RT-qPCR specific detection primer for JMTV, RT-qPCR detection method and application

Abstract

The invention discloses an RT-qPCR specific detection primer for JMTV, an RT-qPCR detection method and application, and belongs to the technical field of virus detection. The RT-qPCR specific detection primer for the JMTV comprises a forward primer JMTV-q-F and a reverse primer JMTV-q-R, wherein the forward primer JMTV-q-F and the reverse primer JMTV-q-R are used for detecting the JMTV; the sequence of the forward primer JMTV-q-F is as follows: GAGGGAGATTGAAGGTGAGG, and the sequence of the reverse primer JMTV-q-R is as follows: GCCATTCCGTATGTAGTCGTTA, and the sequence of the forward primer JMTV-q-F is as follows: GAGGGAGATTGGAAGGTGAGG; the length of a PCR (Polymerase Chain Reaction) product obtained by adopting the forward primer JMTV-q-F and the reverse primer JMTV-q-R is 844bp. The specific detection primer, the detection method and the application provided by the invention can be used for rapidly detecting and identifying the vitex virus, are high in detection sensitivity, can be used for detecting low-content viruses, have excellent detection specificity and are accurate and reliable in detection result, and the lowest detectable concentration is 10copies / mu L of cDNA (Complementary Deoxyribose Nucleic Acid).

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and in particular to an RT-qPCR specific detection primer, an RT qPCR detection method and an application of Jingmen tick virus (JMTV). Background Art

[0002] Since the Jingmen tick virus (JMTV) was first detected in ticks in 2014, the virus has been found in many continents around the world, and the virus has a wide range of hosts, including ticks, bats, mice, etc. In China, JMTV has been detected in many regions, and related human infection cases have been reported, with the main symptoms being fever and headache.

[0003] Existing technologies mainly use ordinary PCR methods for detection, which has insufficient detection sensitivity, and there is no RT-qPCR method with higher sensitivity. Summary of the invention

[0004] In order to solve the above problems, the present invention proposes a RT-qPCR specific detection primer, RT qPCR detection method and application of JMTV, which can quickly and accurately detect Jingmen tick virus.

[0005] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0006] A JMTV RT-qPCR specific detection primer, comprising a forward primer JMTV-qF and a reverse primer JMTV-qR;

[0007] The sequence of the forward primer JMTV-qF is: GAGGGAGATTGAAGGTGAGG

[0008] The sequence of the reverse primer JMTV-qR is: GCCATTCCGTATGTAGTCGTTA;

[0009] The length of the PCR product obtained by using the forward primer JMTV-qF and the reverse primer JMTV-qR is 844 bp.

[0010] The present invention also discloses a RT-qPCR detection method for JMTV, comprising the following steps:

[0011] (1) extracting total RNA from ticks infected with JMTV and synthesizing cDNA from the total RNA;

[0012] (2) using the cDNA obtained in step 1 as a template, and using the RT-qPCR specific detection primers described in claim 1 to perform conventional PCR amplification on the cDNA obtained in step (1) to obtain a PCR product;

[0013] (3) obtaining a plasmid sample according to the PCR product obtained in step (2);

[0014] (4) Performing RT-qPCR detection using the plasmid sample obtained in step (3) as a template to obtain a standard curve, and determining whether the sample contains JMTV virus and obtaining its content based on the standard curve.

[0015] Furthermore, the length of the PCR product in step (2) is 844 bp.

[0016] Furthermore, the amplification system of the conventional PCR amplification in step (2) is:

[0017] Extaq: 12.5 μL; forward primer JMTV-qF: 0.5 μL; reverse primer JMTV-qR: 0.5 μL; cDNA obtained in step (1): 1 μL; conventional PCR reaction buffer: 5.5 μL; enzyme-free deionized water was added to make the total volume of the amplification system 25 μL;

[0018] The amplification conditions were as follows: pre-denaturation temperature 95°C, duration 5 minutes; denaturation temperature 985°C, duration 30 seconds; annealing temperature 51°C, duration 1 minute; extension temperature 72°C, duration 1 minute; re-extension temperature 72°C, duration 5 minutes; the number of cycles was 30.

[0019] Furthermore, the reaction system for RT-qPCR detection in step (4) is: 2× real-time quantitative PCR amplification premix solution: 10uL; forward primer JMTV-qF: 0.8μL; reverse primer JMTV-qR: 0.8μL; cDNA template: 1uL; enzyme-free deionized water is added to the total volume of the reaction system to 20μL;

[0020] The reaction program was: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds; annealing at 55°C for 30 seconds, for 40 cycles.

[0021] Further, the detailed steps of step (1) for synthesizing cDNA are as follows:

[0022] s1. Remove residual genomic DNA; add 24 μL of mixed tick RNA and 6 μL of genomic DNA removal reagent (5×gDNA Eraser Buffer) to a 200 μL centrifuge tube, and mix gently with a pipette. Incubate at 42°C for 2 min;

[0023] s2. After the incubation is completed, immediately transfer the EP tube to an ice block and incubate for 5 minutes;

[0024] s3. Add 10 μL of reverse transcription reaction mixture (2×HifairTM Super Mix plus) to the above system, gently pipette to mix, centrifuge briefly, place the EP tube in a PCR instrument, incubate at 25°C for 5 min, incubate at 42°C for 30 min, and incubate at 85°C for 5 min. After the reaction is completed, cDNA is obtained.

[0025] Furthermore, the RT-qPCR test in step (4) is provided with a positive control group and a negative control group, wherein the positive control group is a sample from which the whole genome of JMTV has been obtained; and the negative control group is enzyme-free deionized water.

[0026] The present invention also protects the use of a RT-qPCR specific detection primer of JMTV in detecting Jingmen tick virus.

[0027] Furthermore, RT-qPCR specific detection primers containing JMTV were added to the kit to prepare a JMTV quantitative PCR detection kit and a JMTV conventional PCR detection kit.

[0028] The RT-qPCR specific detection primers, RT qPCR detection method and application of JMTV of the present invention have the beneficial effects that: the specific detection primers, detection method and application provided by the present invention can be used for rapid detection and identification of Jingmen tick virus, with high detection sensitivity, the lowest detectable concentration is 10 copies / μL of cDNA, can be used for detection of low-content viruses, and have excellent detection specificity, and the detection results are accurate and reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0030] Figure 1 It is the electrophoresis diagram of the amplified JMTV1-3 sequence of the present invention;

[0031] Figure 2 is the amplification curve of JMTV-q of the present invention;

[0032] Figure 3 It is the standard curve of JMTV-q of the present invention.

[0033] Figure 4 This is the specific detection result of JMTV-q of the present invention. DETAILED DESCRIPTION

[0034] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Example 1

[0036] A RT-qPCR specific detection primer for JMTV, the design method and identification process of the specific detection primer are as follows:

[0037] Design method: Based on the base sequence of the RNA-dependent RNA polymerase gene-specific region in the JMTV genome (OR036990.1) in the NCBI database, the Primer5.0 and primer-BLAST online software were used to design specific primers for RT-qPCR detection of JMTV.

[0038] JMTV-qF: GAGGGAGATTGAAGGTGAGG;

[0039] JMTV-qR:GCCATTCCGTATGTAGTCGTTA.

[0040] Identification process: Total RNA from JMTV-infected ticks was extracted using the Trizol method

[0041] ① After disinfecting and cleaning the tick samples, grind them at low temperature, and centrifuge the obtained tick tissue grinding solution in a low-temperature centrifuge at 4°C and 12000rpm for 20min;

[0042] ②After centrifugation, the tick tissue is precipitated at the bottom of the centrifuge tube. Carefully pipette 200 μL of the supernatant into a new 1.5 mL tube, add 700 μL of Trizol and shake to mix;

[0043] ③ Place at room temperature (10-30°C) for 10 minutes to fully lyse the sample;

[0044] ④ After lysis for 10 minutes, add 200 μL of chloroform to the tube and use a vortex shaker to fully shake for 30 seconds. Centrifuge at 4°C and 12,000 rpm for 20 minutes;

[0045] ⑤ After centrifugation, the EP tube is divided into three layers of liquid (RNA, DNA, and protein from top to bottom). Carefully pipette the top aqueous phase into a new EP tube;

[0046] ⑥ Add an equal amount of isopropanol, shake and mix manually, place at room temperature for 10 minutes, and then centrifuge at 12000 rpm for 10 minutes;

[0047] ⑦Discard the supernatant, add 1mL75% ethanol, shake and wash, and centrifuge at 7500rpm for 5min;

[0048] ⑧ Pour off as much supernatant as possible and place the EP tube to air dry at room temperature;

[0049] ⑨ Dissolve the RNA precipitate with 24 μL RNase-free water. RNA can be used immediately for subsequent experiments or stored in a -80℃ refrigerator.

[0050] Example 2

[0051] A RT-qPCR detection method for JMTV comprises the following steps:

[0052] 1. Reverse transcription to synthesize cDNA;

[0053] Tick ​​total RNA extract was used to obtain cDNA using Hifair 1st Strand cDNA Synthesis Super Mix for qPCR (gDNA digester plus) with the following steps:

[0054] ① Remove residual genomic DNA; add 24 μL of tick RNA and 6 μL of 5×gDNA Eraser Buffer to a 200 μL RNase free centrifuge tube, and mix gently with a pipette. Incubate at 42°C for 2 min;

[0055] ②After the incubation is completed, immediately transfer the EP tube to an ice block and incubate for 5 minutes;

[0056] ③ Add 2×HifairTM Super Mix plus 10μL to the above system, mix gently with a pipette, centrifuge briefly, place the EP tube in a PCR instrument, incubate at 25℃ for 5min, 42℃ for 30min, and 85℃ for 5min to obtain cDNA. Store at -20℃ for later use.

[0057] 2. According to the JMTV genome (OR036990.1), use Primer5.0 to design specific PCR amplification primers for the fragment where the qPCR primer is located. The size is 844bp and sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis. PCR amplification was performed using tick cDNA as an amplification template. In each PCR test, a sample of the JMTV full genome obtained in the laboratory was used as a positive control, and ddH2O was used as a negative control. The amplification system is shown in Table 1, the reaction system is shown in Table 2, and the denaturation-annealing-extension is performed for 30 cycles;

[0058] JMTV1-3-F: GAGATGGCCTCGGCGATAAA;

[0059] JMTV1-3-R:TCACCAGTCCCATGTCGTTG.

[0060] Table 1 Amplification system

[0061]

[0062] Table 2 Amplification conditions

[0063]

[0064] 3. Agarose gel electrophoresis of PCR products

[0065] ① Preparation of 1×TAE buffer: weigh 48.4g Tris, 7.44g Na2EDTA.2H2O, and 11.42g acetic acid into a 1L beaker; put a clean magnetic stirring bar into the beaker, place it on a magnetic stirrer and stir until the solution is completely clear, then add 9L of deionized water to dilute it to 1×TAE and store it in a 10L storage barrel for later use.

[0066] ②Prepare 1.0% agarose gel: weigh 0.5g agarose powder with an electronic analytical balance and put it into a conical flask, then add 50mL of 1×TAE buffer and heat it in a microwave oven for about 1-3 minutes until the agarose is completely dissolved. During heating, pay attention to the boiling of the liquid to avoid splashing. After heating, add 5μL of 4S Green nucleic acid dye to the agarose cooled to about 60°C and shake to mix. Insert the comb into the gel container and pour the agarose gel quickly and evenly into a stable container to avoid uneven gel thickness. Wait for the gel to completely solidify before use.

[0067] ③ Nucleic acid gel electrophoresis: Add 1×TAE buffer to the electrophoresis tank to immerse the agarose gel. Take 5μL of PCR product and 1μL of 6×loading buffer and mix thoroughly, add 5μL of the mixed product to the sample well, and reserve a well to add 5μL DLMarker2000 as a reference, and finally add negative control and positive control.

[0068] ④After the sample is added, set the electrophoresis voltage to 120V and the time to 30 minutes. Finally, adjust the gel position and size in the gel imager, start the gel imaging system, select the corresponding staining agent option, and observe the position of the electrophoresis band, such as Figure 1 shown.

[0069] 4. Use the Mini BEST Agarose Gel DNA Extraction Kit Ver.4.0 to recover the target band

[0070] ① Under ultraviolet light, cut the target band with a clean blade and put it into a 1.5mL centrifuge tube. Add 3 times the volume of gel dissolving solution Buffer GM into the centrifuge tube, and then put it into a 37℃ water bath to dissolve the gel for 10 minutes. During this period, turn it upside down every 3 minutes to help dissolve it.

[0071] ② When the gel is completely dissolved, observe the color of the sol solution. If the color of the sol solution changes from yellow to orange or pink, add 10 μl of 3M sodium acetate solution (pH 5.2) to the above gel block solution and mix evenly until the solution returns to yellow.

[0072] ③ Place the Spin Column in the kit on the Collection Tube.

[0073] ④ Transfer the solution from step 7 above to the Spin Column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate.

[0074] ⑤ Add 700 μl of Buffer WB to the Spin Column, centrifuge at 12,000 rpm for 30 seconds at room temperature, and discard the filtrate.

[0075] ⑥Repeat step ⑤.

[0076] ⑦ Place the Spin Column on the Collection Tube and centrifuge at 12,000 rpm for 1 minute at room temperature.

[0077] ⑧ Place the Spin Column in a new 1.5 ml centrifuge tube, add 30 μl of sterile distilled water or Elution Buffer to the center of the Spin Column membrane, and let it stand at room temperature for 1 minute.

[0078] ⑨ Centrifuge at 12000rpm for 1min for elution. After completion, store the obtained target band in a -20℃ refrigerator.

[0079] 5. The gel-recovered products were subjected to ligation cloning using TakaRapMDTM18-T Vector and E.coLiDH-5α cells.

[0080] ① Add 1uL of pMD18-TVector and 4uL of gel recovery product to a 1.5mL centrifuge tube, then add 5uL of SoLution I, the total volume is 10μL, mix well and centrifuge instantly, and connect at 4℃ overnight.

[0081] ② Add the ligation product to 100 μL of DH5α competent cells, gently pipette to mix, place on ice for 30 min, heat shock at 42°C for 90 s, ice bath for 2 min, add 1 mL of LB culture medium and shake and culture at 37°C, 220 rpm for 2 h.

[0082] ③ After cultivation, centrifuge and discard 900 μL of supernatant. Keep 100 μL and mix by pipetting. Spread the bacterial solution on LB solid culture medium plate and culture for 12 hours. Pick out single clone and perform PCR identification.

[0083] ④ Take the positive clone and inoculate it into 5 mL LB medium, and culture it in a 37℃ shaking incubator (250 r / min) for 16 h.

[0084] 6. Plasmid extraction

[0085] ① Centrifuge 5 mL of overnight culture at 12000 g for 5 min, discard the supernatant and collect the bacterial precipitate.

[0086] ② Add 250 μL of solution P1 and vortex until the bacteria are completely suspended.

[0087] ③ Add 250 μL of solution P2 to the centrifuge tube and gently invert it upside down 6-8 times to fully lyse the bacteria.

[0088] ④ Add 350 μL P3 to the centrifuge tube and immediately and gently invert it upside down 6-8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min.

[0089] ⑤ Transfer the supernatant to the adsorption column CP3, and be careful not to absorb the precipitate. Centrifuge at 12000rpm for 1min, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.

[0090] ⑥ Add 600 μL of rinsing solution PW to the adsorption column CP3 (check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.

[0091] ⑦Repeat step ⑥

[0092] ⑧Place the adsorption column CP3 into the collection tube and centrifuge at 12000rpm for 2min to remove the residual rinse solution in the adsorption column.

[0093] ⑨ Place the adsorption column CP3 in a clean centrifuge tube, add 50-100 μL of elution buffer EB to the middle part of the adsorption membrane, place it at room temperature for 2 minutes, and centrifuge it at 1200 rpm for 2 minutes to collect the plasmid solution into the centrifuge tube.

[0094] ⑩ Store the obtained plasmid in a -20℃ refrigerator.

[0095] 7. Preparation of standard positive template: Use NANODROP ONE ultra-micro spectrophotometer to measure the plasmid concentration and calculate the copy number according to the following formula:

[0096] Double-stranded DNA copy number (copies / μL) = (6.02×1023 (copies / mol))×(plasmid concentration (ng / μL)×10-9) / (DNA length×660)

[0097] The plasmid was diluted to 10^9 (copies / μL), and then diluted 10-fold to 10^8, 10^7, 10^6, 10^5, 10^4, 10^3, 10^2, 10^1, 10^0 (copies / μL) to prepare a standard positive plasmid template.

[0098] 8. Establishment of JMTV-qPCR standard curve:

[0099] The qRT-PCR method was used to detect JMTV. The different primer concentrations and reaction steps were optimized, and the optimal reaction system was finally determined as shown in Table 3.

[0100] Table 3 qPCR reaction system

[0101]

[0102]

[0103] The reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds; annealing at 55°C for 30 seconds, for 40 cycles.

[0104] After the reaction is completed, a standard curve is obtained, and the amplification curve is as follows Figure 2 The standard curve is as follows: Figure 3 As shown in the figure, as the concentration of the positive plasmid template gradually decreased, the Ct value showed an increasing trend and had a good linear relationship with the concentration of the plasmid standard, with the lowest detection of 10 copies / μL. The slope of the standard curve was -3.2839, and the determination coefficient R 2 =0.9973, the amplification efficiency is 101.61%, and the linear equation is y=-3.2839x+39.886. This standard curve will be used to determine the JMTV content in the sample to be tested.

[0105] Example 3

[0106] Application of a JMTV specific RT-qPCR detection primer in the detection of Jingmen tick virus (JMTV)

[0107] The JMTV-qPCR specificity test used the laboratory's existing JMTV positive plasmid, Japanese encephalitis virus cDNA, Geta virus cDNA, 2 JMTV positive tick samples and 1 JMTV negative tick sample (verified by previous high-throughput sequencing) as templates, and the JMTV-qPCR specificity test was performed using the method of Example 2. The results are shown in Figure 4 Except for the JMTV-positive plasmid and two JMTV-positive tick samples, which had typical amplification curves, the others were all negative, and the melting curves were all single-peaked, indicating that this detection method has excellent specificity.

[0108] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present invention. The appearance of the phrase in various places in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0109] Finally, it should be noted that the embodiments disclosed in the present invention are only preferred embodiments of the present invention, which are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A RT-qPCR specific detection primer for JMTV, characterized in that: Includes forward primer JMTV-qF and reverse primer JMTV-qR; The sequence of the forward primer JMTV-qF is: GAGGGAGATTGAAGGTGAGG The sequence of the reverse primer JMTV-qR is: GCCATTCCGTATGTAGTCGTTA; The length of the PCR product obtained by using the forward primer JMTV-qF and the reverse primer JMTV-qR is 844 bp.

2. A RT-qPCR detection method, characterized in that: The following steps are involved: (1) extracting total RNA from ticks infected with JMTV and synthesizing cDNA from the total RNA; (2) using the cDNA obtained in step 1 as a template, and using the RT-qPCR specific detection primers described in claim 1 to perform conventional PCR amplification on the cDNA obtained in step (1) to obtain a PCR product; (3) obtaining a plasmid sample according to the PCR product obtained in step (2); (4) Performing RT-qPCR detection using the plasmid sample obtained in step (3) as a template to obtain a standard curve, and determining whether the sample contains JMTV virus and obtaining its content based on the standard curve.

3. A RT-qPCR detection method according to claim 2, characterized in that: The length of the PCR product in step (2) is 844 bp.

4. A RT-qPCR detection method according to any one of claims 2-3, characterized in that: The amplification system of the conventional PCR amplification in step (2) is: Extaq: 12.5 μL; forward primer JMTV-qF: 0.5 μL; reverse primer JMTV-qR: 0.5 μL; cDNA obtained in step (1): 1 μL; conventional PCR reaction buffer: 5.5 μL; enzyme-free deionized water was added to make the total volume of the amplification system 25 μL; The amplification conditions were as follows: pre-denaturation temperature 95°C, duration 5 minutes; denaturation temperature 985°C, duration 30 seconds; annealing temperature 51°C, duration 1 minute; extension temperature 72°C, duration 1 minute; re-extension temperature 72°C, duration 5 minutes; the number of cycles was 30.

5. A RT-qPCR detection method according to any one of claims 2-3, characterized in that: The reaction system for RT-qPCR detection in step (4) is: 2× real-time quantitative PCR amplification premix solution: 10uL; forward primer JMTV-qF: 0.8μL; reverse primer JMTV-qR: 0.8μL; cDNA template: 1uL; enzyme-free deionized water is added to the total volume of the reaction system to 20μL; The reaction program was: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 10 seconds; annealing at 55°C for 30 seconds, for 40 cycles.

6. A RT-qPCR detection method according to any one of claims 2-3, characterized in that: The detailed steps of step (1) cDNA synthesis are as follows: s1. Remove residual genomic DNA; add 24 μL of mixed tick RNA and 6 μL of genomic DNA removal reagent (5×gDNA Eraser Buffer) to a 200 μL centrifuge tube, and mix gently with a pipette. Incubate at 42°C for 2 min; s2. After the incubation is completed, immediately transfer the EP tube to an ice block and incubate for 5 minutes; s3. Add 10 μL of reverse transcription reaction mixture (2×HifairTM Super Mix plus) to the above system, gently pipette to mix, centrifuge briefly, place the EP tube in a PCR instrument, incubate at 25°C for 5 min, incubate at 42°C for 30 min, and incubate at 85°C for 5 min. After the reaction is completed, cDNA is obtained.

7. A RT-qPCR detection method according to any one of claims 2-3, characterized in that: The RT-qPCR test in step (4) is provided with a positive control group and a negative control group. The positive control group is a sample from which the whole genome of JMTV has been obtained; and the negative control group is enzyme-free deionized water.

8. Use of the RT-qPCR specific detection primers of JMTV as claimed in claim 1 in detecting Jingmen tick virus.

Images