ECL biosensor and application thereof in detecting miR-21
By combining multi-stage signal amplification strategy and CRISPR/Cas13a cleavage mechanism in ECL biosensors, the problem of detecting miR-21 at extremely low concentrations is solved, high sensitivity and high specificity detection is achieved, and excellent applicability is shown in complex biological samples.
Patent Information
- Application Number
- CN202510278835.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-05-13
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The prior art is difficult to accurately detect miR-21 at very low concentrations, and traditional methods have limited applicability in complex biological samples.
A multi-stage signal amplification strategy is adopted, combined with bond-mediated strand substitution (TMSD), T7 RNA polymerase amplification and CRISPR/Cas13a cleavage mechanism, and ultra-sensitive detection of miR-21 is achieved through ECL biosensors.
Clear and measurable signals can be obtained at extremely low concentrations (fM level), which achieves high sensitivity and specificity detection of miR-21, and shows high anti-interference ability and good repeatability in complex biological samples.
Smart Images
Figure CN119985650A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of electrochemical biosensors, and particularly relates to an ECL biosensor, and further discloses the application of the ECL biosensor in detecting miR-21. Background Art
[0002] miRNAs are small noncoding RNAs that play a key role in regulating gene expression and are involved in a variety of physiological and pathological processes, including cancer, cardiovascular disease, or immune response. Among the numerous miRNAs, miR-21 has received special attention due to its dysregulated expression in a variety of diseases such as cancer, cardiovascular conditions, and inflammatory diseases. Therefore, accurate and sensitive detection of miR-21 is crucial for early disease diagnosis, treatment monitoring, and understanding of disease mechanisms. However, the low abundance and short sequences of miRNAs in biological samples pose significant challenges to traditional detection methods, which requires the development of advanced biosensing strategies.
[0003] Electrochemiluminescence (ECL)-based biosensors have emerged as a powerful tool for biomolecule detection, offering high sensitivity, excellent dynamic range, and compatibility with miniaturized platforms. Moreover, since ECL avoids the issues of photobleaching and high background signals associated with fluorescence techniques, it enables accurate and reliable detection even at low target concentrations. Furthermore, combining ECL with an amplification mechanism can significantly improve detection performance, making it the technology of choice for miRNA biosensing. Summary of the invention
[0004] To this end, the technical problem to be solved by the present invention is to provide an ECL biosensor, which uses a multi-stage signal amplification strategy, combined with lock-and-key mediated strand displacement (TMSD), T7 RNA polymerase amplification and CRISPR / Cas13a cleavage mechanism, so that a clear and measurable signal can be obtained even at extremely low concentrations (fM level), thereby achieving ultrasensitive detection of miR-21;
[0005] The second technical problem to be solved by the present invention is to provide the application of the above-mentioned ECL biosensor in detecting miR-21.
[0006] The third technical problem to be solved by the present invention is to provide a method for detecting miR-21 based on the ECL biosensor, which has the advantages of high sensitivity and good specificity.
[0007] To solve the above technical problems, the ECL biosensor for detecting miR-21 described in the present invention includes a working electrode, a T7 RNA polymerase transcription system and a CRISPR / Cas13a reaction system.
[0008] Specifically, the ECL biosensor for detecting miR-21, the working electrode comprises:
[0009] (1) AuNPs / Ti3C2Tx / Ru(II)-PEI material modified electrode;
[0010] (2) the DNA1 probe labeled with iron oxide (Fc) is anchored on the surface of the working electrode;
[0011] Preferably, the sequence of the DNA1 probe is as follows: Fc-TTTTTTTTTTTrUrUTTTTTTTT-SH;
[0012] Preferably, the electrode comprises a glassy carbon electrode.
[0013] Specifically, the ECL biosensor for detecting miR-21, the T7 RNA polymerase transcription system includes a degradation reaction system and an amplification reaction system; wherein,
[0014] The degradation reaction system comprises: a PG probe, a λ-Exo enzyme, and a degradation reaction buffer;
[0015] The amplification reaction system comprises NTPs, T7 RNA polymerase, DNA template, RNase inhibitor and RNA Pol reaction buffer.
[0016] As an exemplary embodiment, the RNase inhibitor can be selected from conventional products in the art, such as depc and / or rnase enzymes.
[0017] Specifically, in the ECL biosensor for detecting miR-21, in the T7 RNA polymerase transcription system, the PG probe includes four single-stranded DNAs: T7-a, T7-b, P1, and P2; wherein,
[0018] The sequence of T7-a is as follows: AACGAGACTG TT TAATACGACTCACTATAGGG;
[0019] The sequence of T7-b is as follows: CTACCTGCACTGTAAGCACTTTG CCCTATAGTGAGTCGTATTATTCGTC ACTCCA;
[0020] The sequence of P1 is as follows: TGGAGTGACGTAGCTTATCAGACTCAGTCTCGTT;
[0021] The sequence of P2 is as follows: p-TCAACATCAGTCTGATAAGCTA.
[0022] Specifically, as an exemplary scheme that can be implemented, the preparation of the nucleic acid probe first mixes four single-stranded DNAs (T7-a, T7-b, P1, P2) at a concentration of 10±0.2 mM in PBS buffer (pH 7.4±0.2), heats at 95±5°C for 5±2 minutes, and then slowly cools to room temperature to form a double-stranded PG probe with a predetermined conformation.
[0023] Specifically, as an exemplary scheme that can be implemented, the degradation reaction system includes: mixing 2±0.2μM PG probe, 5±0.2U / μL λ-Exo enzyme (100±20μL), 1× reaction buffer (10-20μL) with different concentrations of miR-21, and adding DEPC water to 100μL, and incubating at 37±2°C for 30±10 minutes to allow miR-21 to bind to the probe and trigger a degradation reaction.
[0024] Specifically, as an exemplary scheme that can be implemented, the amplification reaction system includes: in a 100 μL amplification system, including 40±0.2 μM NTPs, 30±0.2U T7 RNA polymerase, 1±0.2 μM DNA template, 20±0.2U RNase inhibitor and 2±0.2 μL 10×RNAPol reaction buffer, incubating at 37±2°C for 40±10 minutes to perform RNA amplification.
[0025] Specifically, the ECL biosensor for detecting miR-21, the CRISPR / Cas13a reaction system includes Cas13a protein, crRNA and Cas13a reaction buffer;
[0026] Preferably, the sequence of the Cas13a protein is as follows: CAAAGUGCUUACAGUGCAGGUAG;
[0027] Preferably, the sequence of the crRNA is as follows: GACCACCCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG.
[0028] Specifically, as an exemplary scheme that can be implemented, in the CRISPR / Cas13a reaction system, the amplification product is introduced into the CRISPR / Cas13a system, and the transcription product is mixed with 10±0.2nM Cas13a protein, 15±0.2nMcrRNA and 1×NEBuffer (NEB) in this step, and incubated at room temperature for 20±5 minutes to activate the Cas13a system to cleave the DNA reporter probe to obtain the desired activation system.
[0029] The present invention also discloses a method for constructing the ECL biosensor for detecting miR-21, comprising the steps of constructing the working electrode, and dispensing and preparing the T7 RNA polymerase transcription system and the CRISPR / Cas13a reaction system;
[0030] Preferably, the steps of constructing the working electrode include:
[0031] The AuNPs / Ti3C2Tx / Ru(II)-PEI material is mixed with a film-forming solution and then coated on the surface of the electrode, and after film formation, an electrode modified with the AuNPs / Ti3C2Tx / Ru(II)-PEI material is obtained;
[0032] The modified electrode is immersed in a solution containing the DNA1 for incubation and fixation, and a thiol blocking agent is added dropwise to the surface of the electrode for reaction to obtain the modified electrode.
[0033] As an exemplary embodiment, the thiol blocking agent may be selected from conventional 6-mercapto-1-hexanol (MCH) in the art.
[0034] As an exemplary implementation, in the construction process of the working electrode in the ECL sensor of the present invention, the electrode modification process first cleans the electrode to remove surface impurities and improve material adhesion, and then ultrasonically treats with ethanol and deionized water in sequence, and blows dry with nitrogen to ensure surface cleanliness. Subsequently, the synthesized AuNPs / Ti3C2Tx / Ru(II)-PEI material is mixed with 0.5±0.2% Nafion solution and ultrasonically treated for 20±10 minutes to obtain a uniformly dispersed suspension. Take 10±5μL of the mixture and evenly drop it on the GCE surface, dry it naturally at room temperature to form a stable functionalized film, which provides a basis for the subsequent fixation of nucleic acid probes.
[0035] During the probe fixation process, the modified electrode was immersed in a 1±0.5μM DNA1 solution and incubated for 10±2 hours to allow DNA1 to bind to the electrode surface through Au-S bonds to achieve specific fixation. Subsequently, 8±2μL of 1±0.2mM 6-mercapto-1-hexanol (MCH) solution was added to the electrode surface to fill the residual AuNPs binding sites, prevent nonspecific adsorption, and enhance the stability of the DNA probe, laying the foundation for efficient nucleic acid detection.
[0036] Specifically, in the method for constructing the ECL biosensor for detecting miR-21, the step of constructing the working electrode further includes the step of synthesizing the AuNPs / Ti3C2Tx / Ru(II)-PEI material;
[0037] Preferably, the synthesis steps of the AuNPs / Ti3C2Tx / Ru(II)-PEI material include:
[0038] In a buffer system, Ru(II), Ti3C2Tx and PEI were added to react to obtain Ti3C2Tx / Ru(II)-PEI;
[0039] The Au source material is mixed with a reducing agent and an alkaline solution is added to react to obtain AuNPs nanoparticles;
[0040] The AuNPs are added into the Ti3C2Tx / Ru(II)-PEI solution to react and obtain the desired AuNPs / Ti3C2Tx / Ru(II)-PEI material.
[0041] As an exemplary implementation, the synthesis steps of the AuNPs / Ti3C2Tx / Ru(II)-PEI material include:
[0042] Dissolve Ru(II) (preferably Ru(bpy)3) in PBS buffer. 2+ ) and adding EDC and NHS to mix, and adding Ti3C2Tx and PEI solution to obtain Ti3C2Tx / Ru(II)-PEI;
[0043] HAuCl solution was mixed with NaBH solution, and sodium citrate solution was added to react to obtain nanoparticles AuNPs;
[0044] The AuNPs are added into the Ti3C2Tx / Ru(II)-PEI solution to react and obtain the desired AuNPs / Ti3C2Tx / Ru(II)-PEI material.
[0045] It should be noted that, during the entire synthesis process, there is no special requirement for the amount of Ru(II), Ti3C2Tx and PEI added for the reaction. A polymerization reaction can occur in the presence of trace amounts of the three to form the desired Ti3C2Tx / Ru(II)-PEI.
[0046] As an exemplary implementation, the synthesis process of the AuNPs / Ti3C2Tx / Ru(II)-PEI material of the present invention is firstly performed by dissolving 10±2mg Ru(II) in PBS buffer and adding 400±100mM EDC and NHS, and activating the carboxyl group after ultrasonic treatment for 2±1 hours to promote the formation of amide bonds with polyethyleneimine (PEI). Subsequently, 5±2mg Ti3C2Tx and 5±2mg / mL PEI solution are added to the solution, and the solution is stirred for 30±10 minutes and then ultrasonicated for 2±1 hours to ensure the stable binding of Ru(II) to Ti3C2Tx / PEI.
[0047] As an exemplary implementation, the synthesis process of the AuNPs / Ti3C2Tx / Ru(II)-PEI material of the present invention, the synthesis of the gold nanoparticles (AuNPs) is to slowly add 30±10μL of freshly prepared 0.01±0.005M NaBH solution to 400±100μL of 1.0±0.2% HAuCl solution in an ice water bath for reduction, and at the same time, add 30±10μL of 0.01±0.005M sodium citrate solution dropwise, and keep stirring for 40±10 minutes to ensure the stable formation of AuNPs.
[0048] As an exemplary implementation, the synthesis process of the AuNPs / Ti3C2Tx / Ru(II)-PEI material of the present invention is to slowly add the synthesized AuNPs to the Ti3C2Tx / Ru(II)-PEI solution and perform ultrasonic treatment for 2±1 hours to achieve uniform binding. The unreacted products and impurities are removed by centrifugation and PBS washing to obtain a high-purity AuNPs / Ti3C2Tx / Ru(II)-PEI composite material, which is stored at 4°C for use in subsequent biosensor construction.
[0049] The present invention also discloses the application of the ECL biosensor for detecting miR-21 in the field of miR-21 detection.
[0050] The present invention also discloses a method for detecting miR-21 by electrochemical method, comprising the steps of detecting using the ECL biosensor for detecting miR-21;
[0051] Preferably, the electrochemical method for detecting miR-21 comprises the following steps:
[0052] (1) preparing the degradation reaction system according to a selected ratio, mixing it with miR-21 of different concentrations, and performing a first incubation to allow miR-21 to bind to the probe and trigger a degradation reaction;
[0053] (2) preparing the amplification reaction system according to the selected ratio, adding the preliminary reaction product of step (1) to mix, and performing a second incubation to perform RNA amplification;
[0054] (3) preparing the CRISPR / Cas13a reaction system according to the selected ratio, adding the amplified product of step (2), and performing a third incubation to activate the Cas13a system to cleave the DNA reporter probe to obtain an activation solution;
[0055] (4) The working electrode is immersed in the activation solution to allow the DNA probe on the electrode surface to bind to the cleavage product, and an electrochemical luminescence signal is measured to achieve accurate quantitative detection of the miR-21 concentration.
[0056] Specifically, the electrochemical method for detecting miR-21 is:
[0057] In step (1), the temperature of the first incubation step is 35-40° C., and the incubation time is 20-40 minutes; and / or,
[0058] In step (2), the temperature of the second incubation step is 35-40° C., and the incubation time is 20-30-60 minutes; and / or,
[0059] In step (3), the temperature of the third incubation step is 20-30° C., and the incubation time is 10-30 minutes; and / or,
[0060] In the step (4), the dipping step is performed for 10-30 minutes.
[0061] The ECL biosensor of the present invention integrates the advantages of TMSD, T7 RNA polymerase transcription, Cas13a-mediated secondary cleavage and Mxene-based electrode modification. The biosensor uses P1 and P2 probes to initiate TMSD when miR-21 binds, triggering the assembly of functional T7 RNA template and promoter; subsequently, the transcription of T7 RNA polymerase produces a large amount of single-stranded RNA (ssRNA), which activates Cas13a to cut DNA reporter probes on the electrode surface; the iron ion (Fc) modification on these probes is removed, eliminating Fc-induced ECL quenching, resulting in a significant increase in ECL signal. By combining multi-stage amplification and a robust ECL platform, the biosensor achieves high sensitivity and high specificity detection of miR-21, providing a valuable tool for clinical diagnosis and biomarker research.
[0062] In the ECL biosensor of the present invention, in the AuNPs / Ti3C2Tx / Ru(II)-PEI material used for working electrode modification, Ti3C2Tx, namely Mxenes, is a two-dimensional material family that has attracted attention in the field of biosensor construction due to its unique physical and chemical properties. Mxenes have excellent conductivity, large surface area, adjustable functional groups and excellent biocompatibility, providing an ideal platform for fixing biomolecules and promoting signal conduction; in particular, the gold nanoparticle / titanium carbide / ruthenium(II)-PEI modified electrode is integrated into the biosensor system, combining the high conductivity of Mxenes and the strong ECL signal generation ability of the ruthenium(II)-based complex. This hybrid structure improves the efficiency and stability of ECL, making it very suitable for constructing highly sensitive and robust biosensors.
[0063] The ECL biosensor of the present invention targets complex biological matrices and uses Mxene materials to modify electrodes, which effectively improves the anti-interference ability, so that it still maintains excellent detection performance in a real clinical sample environment. The introduction of AuNPs / Ti3C2Tx / Ru(II)-PEI materials in the working electrode not only effectively enhances the electrochemiluminescence (ECL) signal, but also significantly improves the conductivity and stability of the sensor, making the detection more reliable. In addition, the sensor uses Au-S bond self-assembly to fix nucleic acid probes, eliminating cumbersome labeling or pre-treatment steps, optimizing the detection process, making the operation simpler and more efficient, thereby improving the feasibility and promotion value of clinical applications.
[0064] In the ECL biosensor described in the present invention, the innovative electrode modification design enhances the detection performance of the biosensor. The glassy carbon electrode is modified by AuNPs / Ti3C2Tx / Ru(II)-PEI, and the DNA probe labeled with iron oxide (Fc) is combined to achieve precise regulation of the ECL signal. Through the quenching effect of Fc, the system maintains the "ECL off" state when there is no target miRNA, and when CRISPR / Cas13a is activated and the probe is cleaved, the ECL signal is restored, thereby achieving signal amplification detection. This intelligent signal regulation mechanism not only improves the detection sensitivity, but also greatly enhances the specificity, enabling the sensor to effectively distinguish miR-21 from other interfering miRNAs, showing excellent selectivity.
[0065] In the ECL biosensor described in the present invention, the use of lock-and-key mediated strand displacement (TMSD) and T7 RNA polymerase-based transcription amplification is a versatile tool for high-sensitivity biosensor design; TMSD enables programmable and specific target recognition, where the displacement reaction can be precisely controlled to trigger downstream processes, and this mechanism provides excellent specificity even in complex biological matrices. At the same time, T7 RNA polymerase amplification uses its ability to transcribe large amounts of RNA from a single DNA template to provide exponential signal amplification of the presence of the target. The combination of TMSD and T7 RNA polymerase transcription provides a solid framework for multi-stage signal enhancement, solving the sensitivity limitations of traditional detection methods.
[0066] The ECL biosensor of the present invention achieves ultrasensitive detection of miR-21 through a multi-stage signal amplification strategy, combining lock-and-key mediated strand displacement (TMSD), T7 RNA polymerase amplification and CRISPR / Cas13a cleavage mechanism, so that even at extremely low concentrations (fM level) can obtain clear and measurable signals, while ensuring high specificity. Through this strategy, even low-abundance miRNAs can be efficiently identified and amplified to a detectable level, with a detection limit as low as 5.23aM, which is significantly better than traditional methods and breaks through the sensitivity bottleneck of existing miRNA detection technology.
[0067] The high anti-interference ability and excellent repeatability of the ECL biosensor in complex biological samples further highlight its practical value. In the detection of real blood samples, the recovery rate of the system was as high as 99.93%-106.20%, and the relative standard deviation (RSD) was only 4.3%, which proved its stability and repeatability in complex matrices and was suitable for high-precision detection in clinical environments. This anti-interference property enables it to maintain accurate detection when facing biological samples such as plasma and tissue fluid, overcoming the applicability limitations of traditional miRNA detection methods in biological samples.
[0068] The modular design of the ECL biosensor of the present invention and its dependence on the activity of CRISPR / Cas13a make it have the potential to adapt to other nucleic acid targets, especially the wide adaptability provides broad application prospects for future multiple nucleic acid detection and point-of-care (POC) diagnosis, and its structure can be flexibly adjusted to adapt to different nucleic acid targets, laying the foundation for future multiple biomarker detection. In addition, the system can be further integrated into wearable or microfluidic devices to achieve rapid on-site detection. At the same time, by combining with deep learning algorithms, the technology can further optimize data analysis, improve the automated analysis ability of test results, and provide powerful tools for precision medicine and personalized diagnosis and treatment. Future research can further expand this strategy to realize a multiple target detection platform, or integrate it into a portable point-of-care (POCT) tool. In particular, by promoting the application of CRISPR / Cas13a biosensors in the field of precision diagnosis, new ideas are provided for miRNA detection and related research, and a solid foundation is laid for the development of future precision medicine and bioanalysis technology.
[0069] The ECL biosensor described in the present invention not only breaks through the sensitivity and specificity limitations of existing miRNA detection technologies, but also has good stability and scalability, providing an efficient and reliable solution for miRNA detection, biomarker research and precision medicine applications. In particular, its high selectivity and good repeatability make it an ideal tool for quantitative detection of miR-21 in blood, plasma and other biological fluids. The strong anti-interference ability of the biosensor in complex biological samples further proves that it can still operate stably in an environment with large competitive interference from nucleic acids or other biological molecules. Compared with traditional sensors, it has stronger adaptability and has broad clinical and scientific research application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0070] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:
[0071] Figure 1 Schematic diagram of the miRNA detection biosensor based on multi-stage amplification of the present invention; wherein (A) is a schematic diagram of the construction process of the biosensor; (B) is a schematic diagram of the detection and signal amplification mechanism of the target miRNA;
[0072] Figure 2 The detection model parameters and results of the sensor system described in Example 1; wherein (A) is PEI@Ru(bpy)3 at different scales 2 +-Ti3C2@AuNPs transmission electron microscopy (TEM) image; (B) Energy dispersive spectroscopy (EDS) analysis of PEI@Ru(bpy)32 +-Elemental composition results of Ti3C2@AuNPs; (C) PEI@Ru(bpy)3 2 +-Elemental mapping total spectrum of Ti3C2@AuNPs;
[0073] Figure 3 The feasibility analysis results of the sensor system described in Example 1; wherein (A) is an electrochemical impedance spectroscopy (EIS) analysis of the step-by-step construction process of the ECL biosensor based on T7 RNA polymerase amplification and CRISPR / Cas13a; (B) is the change of the ECL signal during the feasibility test of the biosensor;
[0074] Figure 4 The figure shows the change of ECL signal intensity caused by the sensor system described in Example 1 treated with different doses of miR-21; wherein, (A) shows the change of ECL signal intensity with the concentration of miR-21, and curves a to k correspond to the detection results of miR-21 concentrations of 0aM, 10aM, 50aM, 100aM, 500aM, 1000aM, 5000aM, 10000aM, 50000aM, 100000aM and 500000aM, respectively; (B) shows the correlation curve between miR-21 concentration and ECL signal;
[0075] Figure 5 The sensitivity and reproducibility analysis results of the sensor system described in Example 1; wherein, (A) is the sensitivity evaluation result of the ECL biosensor based on T7 RNA polymerase amplification and CRISPR / Cas13a; (B) is the repeatability evaluation result of the biosensor. DETAILED DESCRIPTION
[0076] In the following embodiments of the present invention, the ECL sensor is a miRNA detection biosensor based on multi-stage amplification, and its construction schematic diagram is shown in the attached Figure 1 As shown in (A), the DNA reporter probe (DNA1) is modified with iron oxide (Fc) and fixed on the electrode surface modified with AuNPs / Ti3C2Tx / Ru(II)-PEI, and combined with the DNA probe labeled with iron oxide (Fc), the precise regulation of the ECL signal is achieved. Through the quenching effect of Fc, the Fc group can effectively quench the intrinsic electrochemiluminescence (ECL) signal of the electrode, maintaining the "ECL off" state when there is no target miRNA, and when CRISPR / Cas13a is activated and the probe is cleaved, the ECL signal is restored, thereby achieving signal amplification detection.
[0077] In the following embodiments of the present invention, the ECL sensor performs detection of target miRNA and signal amplification mechanism as shown in the attached Figure 1As shown in (B). When the target miRNA is introduced, the lock-and-key mediated strand displacement (TMSD) reaction is first triggered, releasing the P2 probe from the composite structure and forming a flexible single-stranded P1 probe. This structural change activates the split T7 RNA promoter and template fragment, thereby initiating the transcription process of T7 RNA polymerase. In addition, λ-exonuclease (λ-Exo) can degrade the discarded P2 chain, allowing the miRNA target to be recycled and further amplifying the detection signal. T7 RNA polymerase catalyzes the generation of a large amount of single-stranded RNA (ssRNA), which can activate the Cas13a-crRNA complex, thereby triggering Cas13a to cleave the DNA1 probe, resulting in the removal of the Fc group, thereby restoring the ECL signal. Ultimately, the degree of recovery of the ECL signal is directly related to the concentration of the miRNA, achieving a measurable detection output.
[0078] In the following embodiments of the present invention, the biosensor based on the electrochemiluminescence (ECL) principle, which combines Mxene material modified electrodes, gold nanoparticles (AuNPs), ruthenium (II) complex (Ru(II)-PEI), lock-and-key mediated strand displacement (TMSD) and T7 RNA polymerase amplification strategy, can achieve highly sensitive detection of miR-21.
[0079] In the following embodiments of the present invention, the Mxene material, i.e., Ti3C2Tx nanosheet material, is a conventional material used in the field of electrochemiluminescent biosensing. In the scheme of the present invention, its two-dimensional structure is used to combine with the probe. The choice of Tx functional group has no effect, and a conventional commercially available product can be selected.
[0080] In the following embodiments of the present invention, the preparation process of the biosensor includes the steps of material synthesis, electrode construction, nucleic acid probe preparation and miR-21 detection.
[0081] In the following examples of the present invention, the probe sequences involved are shown in Table 1 below.
[0082] Table 1 Probe sequences
[0083]
[0084] Example 1
[0085] The preparation method of the ECL biosensor described in this embodiment includes the following steps.
[0086] Synthesis of AuNPs / Ti3C2Tx / Ru(II)-PEI Materials
[0087] In this embodiment, the synthesis process of the AuNPs / Ti3C2Tx / Ru(II)-PEI material was firstly performed by dissolving 10 mg of Ru(II)(Ru(bpy)32+ ) and added EDC and NHS at a final concentration of 400 mM, and activated the carboxyl group after ultrasonic treatment for 2 hours to promote the formation of amide bonds with polyethyleneimine (PEI). Subsequently, 5 mg of Ti3C2Tx and a PEI solution with a final concentration of 5 mg / mL were added to the solution, and ultrasonic treatment was continued for 2 hours after stirring for 30 minutes to ensure the stable binding of Ru(II) to Ti3C2Tx / PEI.
[0088] The synthesis of the gold nanoparticles (AuNPs) was performed by slowly adding 30 μL of freshly prepared 0.01 M NaBH solution to 400 μL of 1.0% HAuCl solution in an ice water bath for reduction, and simultaneously adding 30 μL of 0.01 M sodium citrate solution dropwise, and maintaining continuous stirring for 40 minutes to ensure the stable formation of AuNPs.
[0089] The synthesized AuNPs were slowly added to the Ti3C2Tx / Ru(II)-PEI solution and subjected to ultrasonic treatment for 2 hours to achieve uniform binding. The unreacted products and impurities were removed by three centrifugations and PBS washings to obtain a high-purity AuNPs / Ti3C2Tx / Ru(II)-PEI composite material, denoted as PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs and stored them at 4 °C for use in subsequent biosensor construction.
[0090] Construction of ECL sensor
[0091] In this embodiment, the electrode modification process first cleans the glassy carbon electrode (GCE) to remove surface impurities and improve material adhesion, and then ultrasonically treats with ethanol and deionized water in turn, and blows dry with nitrogen to ensure surface cleanliness. Subsequently, the synthesized AuNPs / Ti3C2Tx / Ru(II)-PEI material is mixed with a 0.5% Nafion solution and ultrasonically treated for 20 minutes to obtain a uniformly dispersed suspension. Take 10 μL of the mixture and evenly drop it on the GCE surface, and dry it naturally at room temperature to form a stable functionalized film, which provides a basis for the subsequent fixation of nucleic acid probes.
[0092] During the probe fixation process, the modified electrode was immersed in a 1μM DNA1 solution and incubated for 10 hours to allow DNA1 to bind to the electrode surface through the Au-S bond to achieve specific fixation. Subsequently, 8μL of 1mM 6-mercapto-1-hexanol (MCH) solution was added to the electrode surface to fill the residual AuNPs binding sites, prevent nonspecific adsorption, and enhance the stability of the DNA probe, laying the foundation for efficient nucleic acid detection.
[0093] Nucleic acid probe preparation
[0094] In this example, the preparation of nucleic acid probes first mixed four single-stranded DNAs (T7-a, T7-b, P1, P2, as shown in Table 1) at a concentration of 10 mM in PBS buffer (pH 7.4), heated at 95°C for 5 minutes, and then slowly cooled to room temperature to form a double-stranded PG probe with a predetermined conformation.
[0095] miR-21 detection
[0096] In this embodiment, the detection process of miR-21 starts with target recognition and preliminary reaction. First, 2 μM PG probe, 5U / μL λ-Exo enzyme (100 μL), 1× reaction buffer (15 μL) were mixed with different concentrations of miR-21, and supplemented to 100 μL with DEPC water, and then incubated at 37°C for 30 minutes to allow miR-21 to bind to the probe and trigger the degradation reaction. Subsequently, 50 μL of the preliminary reaction product was added to a 100 μL amplification system, including 40 μM NTPs, 30U T7 RNA polymerase, 1 μM DNA template (such as T7-b in Table 1), 20U RNase inhibitor (depc) and 2 μL 10× RNA Pol reaction buffer, and incubated at 37°C for 40 minutes for RNA amplification.
[0097] The amplified product was then introduced into the CRISPR / Cas13a system, in which the transcription product was mixed with 10 nM Cas13a protein, 15 nM crRNA, and 1 × NEBuffer (NEB) and incubated at room temperature for 20 min to activate the Cas13a system to cleave the DNA reporter probe and obtain the desired activation system.
[0098] Finally, the ECL biosensor constructed above was immersed in the activation system for 20 minutes to allow the DNA probe on the electrode surface to bind to the cleavage product, and the electrochemiluminescence signal was measured using the ECL-6B system to achieve accurate quantitative detection of miR-21 concentration.
[0099] Example 2
[0100] The preparation method of the ECL biosensor described in this embodiment includes the following steps.
[0101] Synthesis of AuNPs / Ti3C2Tx / Ru(II)-PEI Materials
[0102] In this embodiment, the synthesis process of the AuNPs / Ti3C2Tx / Ru(II)-PEI material is firstly performed by dissolving 8 mg of Ru(II) in PBS buffer and adding EDC and NHS at a final concentration of 300 mM, and then activating the carboxyl group after ultrasonic treatment for 1 hour to promote the formation of amide bonds with polyethyleneimine (PEI). Subsequently, 3 mg of Ti3C2Tx and a PEI solution at a final concentration of 3 mg / mL are added to the solution, and the solution is stirred for 20 minutes and then ultrasonicated for 1 hour to ensure the stable binding of Ru(II) to Ti3C2Tx / PEI.
[0103] The synthesis of the gold nanoparticles (AuNPs) was performed by slowly adding 20 μL of freshly prepared 0.005 M NaBH solution to 300 μL of 0.8% HAuCl solution in an ice water bath for reduction, and simultaneously adding 20 μL of 0.005 M sodium citrate solution dropwise, and maintaining continuous stirring for 30 minutes to ensure the stable formation of AuNPs.
[0104] The synthesized AuNPs were slowly added to the Ti3C2Tx / Ru(II)-PEI solution and ultrasonicated for 1 hour to achieve uniform binding. The unreacted products and impurities were removed by three centrifugations and PBS washings to obtain a high-purity AuNPs / Ti3C2Tx / Ru(II)-PEI composite material, which was stored at 4°C for use in subsequent biosensor construction.
[0105] Construction of ECL sensor
[0106] In this embodiment, the electrode modification process first cleans the glassy carbon electrode (GCE) to remove surface impurities and improve material adhesion, and then ultrasonically treats with ethanol and deionized water in turn, and blows dry with nitrogen to ensure surface cleanliness. Subsequently, the synthesized AuNPs / Ti3C2Tx / Ru(II)-PEI material is mixed with a 0.3% Nafion solution and ultrasonically treated for 10 minutes to obtain a uniformly dispersed suspension. Take 15 μL of the mixture and evenly drop it on the GCE surface, dry it naturally at room temperature to form a stable functionalized film, which provides a basis for the subsequent fixation of nucleic acid probes.
[0107] During the probe fixation process, the modified electrode was immersed in a 0.5 μM DNA1 solution and incubated for 12 hours to allow DNA1 to bind to the electrode surface through the Au-S bond to achieve specific fixation. Subsequently, 6 μL of 1.2 mM 6-mercapto-1-hexanol (MCH) solution was added to the electrode surface to fill the residual AuNPs binding sites, prevent nonspecific adsorption, and enhance the stability of the DNA probe, laying the foundation for efficient nucleic acid detection.
[0108] Nucleic acid probe preparation
[0109] In this example, the nucleic acid probe was prepared by first mixing four single-stranded DNAs (T7-a, T7-b, P1, P2) at a concentration of 9.8 mM in PBS buffer (pH 7.4), heating at 90°C for 3 minutes and then slowly cooling to room temperature to form a double-stranded PG probe with a predetermined conformation.
[0110] miR-21 detection
[0111] In this embodiment, the detection process of miR-21 starts with target recognition and preliminary reaction. First, 1.8μMPG probe, 4.8U / μL λ-Exo enzyme (100μL), 1× reaction buffer (10μL) were mixed with different concentrations of miR-21, and supplemented to 100μL with DEPC water, and then incubated at 37°C for 30 minutes to allow miR-21 to bind to the probe and trigger the degradation reaction. Subsequently, 50μL of the preliminary reaction product was added to 100μL amplification system, including 39.8μM NTPs, 29.8U T7 RNA polymerase, 0.8μM DNA template (such as T7-b in Table 1), 19.8U RNase inhibitor (depc) and 1.8μL 10×RNAPol reaction buffer, and incubated at 35°C for 40 minutes for RNA amplification. The amplified product was then introduced into the CRISPR / Cas13a system, in which the transcription product was mixed with 9.8 nM Cas13a protein, 14.8 nM crRNA, and 1× NEBuffer (NEB) and incubated at room temperature for 20 min to activate the Cas13a system to cleave the DNA reporter probe and obtain the desired activation system.
[0112] Finally, the ECL biosensor constructed above was immersed in the activation system for 20 minutes to allow the DNA probe on the electrode surface to bind to the cleavage product, and the electrochemiluminescence signal was measured using the ECL-6B system to achieve accurate quantitative detection of miR-21 concentration.
[0113] Example 3
[0114] The preparation method of the ECL biosensor described in this embodiment includes the following steps.
[0115] Synthesis of AuNPs / Ti3C2Tx / Ru(II)-PEI Materials
[0116] In this embodiment, the synthesis process of the AuNPs / Ti3C2Tx / Ru(II)-PEI material is firstly performed by dissolving 12 mg of Ru(II) in PBS buffer and adding EDC and NHS at a final concentration of 500 mM, and then activating the carboxyl group after ultrasonic treatment for 3 hours to promote the formation of amide bonds with polyethyleneimine (PEI). Subsequently, 7 mg of Ti3C2Tx and a PEI solution with a final concentration of 7 mg / mL are added to the solution, and the solution is stirred for 40 minutes and then ultrasonicated for 3 hours to ensure the stable binding of Ru(II) to Ti3C2Tx / PEI.
[0117] The synthesis of the gold nanoparticles (AuNPs) was performed by slowly adding 40 μL of freshly prepared 0.015 M NaBH solution to 500 μL of 1.2% HAuCl solution in an ice water bath for reduction, and simultaneously adding 40 μL of 0.015 M sodium citrate solution dropwise, and maintaining continuous stirring for 50 minutes to ensure the stable formation of AuNPs.
[0118] The synthesized AuNPs were slowly added to the Ti3C2Tx / Ru(II)-PEI solution and ultrasonicated for 3 hours to achieve uniform binding. The unreacted products and impurities were removed by three centrifugations and PBS washings to obtain a high-purity AuNPs / Ti3C2Tx / Ru(II)-PEI composite material, which was stored at 4°C for use in subsequent biosensor construction.
[0119] Construction of ECL sensor
[0120] In this embodiment, the electrode modification process first cleans the glassy carbon electrode (GCE) to remove surface impurities and improve material adhesion, and then ultrasonically treats with ethanol and deionized water in turn, and blows dry with nitrogen to ensure surface cleanliness. Subsequently, the synthesized AuNPs / Ti3C2Tx / Ru(II)-PEI material is mixed with a 0.7% Nafion solution and ultrasonically treated for 30 minutes to obtain a uniformly dispersed suspension. Take 5 μL of the mixture and evenly drop it on the GCE surface, and dry it naturally at room temperature to form a stable functionalized film, which provides a basis for the subsequent fixation of nucleic acid probes.
[0121] During the probe fixation process, the modified electrode was immersed in a 1.5μM DNA1 solution and incubated for 8 hours to allow DNA1 to bind to the electrode surface through the Au-S bond to achieve specific fixation. Subsequently, 10μL of 0.8mM 6-mercapto-1-hexanol (MCH) solution was added to the electrode surface to fill the residual AuNPs binding sites, prevent nonspecific adsorption, and enhance the stability of the DNA probe, laying the foundation for efficient nucleic acid detection.
[0122] Nucleic acid probe preparation
[0123] In this example, the preparation of nucleic acid probes first involves mixing four single-stranded DNAs (T7-a, T7-b, P1, and P2) at a concentration of 10.2 mM in PBS buffer (pH 7.4), heating at 98°C for 7 minutes, and then slowly cooling to room temperature to form a double-stranded PG probe with a predetermined conformation.
[0124] miR-21 detection
[0125] In this embodiment, the detection process of miR-21 starts with target recognition and preliminary reaction. First, 2.2 μM Pg probe, 5.2 U / μL λ-Exo enzyme (100 μL), 1× reaction buffer (20 μL) were mixed with different concentrations of miR-21, and supplemented to 100 μL with DEPC water, and then incubated at 37 ° C for 40 minutes to allow miR-21 to bind to the probe and trigger the degradation reaction. Subsequently, 50 μL of the preliminary reaction product was added to a 100 μL amplification system, which included 40.2 μM NTPs, 30.2 U T7 RNA polymerase, 1.2 μM DNA template (such as T7-b in Table 1), 20.2 U RNase inhibitor (rnase enzyme) and 2.2 μL 10× RNAPol reaction buffer, and incubated at 37 ° C for 40 minutes for RNA amplification. The amplified product was then introduced into the CRISPR / Cas13a system, in which the transcription product was mixed with 10.2 nM Cas13a protein, 15.2 nM crRNA, and 1× NEBuffer (NEB) and incubated at room temperature for 20 min to activate the Cas13a system to cleave the DNA reporter probe to obtain the desired activation system.
[0126] Finally, the ECL biosensor constructed above was immersed in the activation system for 20 minutes to allow the DNA probe on the electrode surface to bind to the cleavage product, and the electrochemiluminescence signal was measured using the ECL-6B system to achieve accurate quantitative detection of miR-21 concentration.
[0127] Example 4
[0128] This embodiment is based on the detection and analysis of the biosensor in the aforementioned embodiment 1.
[0129] 1. Transmission electron microscopy (TEM) analysis
[0130] In this example, TEM analysis was used to observe the PEI@Ru(bpy)3 2 The morphology of the +-Ti3C2@AuNPs nanocomposite and the distribution of gold nanoparticles (AuNPs) on the Ti3C2 surface specifically include the following steps:
[0131] Sample preparation: The synthesized PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs nanocomposites were dispersed on the support membrane to form a uniform film;
[0132] TEM imaging: Transmission electron microscopy (TEM) was used to image the samples to observe the morphology of the nanocomposites and the distribution of gold nanoparticles.
[0133] Results: TEM images showed that gold nanoparticles were uniformly distributed on the Ti3C2 surface, which indicated that the preparation of the nanocomposite was successful.
[0134] 2. Energy dispersive spectroscopy (EDS) analysis
[0135] This example verifies the PEI@Ru(bpy)3 by EDS analysis. 2 +-The presence of key elements in Ti3C2@AuNPs nanocomposites specifically includes the following steps:
[0136] Sample preparation: The synthesized PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs nanocomposites were prepared into samples suitable for EDS analysis;
[0137] EDS analysis: Energy dispersive spectroscopy (EDS) was used to perform elemental analysis on the samples and detect the elemental composition.
[0138] Results: EDS analysis results confirmed the presence of key elements such as C (carbon), Ti (titanium), N (nitrogen), Au (gold) and Ru (ruthenium) in the nanocomposite, which further verified the successful synthesis of the nanocomposite.
[0139] Through these two methods, this example verifies the PEI@Ru(bpy)3 2 The morphology and elemental composition of +-Ti3C2@AuNPs nanocomposites ensure their feasibility for application in ECL biosensors.
[0140] Figure 2 (A) shows PEI@Ru(bpy)3 at different scales 2 Transmission electron microscopy (TEM) images of the +-Ti3C2@AuNPs nanocomposite to show the detailed structure of the nanocomposite and the distribution of gold nanoparticles. These images help to understand the microstructure of the material and thus explain its performance in electrochemiluminescence (ECL) biosensor. Figure 2 The transmission electron microscopy (TEM) image shown in (A) shows the PEI@Ru(bpy)3 2The morphology of the +-Ti3C2@AuNPs nanocomposite shows that the gold nanoparticles (AuNPs) are evenly distributed on the Ti3C2 surface. This uniform distribution is a key factor affecting the performance of the composite, helping to ensure the consistency of its electronic and electrochemical properties as it ensures the consistency of the material’s electronic and electrochemical properties.
[0141] Figure 2 (B) is the analysis of PEI@Ru(bpy)3 by energy dispersive spectroscopy (EDS). 2 +-Elemental composition of Ti3C2@AuNPs, showing PEI@Ru(bpy)3 2 +- EDS spectrum of Ti3C2@AuNPs nanocomposite. It can be seen that Figure 2 The energy dispersive spectroscopy (EDS) analysis spectrum shown in (B) confirmed the presence of key elements, including C (carbon), Ti (titanium), N (nitrogen), Au (gold) and Ru (ruthenium), verifying the successful synthesis of the nanocomposite. The key elements such as carbon (C), titanium (Ti), nitrogen (N), gold (Au) and ruthenium (Ru) were clearly detected, and the presence of these elements verified the successful synthesis of the nanocomposite. Figure 2 The EDS analysis results shown in (B) show that all the expected elements were successfully incorporated into the nanocomposite. This step is critical to confirming the composition and structure of the material because it ensures that the chemical properties of the material match its intended function.
[0142] Figure 2 (C) is PEI@Ru(bpy)3 2 +-The total element mapping spectrum of Ti3C2@AuNPs nanocomposites. It can be seen that Figure 2 The elemental mapping results shown in (C) show the distribution of C, Ti, N, Au, and Ru elements in the nanocomposite, highlighting the uniform distribution of these elements in the composite, which is crucial for the performance and stability of the material. Combining these characterization results, it can be clearly demonstrated that PEI@Ru(bpy)3 2 The successful synthesis of +-Ti3C2@AuNPs nanocomposites, where TEM images highlight the uniform distribution of nanoparticles, while EDS analysis confirms the effective incorporation of all essential elements.
[0143] It can be seen that this example successfully characterized PEI@Ru(bpy)3 through TEM images and EDS analysis. 2Morphology and elemental composition of the +-Ti3C2@AuNPs nanocomposite. TEM images show the uniform distribution of gold nanoparticles on the Ti3C2 surface, while EDS analysis confirms the presence of all key elements. Together, these results validate the successful synthesis of the nanocomposite and provide a scientific basis for its application in ECL biosensors.
[0144] It can be seen that the uniform distribution of gold nanoparticles not only enhances the overall performance of the composite material, but also outperforms its individual components, making it an ideal candidate for high-performance material applications. This successful synthesis lays a solid foundation for the construction of ECL biosensors, which can significantly improve the electrochemical properties of the sensor, thereby improving the sensitivity and reliability of detection.
[0145] Example 5
[0146] This embodiment performs feasibility analysis based on the biosensor solution in the aforementioned embodiment 1.
[0147] 1. Electrochemical impedance spectroscopy (EIS) analysis
[0148] In this example, EIS analysis is used to characterize the step-by-step construction process of the biosensor and monitor the impedance changes of the electrode surface during different modification steps. The specific steps are as follows:
[0149] Bare electrode: First measure the impedance of the bare electrode as a benchmark;
[0150] PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs modification: PEI@Ru(bpy)3 2 After +-Ti3C2@AuNPs material was modified onto the electrode surface, the impedance was measured;
[0151] DNA1 modification: In PEI@Ru(bpy)3 2 After further modification of DNA1 on the +-Ti3C2@AuNPs-modified electrode, the impedance was measured;
[0152] MCH modification: Finally, the impedance was measured after modifying the electrode surface with 6-mercapto-1-hexanol (MCH).
[0153] like Figure 3 (A) shows the electrochemical impedance spectroscopy (EIS) analysis of the step-by-step construction process of the ECL biosensor based on T7 RNA polymerase amplification and CRISPR / Cas13a. Curve (a) represents the bare electrode, which shows the lowest impedance, indicating that it has high conductivity; curve (b) shows the lowest impedance after the modified PEI@Ru(bpy)3 2+-Ti3C2@AuNPs, the impedance increased, indicating that electron transfer was blocked; curve (c) showed that the impedance further increased after DNA1 was fixed, indicating that the introduction of nucleic acids interfered with electron transfer; curve (d) reached the highest impedance after MCH modification, proving that the biosensor was successfully constructed.
[0154] It can be seen that with each step of modification, the impedance gradually increased, indicating that the electron transport on the electrode surface was hindered and the biosensor was successfully constructed.
[0155] 2. Study on ECL signal behavior
[0156] This example verifies the feasibility of the biosensor by detecting ECL signals under different conditions. The specific steps include:
[0157] DNA1-Fc modified electrode: The electrode modified with DNA1-Fc was immersed in PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs solution, the ECL signal was measured;
[0158] No PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs electrode: In the absence of PEI@Ru(bpy)3 2 +-The same operation was performed on the Ti3C2@AuNPs modified electrode and the ECL signal was measured;
[0159] Reaction without target miRNA: Measure the ECL signal in the reaction system without adding target miRNA;
[0160] Add miR-21, probe, and CRISPR / Cas13a: After adding miR-21, probe, and CRISPR / Cas13a to the reaction system, measure the ECL signal.
[0161] like Figure 3 (B) shows the change of ECL signal during the feasibility test of the biosensor. Curve (a) shows that when DNA1-Fc inhibits PEI@Ru(bpy)3 2 +-Ti3C2@AuNPs, almost no ECL signal can be detected; curve (b) is unmodified PEI@Ru(bpy)3 2The electrode of +-Ti3C2@AuNPs exhibits the maximum ECL signal due to the lack of quenching effect of Fc; curve (c) produces only a weak ECL signal without the addition of target miRNA, indicating that CRISPR / Cas13a is not activated; curve (d) after the introduction of miR-21 (10000aM), probe and CRISPR / Cas13a, the ECL signal is significantly enhanced, confirming the successful activation of CRISPR / Cas13a cutting activity.
[0162] It can be seen that under the conditions of adding miR-21, probe and CRISPR / Cas13a, the ECL signal was significantly enhanced, indicating that CRISPR / Cas13a successfully activated and cut DNA1 on the electrode and restored the ECL signal.
[0163] Example 6
[0164] This embodiment is based on the feasibility verification of the biosensor solution in the aforementioned embodiment 1.
[0165] ECL signal detection: The ECL signal intensity of the biosensor was measured by an ECL signal detection system, and the signal intensity was directly related to the concentration of miR-21.
[0166] Quantitative analysis: Based on the relationship between ECL signal intensity and miR-21 concentration, a standard curve was drawn for quantitative analysis.
[0167] Figure 4 The results of ECL signal intensity changes caused by treatment with different doses of miR-21; (A) shows the change of ECL signal intensity with miR-21 concentration, wherein curve ak corresponds to the detection results of miR-21 concentrations of 0aM, 10aM, 50aM, 100aM, 500aM, 1000aM, 5000aM, 10000aM, 50000aM, 100000aM and 500000aM respectively; (B) is the correlation curve between miR-21 concentration and ECL signal.
[0168] Example 7
[0169] This example is based on the biosensor solution in the aforementioned Example 1 for sensitivity and reproducibility analysis.
[0170] 1. Sensitivity analysis
[0171] This example evaluates the detection capability of the biosensor for different concentrations of miR-21 and determines its detection limit and linear range, specifically comprising the following steps:
[0172] Preparation of miR-21 solutions of different concentrations: diluting miR-21 to different concentrations, namely 0aM, 10aM, 50aM, 100aM, 500aM, 1000aM, 5000aM, 10000aM, 50000aM, 100000aM and 500000aM;
[0173] Detection of ECL signal: Add different concentrations of miR-21 solution into the biosensor and measure the corresponding ECL signal intensity;
[0174] Draw a standard curve: Draw a standard curve with miR-21 concentration as the horizontal axis and ECL signal intensity as the vertical axis;
[0175] Calculation of detection limit: The detection limit was calculated using the 3σ method, i.e., the standard deviation (σ) of the ECL signal of the blank sample was measured and multiplied by 3 to obtain the detection limit.
[0176] like Figure 5 (A) shows the sensitivity evaluation results of the ECL biosensor based on T7 RNA polymerase amplification and CRISPR / Cas13a. It can be seen that the ECL signal response was measured for miR-21 (100fM) and interfering miRNAs (including Let-7a, miR-205 and miR-221, all 100fM) and blank controls. The results showed that the ECL signal was significantly enhanced only in the presence of miR-21, while for interfering miRNAs and blank controls, the ECL signal was almost negligible, proving that the biosensor is highly selective for miR-21.
[0177] In this embodiment, the linear equation for constructing the standard curve is Y=0.05267×lgX-0.03918, and the correlation coefficient R 2 =0.9971, indicating that there is a good linear relationship between ECL signal intensity and miR-21 concentration.
[0178] Detection limit: The calculated detection limit was 5.23 aM, showing the high sensitivity of the biosensor to miR-21.
[0179] 2. Reproducibility Analysis
[0180] This example evaluates the stability and consistency of the biosensor in repeated detection, specifically including the following steps:
[0181] Select a fixed concentration of miR-21: 100 fM miR-21 was selected as the test concentration;
[0182] Multiple detections were performed: 10 consecutive ECL signal detections were performed for the same concentration of miR-21.
[0183] Calculation of relative standard deviation (RSD): The relative standard deviation (RSD) of the 10 test results was calculated to evaluate the reproducibility of the biosensor.
[0184] like Figure 5 (B) is the repeatability evaluation of the biosensor. It can be seen that under the condition of miR-21 concentration of 100fM, 10 consecutive scan tests were performed, and the relative standard deviation (RSD) obtained was 4.3% (n=10), indicating that the biosensor has excellent repeatability, stability and consistency in repeated detection of miR-21.
[0185] Example 8
[0186] This embodiment performs data detection of actual samples based on the biosensor solution in the aforementioned embodiment 1.
[0187] In this example, to further evaluate the effectiveness of this strategy, a series of experiments were conducted to verify the ability of the ECL biosensor based on T7 RNA polymerase amplification and CRISPR / Cas13a amplification to detect miR-21 levels in human blood samples.
[0188] In this embodiment, different concentrations of miR-21 were added to a 10-fold diluted human blood sample, and the serum of the physical examination patient was diluted ten times with PBS buffer, that is, 1 mL of human serum was taken, 9 mL of PBS buffer was added, and mixed evenly, and the biosensor was used to measure its concentration. The results are shown in Table 2 below.
[0189] Table 2 Results of miR-21 detection in samples
[0190]
[0191]
[0192] The experimental results showed that the ECL signal intensity increased proportionally with the increase in miR-21 concentration, allowing the calculation of miR-21 levels and their recovery rates. The recovery rates obtained ranged from 99.93% to 106.20%, as shown in Table 2. This result confirms the high anti-interference ability of the biosensor in complex biological samples and its ability to maintain effective CRISPR / Cas13a activity in complex matrices such as blood samples.
[0193] In summary, the ECL biosensor described in the present invention adopts a multi-stage signal amplification strategy, combined with lock-and-key mediated strand displacement (TMSD), T7 RNA polymerase transcription amplification and CRISPR / Cas13a secondary cleavage effect, has high selectivity and good repeatability, especially high specificity, and can still operate stably in an environment with large competitive interference from nucleic acids or other biological molecules, and can achieve ultrasensitive detection of miR-21, providing a multifunctional platform for miR-21 detection and its application in clinical diagnosis and biomarker monitoring.
[0194] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.
Claims
1. An ECL biosensor for detecting miR-21, characterized in that: It includes a working electrode, a T7 RNA polymerase transcription system and a CRISPR / Cas13a reaction system.
2. The ECL biosensor for detecting miR-21 according to claim 1, characterized in that: The working electrode comprises: (1) AuNPs / Ti3C2Tx / Ru(II)-PEI material modified electrode; (2) the iron oxide-labeled DNA1 probe is anchored on the surface of the working electrode; Preferably, the sequence of the DNA1 probe is as follows: Fc-TTTTTTTTTTTrUrUTTTTTTTT-SH; Preferably, the electrode comprises a glassy carbon electrode.
3. The ECL biosensor for detecting miR-21 according to claim 1 or 2, characterized in that: The T7 RNA polymerase transcription system includes a degradation reaction system and an amplification reaction system; wherein, The degradation reaction system comprises: a PG probe, a λ-Exo enzyme, and a degradation reaction buffer; The amplification reaction system comprises NTPs, T7 RNA polymerase, DNA template, RNase inhibitor and RNAPol reaction buffer.
4. The ECL biosensor for detecting miR-21 according to claim 3, characterized in that: In the T7 RNA polymerase transcription system, the PG probe includes four single-stranded DNAs: T7-a, T7-b, P1, and P2; wherein, The sequence of T7-a is as follows: AACGAGACTG TT TAATACGACTCACTATAGGG; The sequence of T7-b is as follows: CTACCTGCACTGTAAGCACTTTG CCCTATAGTGAGTCGTATTATTCGTC ACTCCA; The sequence of P1 is as follows: TGGAGTGACGTAGCTTATCAGACTCAGTCTCGTT; The sequence of P2 is as follows: p-TCAACATCAGTCTGATAAGCTA.
5. The ECL biosensor for detecting miR-21 according to any one of claims 1 to 4, characterized in that: The CRISPR / Cas13a reaction system includes Cas13a protein, crRNA and Cas13a reaction buffer; Preferably, the sequence of the Cas13a protein is as follows: CAAAGUGCUUACAGUGCAGGUAG; Preferably, the sequence of the crRNA is as follows: GACCACCCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG.
6. A method for constructing an ECL biosensor for detecting miR-21 according to any one of claims 1 to 5, characterized in that: The method comprises the steps of constructing the working electrode and distributing and preparing the T7 RNA polymerase transcription system and the CRISPR / Cas13a reaction system; Preferably, the steps of constructing the working electrode include: The AuNPs / Ti3C2Tx / Ru(II)-PEI material is mixed with a film-forming solution and then coated on the surface of the electrode, and after film formation, an electrode modified with the AuNPs / Ti3C2Tx / Ru(II)-PEI material is obtained; The modified electrode is immersed in a solution containing the DNA1 for incubation and fixation, and a thiol blocking agent is added dropwise to the surface of the electrode for reaction to obtain the modified electrode.
7. The method for constructing an ECL biosensor for detecting miR-21 according to claim 6, characterized in that: The step of constructing the working electrode also includes the step of synthesizing the AuNPs / Ti3C2Tx / Ru(II)-PEI material; Preferably, the synthesis steps of the AuNPs / Ti3C2Tx / Ru(II)-PEI material include: In a buffer system, Ru(II), Ti3C2Tx and PEI were added to react to obtain Ti3C2Tx / Ru(II)-PEI; The Au source material is mixed with a reducing agent and an alkaline solution is added to react to obtain AuNPs nanoparticles; The AuNPs are added into the Ti3C2Tx / Ru(II)-PEI solution to react and obtain the desired AuNPs / Ti3C2Tx / Ru(II)-PEI material.
8. Use of the ECL biosensor for detecting miR-21 according to any one of claims 1 to 5 in the field of miR-21 detection.
9. A method for detecting miR-21 by electrochemical method, characterized in that: The method comprises the steps of using the ECL biosensor for detecting miR-21 according to any one of claims 1 to 5 for detection; Preferably, the electrochemical method for detecting miR-21 comprises the following steps: (1) preparing the degradation reaction system according to a selected ratio, mixing it with miR-21 of different concentrations, and performing a first incubation to allow miR-21 to bind to the probe and trigger a degradation reaction; (2) preparing the amplification reaction system according to the selected ratio, adding the preliminary reaction product of step (1) to mix, and performing a second incubation to perform RNA amplification; (3) preparing the CRISPR / Cas13a reaction system according to the selected ratio, adding the amplified product of step (2), and performing a third incubation to activate the Cas13a system to cleave the DNA reporter probe to obtain an activation solution; (4) The working electrode is immersed in the activation solution to allow the DNA probe on the electrode surface to bind to the cleavage product, and an electrochemical luminescence signal is measured to achieve accurate quantitative detection of the miR-21 concentration.
10. The method for detecting miR-21 by electrochemical method according to claim 9, characterized in that: In step (1), the temperature of the first incubation step is 35-40° C., and the incubation time is 20-40 minutes; and / or, In step (2), the temperature of the second incubation step is 35-40° C., and the incubation time is 20-30-60 minutes; and / or, In step (3), the temperature of the third incubation step is 20-30° C., and the incubation time is 10-30 minutes; and / or, In the step (4), the dipping step is performed for 10-30 minutes.