Table 1 were used, and the LAMP amplification system was configured according to Table 2. After the reaction system was prepared, it was rotated and mixed, then centrifuged, reacted in a metal bath at 65°C for 1 h, and inactivated at 80°C for 10 min. After the reaction, 9 μL of the sample was added to 1 μL of 10× Loading Buffer and subjected to 2% agarose gel electrophoresis.

[0068] Among them, the primer sets F3, B3, FIP, and BIP shown in Table 2 are F3-1, B3-1, FIP-1, BIP-1 or F3-2, B3-2, FIP-2, BIP-2 or F3-3, B3-3, FIP-3, and BIP-3, respectively. The above three primer sets were used to establish LAMP amplification systems for reaction, and corresponding negative control groups were established. The three LAMP amplification systems were named LAMP-1, LAMP-2, and LAMP-3, and the corresponding negative controls were named NTC-1, NTC-2, and NTC-3, respectively. The results are shown in FIG. Figure 1 As shown in A, the bands amplified by the third set of LAMP primers present the clearest waterfall-like bands, indicating that the LAMP-3 primers have the best effect. Therefore, the primers shown in the sequences SEQ ID NO.9-12 are selected as LAMP amplification primers, and the LAMP amplification conditions are optimized in the subsequent process.

[0069] Table 2 LAMP amplification system

[0070]

[0071] 1.3 Optimization of LAMP amplification system

[0072] The temperature and amplification time in the LAMP amplification system were optimized. The optimal LAMP amplification temperature was found to be 65°C ( Figure 1 B), time is 30 min ( Figure 1 C). The optimized best LAMP amplification system is as follows:

[0073]

[0074] Example 2 Establishment of LAMP-CRISPR / Cas12a detection system

[0075] 2.1 crRNA design

[0076] For the LAMP-3 amplification product sequence, find the detection site 20-23nt after PAM (TTTV, V is G, A or C). Add the scaffold sequence of Lba Cas12a (UAAUUUCUACUAAGUGUAGAU) to the target sequence, i.e. 20-23nt after the PAM sequence, and design 2 crRNAs as shown in Table 3.

[0077] Table 3 crRNA sequences

[0078]

[0079] The above LAMP amplification positive product was used as a template, and ddH2O was set as a negative control. The crRNA in Table 3 was used to perform CRISPR / Cas12a detection. The CRISPR / Cas12a detection system is shown in Table 4, where the ssDNA probe sequence is 5'-FAM-TTATT-BHQ-3', and the 5' end of the ssDNA probe is labeled with 6-FAM and the 3' end is labeled with BHQ-1. After the reaction system is prepared, shake and mix, then centrifuge, place in a fluorescent quantitative PCR instrument at 37°C, react for 10 min, read the fluorescence value data, compare the fluorescence intensity and reaction rate, and use a gel imaging system to observe the fluorescence using blue light to screen out the optimal crRNA. The results are shown in Figure 2 As shown in A and 2B, both crRNAs can activate the complex in the system to trans-cleave ssDNA and release fluorescent signals, thereby achieving on-site rapid visual detection of goose circovirus. Figure 2 As shown in B, the fluorescence signal value measured by the detection reaction solution of the crRNA-2 group is slightly higher than that of the crRNA-1 group, indicating that the fluorescence signal of the crRNA-2 group is stronger.

[0080] Table 4 Components of the test system

[0081]

[0082] Example 3 Optimization of LAMP-CRISPR / Cas12a detection system

[0083] In order to achieve rapid detection of the LAMP-CRISPR / Cas12a detection system, the concentrations of Cas12a and crRNA were optimized based on the above crRNA screening. The CRISPR / Cas12a detection experiment was carried out using the above LAMP amplification product as a template and sterilized ddH2O as a negative control. The reaction temperature was fixed at 37°C, and the final concentrations of crRNA and Lba Cas12a were 25, 50, 100, 150, and 200 nM, respectively. The reaction was carried out using a real-time fluorescence quantitative PCR instrument, and the fluorescence signal was collected every 30 seconds for 30 cycles, and then observed with blue light or ultraviolet light. By comparing the fluorescence intensity and reaction rate through the amplification curve, it was determined that the optimal final concentrations of crRNA and Lba Cas12a in the detection system were 50 nM ( Figure 3 A and 3B) and 150 nM ( Figure 3 C and 3D), the optimal LAMP-CRISPR / Cas12a detection system is shown in the following table.

[0084]

[0085] Example 4 Specificity and sensitivity test of LAMP-CRISPR / Cas12a detection method

[0086] In order to verify the specificity of the CRISPR / Cas12a detection method, the method established in this study was used to simultaneously detect goose circovirus (GoCV), duck circovirus (DuCV), duck plague virus (DPV), avian adenovirus type 4 (FAdV-4), duck hepatitis A virus type 3 (DHAV-3), duck Tembusu virus (DTMUV), and Muscovy duck parvovirus (MDPV), with ddH2O as a negative control.

[0087] The specific method of the specific experiment is:

[0088] (1) Extracting DNA from samples to be tested: extracting DNA from goose circovirus (GoCV), duck circovirus (DuCV), duck plague virus (DPV), avian adenovirus type 4 (FAdV-4), duck hepatitis A virus type 3 (DHAV-3), duck Tembusu virus (DTMUV), and Muscovy duck parvovirus (MDPV) to obtain DNA from samples to be tested;

[0089] (2) Using the DNA extracted in step (1) as a template, amplification was performed in a LAMP amplification system; wherein the total volume of the LAMP amplification system was 25 μL, 12.5 μL 2×LAMP Master Mix, 0.5 μL DNA Polymerase, 0.5 μL each of the outer primers F3-3 and B3-3, to a final concentration of 0.2 μM, 2 μL each of the inner primers FIP-3 and BIP-3, to a final concentration of 0.8 μM, 1 μL of the sample DNA to be tested, and ddH2O was added to 25 μL; the optimal LAMP amplification temperature was 65°C and the time was 30 min;

[0090] (3) The LAMP amplification product obtained in step (2) was subjected to enzyme digestion and fluorescence detection in the CRISPR / Cas12a detection system; wherein the total volume of the CRISPR / Cas12a detection system was 20 μL, including 2 μL of Cas12a Reaction buffer (10×), 1 μL of Lba Cas12a to a final concentration of 150 nM, 1 μL of crRNA-2 (1 μM) to a final concentration of 50 nM, 1.2 μL of ssDNA (4 μM) to a final concentration of 240 nM, 1 μL of LAMP amplification product, and ddH2O was added to 20 μL. The reaction temperature was fixed at 37°C.

[0091] The specific test results showed that only goose circovirus was positive, while other viruses and negative controls were not detected ( Figure 4 A, 4B), indicating that this method has high specificity.

[0092] To determine the sensitivity of this method, a pair of primers for amplifying the Cap gene fragment (upstream: 5'-CCGCTGGTAGTGGTTGTGAT-3', downstream: 5'-GCCTGGAAGCGATACCATCA-3') were designed based on the LAMP amplification fragment. The amplified fragment was about 240 bp and cloned into the pUC57 vector as a standard plasmid according to the conventional method and named pUC57-Cap. The copy number of the recombinant plasmid pUC57-Cap extracted from the positive clone was 2.43×10 9 Copies / μL. Dilute pUC57-Cap in 10-fold gradients, from 1×10 9 Copies / μL diluted to 1.0×10 -1 Copies / μL. 10-fold serial dilution of plasmid (1×10 9 ~1×10 -1Copies / μL) as a template and sterile ddH2O as a negative control, the detection was carried out under optimized conditions to verify the sensitivity of the detection method. The results of the sensitivity test showed that the detection limit of the detection method was 1×10 0 Copies / μL( Figure 4 C, 4D).

[0093] Example 5 Clinical sample testing

[0094] To further evaluate the clinical applicability of the LAMP-CRISPR / Cas12a detection method, the LAMP-CRISPR / Cas12a method established in this study (refer to the operation method of the specific experiment) was used to detect 50 goose tissue samples suspected of being infected with goose circovirus, and TaqMan qPCR was used for comparison. The results are shown in Table 5. The positive detection rate of the LAMP-CRISPR / Cas12a detection method established by the present invention is the same as that of TaqMan qPCR, which is 34% (17 / 50), indicating that the LAMP-CRISPR / Cas12a method is equivalent to TaqMan qPCR and can be used for rapid on-site detection without expensive equipment.

[0095] Table 5 Clinical sample test results

[0096]

[0097] From the above results, it can be seen that the LAMP-CRISPR / Cas12a detection system established using the LAMP primer set and crRNA of the present invention can achieve high specificity, sensitivity, visualization and rapid on-site detection of goose circovirus-positive samples, which is of great value for the detection and prevention and control of goose circovirus.

[0098] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A reagent combination for visual detection of goose circovirus based on LAMP-CRISPR / Cas12a, characterized in that: It includes LAMP amplification primers and crRNA; The LAMP amplification primers include an outer primer pair F3-3 and B3-3, and an inner primer pair FIP-3 and BIP-3; the nucleotide sequences of the outer primer pair F3-3 and B3-3 are respectively: F3-3: 5'-TGGTTGTGATGTGCCTCT-3', B3-3: 5'-GCCTGGAAGCGATACCATC-3'; The nucleotide sequences of the inner primers FIP-3 and BIP-3 are: FIP-3: 5'-GTCGAACTCCGTCCGGCATTTAATGTATGTGCTGCCTTGTGT-3', BIP-3: 5'-TTGGTTTCCTGTTCCCGGCACAGCCCCAAACCAGGAATT-3'; The crRNA is any one of crRNA-1 and crRNA-2, and the nucleotide sequences of crRNA-1 and crRNA-2 are respectively: crRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUCUGUUCCCGGCAAUCUGUCU-3' crRNA-2: 5'-UAAUUUCUACUAAGUGUAGAUCCAAUCGUAUCAUGUAGUAAUCG-3'.

2. The reagent combination according to claim 1, characterized in that: The crRNA is crRNA-2.

3. The reagent combination according to claim 1, characterized in that: It also includes a ssDNA probe, the nucleotide sequence of which is 5'-TTATT-3'.

4. A kit for visual detection of goose circovirus based on LAMP-CRISPR / Cas12a, characterized in that: The kit includes a LAMP amplification system and a CRISPR / Cas12a detection system; The LAMP amplification system includes an outer primer pair F3-3 and B3-3, and an inner primer pair FIP-3 and BIP-3; the nucleotide sequences of the outer primer pair F3-3 and B3-3 are respectively: F3-3: 5'-TGGTTGTGATGTGCCTCT-3', B3-3: 5'-GCCTGGAAGCGATACCATC-3'; The nucleotide sequences of the inner primer pair FIP-3 and BIP-3 are: FIP-3: 5'-GTCGAACTCCGTCCGGCATTTAATGTATGTGCTGCCTTGTGT-3', BIP-3: 5'-TTGGTTTCCTGTTCCCGGCACAGCCCCAAACCAGGAATT-3'; The CRISPR / Cas12a detection system includes crRNA, wherein the crRNA is any one of crRNA-1 and crRNA-2, and the nucleotide sequences of crRNA-1 and crRNA-2 are respectively: crRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUCUGUUCCCGGCAAUCUGUCU-3' crRNA-2: 5'-UAAUUUCUACUAAGUGUAGAUCCAAUCGUAUCAUGUAGUAAUCG-3'.

5. The kit according to claim 4, characterized in that: The crRNA is crRNA-2.

6. The kit according to claim 4, characterized in that: The LAMP amplification system also includes 2×LAMP Master Mix, DNA Polymerase, ddH2O, samples to be tested, and negative and positive control samples.

7. The kit according to claim 4, characterized in that The CRISPR / Cas12a detection system also includes Cas12a Reaction buffer (10×), Lba Cas12a, LAMP amplification product, ssDNA probe and ddH2O.

8. The kit according to claim 7, characterized in that: The nucleotide sequence of the ssDNA probe is 5'-TTATT-3'.

9. Use of the kit as claimed in claim 8 in the detection of goose circovirus for non-diagnostic purposes.

10. The use according to claim 9, characterized in that: The method for visually detecting goose circovirus using the kit comprises the following steps: (1) Extract DNA from the sample to be tested; (2) using the DNA extracted in step (1) as a template, amplifying in a LAMP amplification system; (3) performing enzyme digestion and fluorescence detection on the LAMP amplification product obtained in step (2) in a CRISPR / Cas12a detection system; The total volume of the LAMP amplification system is 25 μL, 12.5 μL 2×LAMP Master Mix, 0.5 μL DNA Polymerase, 0.5 μL each of the outer primers F3-3 and B3-3, to a final concentration of 0.2 μM, 2 μL each of the inner primers FIP-3 and BIP-3, to a final concentration of 0.8 μM, 1 μL of the sample DNA to be tested, and ddH2O supplemented to 25 μL; The total volume of the CRISPR / Cas12a detection system is 20 μL, including 2 μL of Cas12a Reaction buffer (10×), 1 μL of Lba Cas12a to a final concentration of 150 nM, 1 μL of crRNA-2 (1 μM) to a final concentration of 50 nM, 1.2 μL of ssDNA (4 μM) to a final concentration of 240 nM, 1 μL of LAMP amplification product, and ddH2O is supplemented to 20 μL.

Images