Plants having improved pathogen resistance

Abstract

The present invention relates to novel tomato plants having improved resistance to lesion forming pathogens. The invention further relates to plant parts and seeds derived from said tomato plant, and to methods of making said tomato plant or increasing the resistance of a tomato plant to lesion-forming pathogens. Further aspects of the invention relate to the modified Pub21 nucleic acid and Pub21 protein sequences, and to combinations of the modified Pub21 and Pub17 nucleic acid and Pub21 and Pub17 protein sequences, which are associated with such improved lesion forming pathogen resistance.

Description

Technical Field

[0001] The present invention relates to novel tomato plants with improved resistance to lesion forming pathogens. The invention further relates to plant parts and seeds derived from said tomato plants, and to methods of making said tomato plants or increasing the resistance of tomato plants to lesion forming pathogens. Additional aspects of the invention relate to modified Pub21 nucleic acid and Pub21 protein sequences, and to combinations of modified Pub21 and Pub17 nucleic acids and Pub21 and Pub17 protein sequences, which are associated with such improved resistance to lesion forming pathogens. Background Art

[0002] Valuable crop plants such as tomatoes are hosts to a wide variety of pests and pathogens from more than 200 species. In plant breeding practice, one of the most prominent issues since the 1950s has been breeding for resistance to the most destructive pests and pathogens by transferring disease resistance (R) genes from wild relatives to cultivated plants. Today, about 20 pathogens can be genetically controlled by R-genes, which are derived from a relatively small number of wild species. In most cases, monogenic resistance controlled by a single dominant gene is introgressed into cultivated varieties (Bai et al., 2018). Most of the dominant R-genes cloned to date can be divided into two groups: (1) plasma membrane receptors, including receptor-like kinases (RLKs, encoded by I-3 genes) and receptor-like proteins (RLPs, encoded by Cf genes and Ve-1 genes); and (2) in most cases, intracellular receptors, which represent proteins with a nucleotide binding site and a leucine-rich repeat domain (NBS-LRR). These plant receptors are able to recognize pathogen molecules known as pathogen-associated molecular patterns and effectors, leading to pathogen-induced resistance (Dangl et al., 2013).

[0003] For (semi) biotrophic microbial pathogens, dominant R-genes have been very successful infiltrating cultivars from wild species. The mode of action of such R-genes has been extensively studied over the past two decades, and in most cases has been shown to rely on a mechanism known as effector-triggered immunity (ETI). The effector molecules of biotrophic pathogens are considered to be important in suppressing the so-called PAMP-triggered immunity (PTI). Plant receptor proteins (products of R-genes) induce programmed cell death ("hypersensitive response", HR) to the recognition of microbial effector molecules, thereby preventing further invasion of pathogens.

[0004] However, no genes have been identified that confer immunity against lesion-forming pathogens, especially necrotrophic pathogens, including the common tomato pathogens Botrytis cinerea and Alternaria solani (Adhikari et al., 2017; Bai et al., 2018). The above immune responses are ineffective against such microbial pathogens. Instead, necrotrophs are thought to “hijack” host cell death pathways in response to effector molecules (Mengiste, 2012; Vleeshouwers and Oliver 2014; Shi et al., 2016). Therefore, it is crucial to develop alternative breeding strategies that circumvent the use of plant receptor genes that recognize effectors.

[0005] Most of the currently available resistance to lesion-forming pathogens is quantitative and is conferred by a number of quantitative trait loci (QTLs, Poland et al., 2009; Bai et al., 2018). In contrast to R-gene-mediated qualitative resistance, the molecular mechanisms of quantitative resistance conferred by QTLs are not yet understood. It has been proposed that resistance QTLs may be regulated by genes involved in defense signaling, genes regulating morphological traits, and genes encoding components of chemical warfare agents (Poland et al., 2009; Roux et al., 2014). In breeding, QTLs are difficult to use due to the impact of small individual QTLs on resistance. For example, in some wild tomato relative germplasm, there is a good level of disease resistance to Botrytis cinerea and Alternaria solani (ten Have et al., 2007; Smith et al., 2014), however, once introgressed into the tomato (S. lycopersicum) background, the resistance level drops, indicating that the genetic background of resistance in wild species is very complex (Finkers et al., 2007; Smith et al., 2014).

[0006] In 2010, a new strategy for crop breeding for resistance was proposed: the use of impaired plant susceptibility (S) genes (Pavan et al., 2010). S-genes are plant genes that encode proteins that pathogens exploit for their own benefit during infection (Pavan et al., 2010). These S-genes can be divided into three groups (Van Schie and Takken, 2014): (i) genes that allow basic plant-pathogen compatibility, facilitating host recognition and penetration; (ii) genes that encode negative regulators of immune signaling; and (iii) genes that allow sustained compatibility and pathogen proliferation, fulfilling metabolic or structural needs of the pathogen. When such genes become dysfunctional due to mutation or loss of expression, they hinder the pathogen from colonizing the plant. Thus, impaired S-genes contribute primarily to recessive resistance traits, in contrast to recognition-based resistance dominated by dominant R-genes. Strategies using S-genes offer fundamentally different opportunities for controlling diseases caused by lesion-forming microorganisms. However, many S-genes remain undiscovered, and the concept of using S-genes to generate pathogen-resistant plants has not yet been tested or realized in key crop plants such as tomatoes.

[0007] The present invention aims to solve one or more of the above problems in the art by providing an alternative means of increasing plant resistance to lesion-forming pathogens, particularly in tomato plants. Summary of the invention

[0008] According to a first aspect of the present invention there is provided a tomato plant or plant material having reduced Pub21 protein levels, activity or expression thereby conferring increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material.

[0009] In one embodiment, the tomato plant or plant material with reduced Pub21 protein level, activity or expression further comprises reduced Pub17 protein level, activity or expression, thereby conferring increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material according to the first aspect of the invention. In one embodiment, the modified Pub21 and Pub17 alleles confer increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material.

[0010] In one embodiment, the tomato plant or plant material has been modified to reduce the level, activity or expression of Pub21 protein. Thus, in one embodiment, there is a tomato plant or plant material that has been modified to reduce the level, activity or expression of Pub21 protein, thereby conferring increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material.

[0011] In one embodiment, the tomato plant or plant material has been modified to reduce the level, activity or expression of Pub21 protein and Pub17 protein. Thus, in one embodiment, there is a tomato plant or plant material that has been modified to reduce the level, activity or expression of Pub21 protein and has also been modified to reduce the level, activity or expression of Pub17 protein, thereby conferring increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material.

[0012] In one embodiment, the tomato plant or plant material comprises a modified Pub21 allele and optionally a modified Pub17 allele. In one embodiment, the plant or plant material comprises a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, wherein the Pub21 allele comprises a mutation, and optionally further comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, wherein the Pub17 allele comprises a mutation. In one embodiment, the modified Pub21 allele and optionally the Pub17 allele confer increased resistance to lesion-forming pathogens relative to a reference tomato plant or plant material. Thus, in one embodiment, there is a tomato plant or plant material comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, wherein the Pub21 allele comprises a mutation that reduces Pub21 protein levels, activity or expression, thereby conferring increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material. In another embodiment, there is a tomato plant or plant material comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, wherein the Pub21 allele and the Pub17 allele each comprise a mutation that reduces the level, activity or expression of the Pub21 protein and the Pub17 protein, respectively, thereby conferring increased resistance to lesion-forming pathogens relative to a reference tomato plant or plant material.

[0013] According to a second aspect of the present invention there is provided a method of increasing resistance of a tomato plant or plant material to a lesion forming pathogen, the method comprising reducing the level, activity or expression of Pub21 protein in the tomato plant or plant material.

[0014] In one embodiment, the method according to the second aspect of the invention further comprises reducing the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0015] In one embodiment, the method comprises modifying the tomato plant to reduce the level, activity or expression of Pub21 protein in the tomato plant or plant material. In one embodiment, the method comprises modifying the tomato plant to reduce the level, activity or expression of Pub21 protein and Pub17 protein in the tomato plant or plant material. Thus, in one embodiment, there is a method of increasing resistance of a tomato plant or plant material to a lesion forming pathogen, the method comprising modifying the tomato plant to reduce the level, activity or expression of Pub21 protein and optionally Pub17 protein in the tomato plant or plant material.

[0016] In one embodiment, the method comprises obtaining a mutant population of tomato plants, and selecting tomato plants comprising a modified Pub21 allele. In one embodiment, the method comprises obtaining a mutant population of tomato plants, and selecting tomato plants comprising a modified Pub21 allele and a modified Pub17 allele. In one embodiment, the method comprises selecting a tomato plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or a straight homologue or homologue thereof and containing a mutation, and optionally wherein the plant further comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or a straight homologue or homologue thereof and containing a mutation.

[0017] Thus, in one embodiment, there is a method of increasing resistance of a tomato plant or plant material to a lesion-forming pathogen, the method comprising obtaining a mutant population of tomato plants, and selecting plants comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutation that reduces the level, activity or expression of Pub21 protein. In another embodiment, the method of increasing the resistance of tomato plants or plant materials to lesion-forming pathogens comprises obtaining a mutant population of tomato plants, and selecting a plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutation, the plant further comprising a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutation, wherein the Pub21 allele and the Pub17 allele respectively reduce the level, activity or expression of Pub21 protein and Pub17 protein.

[0018] In one embodiment, the increased resistance may be relative to a reference tomato plant or plant material.

[0019] According to a third aspect of the present invention there is provided a method of producing a tomato plant with increased resistance to lesion forming pathogens, the method comprising reducing the level, activity or expression of Pub21 protein in the tomato plant or plant material.

[0020] In an embodiment according to the third aspect of the present invention, the method further comprises reducing the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0021] In one embodiment, the method comprises modifying the tomato plant to reduce the level, activity or expression of Pub21 protein in the tomato plant or plant material, and optionally the method further comprises modifying the tomato plant or plant material to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material. Thus, in one embodiment, there is a method of producing a tomato plant with increased resistance to a lesion forming pathogen, the method comprising modifying the plant to reduce the level, activity or expression of Pub21 protein in the tomato plant or plant material, and optionally further comprising modifying the plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0022] In one embodiment, the method comprises obtaining a mutant population of tomato plants, and selecting plants comprising a modified Pub21 allele and optionally further comprising a modified Pub17 allele. In one embodiment, the method comprises selecting a tomato plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and comprising a mutation, and optionally wherein the plant further comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and comprising a mutation.

[0023] Thus, in one embodiment, there is a method for producing a tomato plant with increased resistance to lesion-forming pathogens, the method comprising obtaining a mutant population of tomato plants, and selecting a modified tomato plant comprising a modified Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutation that reduces Pub21 protein levels, activity or expression, and optionally wherein the plant further comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutation that reduces Pub17 protein levels, activity or expression.

[0024] In one embodiment, the increased resistance may be relative to a reference tomato plant or plant material.

[0025] According to a fourth aspect of the present invention, there is provided a method for enhancing the growth of a tomato plant by increasing the resistance of the tomato plant or plant material to a lesion forming pathogen, the method comprising reducing the level, activity or expression of Pub21 protein in the tomato plant or plant material.

[0026] In an embodiment of the fourth aspect of the present invention, the method further comprises reducing the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0027] In one embodiment, the method comprises modifying the tomato plant to reduce the level, activity or expression of Pub21 protein in the tomato plant or plant material. In one embodiment, the method comprises modifying the tomato plant to reduce the level, activity or expression of Pub21 protein in the tomato plant or plant material and to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0028] Thus, in one embodiment, there is a method of enhancing the growth of a tomato plant by increasing the resistance of a tomato plant or plant material to a lesion forming pathogen, the method comprising modifying the tomato plant to reduce the level, activity or expression of a Pub21 protein in the tomato plant or plant material, and optionally further comprising modifying the tomato plant to reduce the level, activity or expression of a Pub17 protein in the tomato plant or plant material.

[0029] In one embodiment, the method comprises obtaining a mutant population of tomato plants, and selecting plants comprising a modified Pub21 allele. In one embodiment, the method comprises obtaining a mutant population of tomato plants, and selecting plants comprising a modified Pub21 allele and a modified Pub17 allele. In one embodiment, the method comprises selecting a tomato plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutation, and optionally wherein the plant further comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutation. Therefore, in one embodiment, there is a method for enhancing the growth of a tomato plant by increasing the resistance of a tomato plant or plant material to a lesion-forming pathogen, the method comprising obtaining a mutant population of tomato plants, and selecting a modified plant comprising a modified Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutation that reduces the level, activity or expression of Pub21 protein, and optionally wherein the plant further comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutation that reduces the level, activity or expression of Pub17 protein.

[0030] In one embodiment, the increased resistance may be relative to a reference tomato plant or plant material.

[0031] According to a fifth aspect of the present invention, there is provided a method for identifying a tomato plant having increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material, the method comprising: determining the level, activity or expression of a Pub21 protein in one or more tomato plants, and comparing it with the level, activity or expression of a Pub21 protein in a reference tomato plant, and selecting a tomato plant having a reduced level, activity or expression of the Pub21 protein relative to the reference tomato plant, wherein a reduction in the level, activity or expression of the Pub21 protein indicates increased resistance to a lesion-forming pathogen relative to the reference tomato plant.

[0032] In an embodiment of the fifth aspect of the invention, the method for identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material further comprises: determining the level, activity or expression of a Pub17 protein in one or more tomato plants, and comparing it with the level, activity or expression of a Pub17 protein in a reference tomato plant, and selecting a tomato plant having a reduced level, activity or expression of the Pub17 protein relative to the reference tomato plant, wherein a reduction in the level, activity or expression of the Pub17 protein indicates increased resistance to a lesion forming pathogen relative to the reference tomato plant.

[0033] In one embodiment, the method comprises the step of obtaining a mutant population of tomato plants. In one embodiment, a method of identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material is provided, the method comprising: obtaining a mutant population of tomato plants, determining the level, activity or expression level of Pub21 protein in one or more tomato plants in the tomato plant population, and comparing it to the level, activity or expression of Pub21 protein in a reference tomato plant, selecting a plant having a reduced level, activity or expression of Pub21 protein relative to the reference tomato plant, wherein a reduced level, activity or expression of Pub21 protein indicates increased resistance to a lesion forming pathogen relative to the reference tomato plant.

[0034] In another embodiment, a method for identifying a tomato plant having increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material is provided, the method comprising: obtaining a mutant population of tomato plants, determining the level, activity or expression level of Pub21 protein and Pub17 protein in one or more tomato plants in the tomato plant population, and comparing it with the level, activity or expression of Pub21 protein and Pub17 protein in a reference tomato plant, and selecting a plant with reduced level, activity or expression of the Pub21 protein and Pub17 protein relative to the reference tomato plant, wherein a reduction in the level, activity or expression of the Pub21 protein and the Pub17 protein indicates increased resistance to a lesion-forming pathogen relative to the reference tomato plant.

[0035] In one embodiment, the method comprises obtaining a mutant population of tomato plants, and screening for tomato plants comprising a modified Pub21 allele and optionally a modified Pub17 allele. In one embodiment, the method comprises screening for a tomato plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and comprising a mutation, and optionally wherein the plant comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and comprising a mutation. Therefore, in one embodiment, there is a method for identifying a tomato plant having increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material, the method comprising: obtaining a mutant population of tomato plants, screening the tomato plant population for the presence of a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or a direct homolog or homolog thereof and containing a mutation that reduces the level, activity or expression of Pub21 protein, and selecting a tomato plant having the Pub21 allele. Therefore, in another embodiment, there is a method for identifying a tomato plant having increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material, the method comprising: obtaining a mutant population of tomato plants, screening the tomato plant population for the presence of a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutation that reduces the level, activity or expression of Pub21 protein, and a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutation that reduces the level, activity or expression of Pub17 protein, and selecting tomato plants having both the Pub21 allele and the Pub17 allele.

[0036] According to a sixth aspect of the present invention, there is provided a plant part obtained from the tomato plant of the first aspect.

[0037] In one embodiment, the plant part is a fruit. In one embodiment, the plant part comprises a modified Pub21 allele and optionally a modified Pub17 allele. In one embodiment, the plant part comprises a tomato plant having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutated Pub21 allele, and optionally further comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutated Pub17 allele.

[0038] According to a seventh aspect of the present invention, there is provided a seed capable of producing the tomato plant of the first aspect.

[0039] In one embodiment, the seed comprises a modified Pub21 allele. In one embodiment, the seed comprises a modified Pub21 allele and a modified Pub17 allele. In one embodiment, the seed comprises a tomato plant having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and containing a mutated Pub21 allele, and optionally further comprises a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and containing a mutated Pub17 allele.

[0040] According to the eighth aspect of the present invention, an isolated polynucleotide sequence is provided, which has at least 70% identity with SEQ ID NO:1 (wild-type Pub21 allele) or its direct homolog or homolog, wherein the sequence contains a mutation at position 890 of SEQ ID NO:1 or at a position corresponding thereto.

[0041] In one embodiment, the isolated polynucleotide comprises or consists of the sequence according to SEQ ID NO:2.

[0042] In one embodiment, the isolated polynucleotide sequence is capable of conferring increased resistance to lesion forming pathogens. Suitably, it is capable of conferring increased resistance to lesion forming pathogens when expressed in a plant or plant material.

[0043] According to the ninth aspect of the present invention, there is provided an isolated polypeptide sequence encoded by the polynucleotide sequence of the eighth aspect.

[0044] In one embodiment, the isolated polypeptide sequence consists of the amino acid sequence according to SEQ ID NO: 4 (truncated Pub21 protein sequence) or a portion thereof or an amino acid sequence having at least 70% identity thereto.

[0045] In one embodiment, the isolated polypeptide sequence is capable of conferring increased resistance to lesion forming pathogens. Suitably, when present in a plant or plant material, it is capable of conferring increased resistance to lesion forming pathogens.

[0046] According to the tenth aspect of the present invention, a vector or expression construct is provided, which vector or expression construct comprises the polynucleotide sequence of the eighth aspect.

[0047] In one embodiment, the vector or expression construct may further comprise a polynucleotide sequence encoding a modified Pub17 allele. In one embodiment, the polynucleotide sequence encoding the modified Pub17 allele has at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, wherein the sequence comprises a mutation at position 1477 of SEQ ID NO: 39 or a position corresponding thereto.

[0048] According to the eleventh aspect, a host cell is provided, the host cell comprising the polynucleotide sequence according to the eighth aspect, the vector according to the tenth aspect, or the polypeptide according to the ninth aspect.

[0049] In one embodiment, the host cell may further comprise a polynucleotide sequence encoding a modified Pub17 allele or a vector encoding a modified Pub17 allele. In one embodiment, the polynucleotide sequence encoding the modified Pub17 allele has at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, wherein the sequence comprises a mutation at position 1477 of SEQ ID NO: 39 or a position corresponding thereto.

[0050] According to a twelfth aspect, there is provided a method of producing hybrid seeds, the method comprising crossing a first tomato plant of the first aspect with a second tomato plant and obtaining seeds therefrom.

[0051] According to the thirteenth aspect, a kit for detecting lesion-forming pathogen-resistant Pub21 alleles in tomato plants is provided, the kit comprising a PCR oligonucleotide primer pair, wherein the primer pair comprises: a forward primer of SEQ ID NO:11 and a reverse primer of SEQ ID NO:12; or a forward primer of SEQ ID NO:36, a first reverse primer of SEQ ID NO:38 and a second reverse primer of SEQ ID NO:37.

[0052] In one embodiment, the kit is for use in gene-specific PCR and comprises a forward primer of SEQ ID NO:11 and a reverse primer of SEQ ID NO:12.

[0053] In one embodiment, the kit is for use in allele-specific PCR and comprises a forward primer of SEQ ID NO:36, a first reverse primer of SEQ ID NO:38, and a second reverse primer of SEQ ID NO:37.

[0054] In an embodiment of the thirteenth aspect, a kit for detecting a lesion-forming pathogen-resistant Pub17 allele in a tomato plant is further provided, the kit comprising a PCR oligonucleotide primer pair, wherein the primer pair comprises: a forward primer of SEQ ID NO:42 and a reverse primer of SEQ ID NO:41; or a first forward primer of SEQ ID NO:44, a second forward primer of SEQ ID NO:43, and a reverse primer of SEQ ID NO:45.

[0055] In one embodiment, the kit is for use in gene-specific PCR and comprises a forward primer of SEQ ID NO:42 and a reverse primer of SEQ ID NO:41.

[0056] In one embodiment, the kit is for use in allele-specific PCR and comprises a first forward primer of SEQ ID NO:44, a second forward primer of SEQ ID NO:43, and a reverse primer of SEQ ID NO:45.

[0057] The present invention exploits the principle of a mutated S-gene to achieve resistance against lesion-forming pathogens, rather than using classical R-genes or introgression of several (minor) effector QTLs.

[0058] The inventors have further discovered that Solanaceae plants carrying a mutant dysfunctional allele of the S-gene Pub21 have increased resistance to pathogens, especially to lesion-forming pathogens. Examples demonstrate that Solanaceae plants homozygous for this mutant Pub21 allele have significantly reduced susceptibility to necrotrophic pathogens, including Botrytis and Alternaria. The inventors have shown that this is the case in several different genetic backgrounds.

[0059] In addition, the inventors identified a novel S-gene Pub17, which was previously not known to be a susceptibility gene in Solanaceae species. The inventors further discovered that Solanaceae plants carrying mutated dysfunctional alleles of both S-genes Pub21 and Pub17 have even more increased pathogen resistance, especially resistance to lesion forming pathogens. Advantageously, the combination of mutated dysfunctional alleles of S-genes Pub21 and Pub17 has a synergistic effect in increasing pathogen resistance.

[0060] Advantageously, the Pub21 allele, and optionally the Pub17 allele, may be used in crop breeding to obtain a population of Solanaceae plants that is less susceptible to severe disease from necrotrophic pathogens than current cultivars.

[0061] The present invention thus provides an alternative solution to the problem of controlling lesion-forming pathogens in Solanaceae crops, which solution is much simpler than using QTLs or R-genes. Given that Solanaceae is one of the largest crop plant families, containing not only tomatoes but also potatoes and peppers, such resistant plants of the present invention are of economic interest. The present invention can be used to limit the damage caused by these pathogens and increase the yield of Solanaceae crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 shows : Diagram representing the pedigree of the M2042 mutant. A. Selfing generations of M2042 in the Micro-Tom (MT) background. B. Hybrid generations after crossing the resistant M4 plant M2042-1-3-10 with Moneymaker (MM). IR, moderately resistant; S, susceptible. C. Selfing generations of M2042 in the Micro-Tom (MT) background according to (A), and additional hybrid generations with MM. D. Hybrid generations after crossing the resistant M4 plant M2042-1-3-10 with Moneymaker (MM) according to (B), with additional hybrid generations shown.

[0063] Figure 2 Shows: Mutant M2042 candidate gene Pub21 with reduced susceptibility to Botrytis cinerea. Tomato Pub21 (Solyc11g006030) has the following two domains: U-box domain (amino acids 22-94) and ARM armadillo repeat sequence (amino acids 192-364). Mutations in the ARM repeat sequence domain produce premature stop codons.

[0064] Figure 3 Shows : Plot of relative gene expression levels of candidates Pub17 (panel A) and Pub21 (panel B) in wild-type Little Tom (MT) and Botrytis resistant double mutant plants M2042-1-3-14 (3-14) after infection with Botrytis cinerea. hpi, hours post infection.

[0065] Figure 4 Shows : Graphs showing average lesion diameters of single Pub17 mutants and single Pub21 mutants and double pub17pub21 mutants compared to Moneymaker after Botrytis infection. A, Results at 3 days post inoculation (dpi); B, Results at 4 dpi.

[0066] Figure 5 It shows: Positions of selected RNAi fragments for SlPub21 (Solyc11g006030).

[0067] Figure 6 Shows : Graph of relative expression levels of tomato Pub21 in RNAi T3 families compared to untransformed Moneymaker (MM) as determined by qRT-PCR using EF1α as reference gene. The coding of the T3 families is explained in Table 3.

[0068] Figure 7 Shows : Box plots of the diameter size of Botrytis cinerea lesions on leaves from the Pub21 RNAi T3 family, with two negative controls (TV202240 and MM) on the left side of each panel. A, results at 3 days post inoculation (dpi); B, results at 4 dpi.

[0069] Figure 8 Shows : Locations of three sgRNAs targeting tomato Pub21 (Solyc11g006030) and primers used to detect mutations.

[0070] Fig. 9 Shows : Box plots of diameter size of Botrytis cinerea lesions on leaves from Pub21 CRISPR mutant T3 families TV85, TV69 and TV81 compared to negative control Moneymaker (MM) and non-mutant T3 plants and families. A. Results at 3 days post inoculation (dpi). B. Results at 4 dpi.

[0071] Fig.10 Shows : Graph of mean lesion diameter size on leaves 5 days post inoculation (5 dpi) with Alternaria solani. MM, Moneymaker; MT, Tom Jr.

[0072] Fig.11 Shows : Box plots of diameters of A. solani lesions on leaves from Pub21 RNAi T3 families (including controls). Abbreviations for T3 families are explained in Table 3. A. Results at 5 days post inoculation (dpi). B. Results at 7 dpi.

[0073] Fig.12 Shows : Box plots of Alternaria solani lesion diameters on leaves from Pub21 CRISPR T3 families (including controls). Abbreviations for T3 families are explained in Table 6. A. Results at 5 days post inoculation (dpi). B. Results at 7 dpi.

[0074] Fig.13 It shows: The structure of the mutant M2042 candidate gene Pub17 with reduced susceptibility to Botrytis cinerea is provided. Tomato Pub17 (Solyc02g072080) has the following three domains: U-box N-terminal domain UND (amino acids 20-171), U-box domain (amino acids 297-364) and ARM armadillo repeat sequence (amino acids 429-682) (deduced by comparison with potato StPub17, Ni et al. 2010). A SNP at position 1477 was identified, which produces a premature stop codon at amino acid R493.

[0075] Fig.14 Shows : Relative gene expression levels of mutant Pub17 candidate genes in wild-type Little Tom (MT) and Botrytis cinerea resistant mutant plants M2042-1-1-17 and M2042-1-2-12 after infection with Botrytis cinerea. hpi, hours post infection.

[0076] Fig.15 Shows : Location of selected RNAi fragments used to silence Pub17 expression.

[0077] Fig.16 Shows : Relative expression levels of tomato Pub17 in RNAi transformants compared to untransformed Moneymaker (MM) as determined by qPCR using EF1α as reference gene. T1 plants 3-5 and 3-29 (indicated by arrows) were selected for further analysis.

[0078] Fig.17 Shows: Box plots of diameter size of Botrytis cinerea lesions on leaves from Pub17 RNAi T3 family, with two negative controls (MM and TV24) on the left side of each panel. Left panel, results at 3 days post inoculation (dpi); right panel, results at 4 dpi. Different letters above the box plots indicate significant differences, as calculated by Tukey HSD method.

[0079] Fig.18 Shows : Box plots of the diameter size of Botrytis cinerea lesions on leaves from Pub17 RNAi T2 family TV181105 (TV05, plants containing NPTII), with two negative controls (MM and TV181105 plants without NPTII) on the left side of each panel. Left panel, results at 3 days post inoculation (dpi); right panel, results at 4 dpi. Different letters above the box plots indicate significant differences, as calculated by the Tukey HSD method.

[0080] Fig.19 Shows : Location of four sgRNAs targeting the tomato Pub17 gene using CRISPR / Cas9.

[0081] Fig. 20 Shows : Four CRISPR / Cas9 Pub17 transformants, which showed smaller bands than the expected wild-type Moneymaker (MM) control, indicating that deletion had occurred. Pub17 was amplified using primers FWD_MR_GX_CRISPR+REV_MR_GX_CRISPR (A) or AWPUB17_F1+REV_MR_GX_CRISPR (B). The PCR products were run on a 1% agarose gel with TAE. The size of the marker bands is indicated in bp.

[0082] Fig.21 Shows : CRISPR-induced mutations in the tomato Pub17 gene. Schematic representation of the tomato Pub17 genomic sequence. Individual exons are shown as solid arrows, with the locations of the four sgRNA target sites shown as asterisks. The expected PCR product for the wild-type allele is shown below the exon. The size of the deletion in the CRISPR transformant is indicated by the line above the exon.

[0083] Fig. 22 Shows : CRISPR-induced single nucleotide mutations at the target sites of sgRNA3 and sgRNA4 in the tomato Pub17 gene in CRISPR / Cas9 transformant 7.

[0084] Fig.23 Shows: Box plots of the diameter size of Botrytis cinerea lesions on leaves from Pub17 CRISPR mutant T3 families compared to negative control Moneymaker (MM) and non-mutant T2 families TV181133. A. Results at 3 days post inoculation (dpi). B. Results at 4 dpi.

[0085] Fig.24 It shows: Results of the Phytophthora infestans detached leaf assay for pub17 and pub21 mutants and the combined pub17 / pub21 mutant. Shown are the disease index scores from low (1) to high (6) for each mutant at 4 and 7 days after inoculation.

[0086] Further features and embodiments of the invention will now be described under the heading sections.Any feature in any section may be combined with any of the above-described aspects or embodiments of the invention in any feasible combination. DETAILED DESCRIPTION

[0087] definition

[0088] If not otherwise indicated below, the technical terms and expressions used within the scope of the present application are generally given the meanings commonly applied thereto in the fields related to plant breeding and cultivation.

[0089] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes one or more plants, and reference to "a cell" includes mixtures of multiple cells, tissues, etc.

[0090] As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the stated amount in some embodiments, ±10% from the stated amount in some embodiments, ±5% from the stated amount in some embodiments, ±1% from the stated amount in some embodiments, ±0.5% from the stated amount in some embodiments, and ±0.1% from the stated amount in some embodiments, as such variations are appropriate in the context of the present invention.

[0091] "Cultivated" plants are understood within the scope of the present invention to mean plants that are no longer in their natural state, but have been developed and domesticated by human care and are used for agricultural purposes and / or for human consumption, and do not include wild germplasm. For example, in an embodiment, a "cultivated plant" is a hybrid plant.

[0092] In the scope of the present invention, "allele" is understood to refer to the alternative or variant forms of different genetic units that are identical or relevant to the different forms of a gene, which are alternative in heredity because they are at the same locus of a homologous chromosome. Such alternative or variant forms can be the result of a single nucleotide polymorphism, insertion, inversion, translocation or disappearance, or the result of gene regulation (caused by, for example, chemical or structural modification), transcriptional regulation or post-translational modification / regulation. In diploid cells or organisms, two alleles of a given gene or genetic element typically occupy a corresponding locus on a homologous chromosome.

[0093] The term "trait" refers to a characteristic or phenotype. In the context of the present invention, a nematode resistance trait is an improved nematode resistance trait. Traits can be inherited in a dominant or recessive manner or in a partially or incompletely dominant manner. Traits can be monogenic or polygenic, or can be produced by the interaction of one or more genes with the environment. Traits in plants can be homozygous or heterozygous.

[0094] The terms "hybrid," "hybrid plant," and "hybrid progeny" refer to individuals produced from genetically different parents (eg, individuals that are genetically heterozygous or predominantly heterozygous).

[0095] The term "inbred strain" refers to a population that is homozygous or nearly homozygous genetically. For example, an inbred strain can be obtained by several cycles of brother / sister breeding or selfing or doubled haploid production.

[0096] The term "doubled haploid line" refers to a stable inbred line derived from anther culture. Some pollen grains (haploid) cultured in a specific culture medium and environment can develop into plantlets containing n chromosomes. These plantlets are then "doubled" and contain 2n chromosomes. The offspring of these plantlets are called "doubled haploids" and are essentially no longer segregating (stable).

[0097] The term "cultivar" or "variety" refers to a horticulturally derived variety that is different from the naturally occurring variety. In some embodiments of the invention, the cultivar or variety is commercially valuable.

[0098] The term "stock" refers to a plant used as a scion plant receptacle. Typically, the stock plant and the scion plant have different genotypes. In an embodiment, a plant according to the present invention is used as a stock plant.

[0099] The term "genetically fixed" refers to a genetic element that has been stably incorporated into a plant genome that does not normally contain the genetic element. When genetically fixed, the genetic element can be spread to other plants in an easy and predictable manner through sexual hybridization.

[0100] A "plant cell" is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. A plant cell may be in the form of an isolated single cell or a cultured cell, or as part of a higher organized unit such as, for example, a plant tissue, a plant organ, or a whole plant.

[0101] "Plant cell culture" means a culture of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various stages of development.

[0102] A "plant organ" is a distinct and distinct structured and differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.

[0103] As used herein, "plant tissue" means a group of plant cells organized into structural and functional units. Any plant tissue in a plant or in culture is included. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into structural and / or functional units. The use of this term in conjunction with any specific type of plant tissue as listed above or otherwise covered by this definition or alone is not intended to exclude any other type of plant tissue.

[0104] As used herein, the term "breeding" and its grammatical variants refer to any process of producing progeny individuals. Breeding can be sexual or asexual, or any combination thereof. Exemplary non-limiting breeding types include hybridization, selfing, generation of doubled haploid derivatives, and combinations thereof.

[0105] As used herein, phrase " breeding population established " refers to the set of potential breeding partners produced by the parent in a breeding program (for example, a commercial breeding program) and / or used as a parent. The members of the breeding population established are typically fully characterized in terms of gene and / or phenotype. For example, several phenotypic traits of interest may have been evaluated, for example under different environmental conditions, in multiple locations and / or at different times. Alternatively or in addition, one or more genetic loci relevant to the expression of phenotypic traits may have been identified, and one or more members of the breeding population may have been genotyped with respect to the one or more genetic loci and with respect to the one or more gene markers relevant to the one or more genetic loci.

[0106] As used herein, the phrase "diploid individual" refers to an individual having two sets of chromosomes, typically one set from each of its two parents. However, it should be understood that in some embodiments, a diploid individual may receive its "maternal" and "paternal" sets of chromosomes from the same single organism, such as when a plant self-pollinates to produce successive generations of plants.

[0107] "Homozygous" is understood within the scope of the present invention to mean identical alleles at one or more corresponding loci on homologous chromosomes.

[0108] "Heterozygous" is understood within the scope of the present invention to mean different alleles at one or more corresponding loci on homologous chromosomes.

[0109] A "dominant" allele is understood within the scope of the present invention to mean an allele which determines the phenotype when present in the heterozygous or homozygous state. A "recessive" allele is an allele which determines the phenotype when present only in the homozygous state.

[0110] "Genetic locus" is understood within the scope of the present invention to mean a region on a chromosome that contains a gene or any other genetic element or factor that contributes to a trait.

[0111] As used herein, "marker locus" refers to a region on a chromosome that contains nucleotides or polynucleotide sequences that are present in an individual's genome and are associated with one or more loci of interest, which may include genes or any other genetic determinants or factors that contribute to a trait."Marker locus" also refers to a region on a chromosome that contains a polynucleotide sequence that is complementary to a genomic sequence (such as a sequence of a nucleic acid used as a probe).

[0112] As used herein, the phrases "sexual crossing" and "sexual reproduction" in the context of the presently disclosed subject matter refer to the fusion of gametes to produce offspring (e.g., by fertilization, such as in plants by pollination to produce seeds). In some embodiments, "sexual crossing" or "cross-fertilization" is the fertilization of one individual by another individual (e.g., cross-pollination in plants). The term "selfing" in some embodiments refers to the production of seeds by self-fertilization or self-pollination; that is, the pollen and ovules are from the same plant.

[0113] As used herein, phrase "genetic marker" refers to the feature (for example, present in the nucleotide or polynucleotide sequence in the individual genome) associated with one or more loci of interest in an individual genome. In certain embodiments, gene marker is polymorphic in a colony of interest, or loci are occupied by polymorphism, depending on context.Genetic marker includes for example single nucleotide polymorphism (SNP), indel (that is, insertion / deletion), simple sequence repeat (SSR), restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), cutting amplified polymorphic sequence (CAPS) mark, diversity array technology (DArT) mark and amplified fragment length polymorphism (AFLP) and many other examples.Genetic marker can be for example used for locating the genetic locus of the allele that comprises the variability that contributes to phenotypic traits on chromosome.Phrase "genetic marker" can also refer to the polynucleotide sequence complementary to genomic sequence (such as the sequence of the nucleic acid used as probe).

[0114] "Gene marker" can be physically located on a chromosome with a genetic locus associated therewith inside or outside (i.e., correspondingly inside or outside a gene). In other words, although the position of a gene or functional mutation on a chromosome corresponding to a locus of interest (e.g., inside a control element outside a gene) has not yet been identified and a non-zero recombination ratio is typically used between a gene marker and a locus of interest, the subject matter disclosed by the present invention can also use a gene marker physically located within the border of a genetic locus (e.g., inside a genomic sequence corresponding to a gene, such as, but not limited to, a polymorphism within an intron or exon of a gene). In some embodiments of the subject matter disclosed by the present invention, one or more gene markers are included in between one and ten markers, and in some embodiments, one or more gene markers include more than ten gene markers.

[0115] As used herein, the term "genotype" refers to the genetic makeup of a cell or organism. "A set of gene-marked genotypes" of an individual include the specific alleles of one or more gene marker loci present in the haplotype of the individual. As known in the art, genotypes can relate to a single locus or multiple loci, whether these loci are related or unrelated, and / or are linked or non-linked. In certain embodiments, the genotype of an individual relates to one or more related genes, because one or more of these genes participate in the expression of a phenotype of interest (e.g., quantitative traits as defined herein). Thus, in certain embodiments, genotypes include the summary of one or more alleles present at one or more genetic loci of an individual intrinsic quantitative trait. In certain embodiments, genotypes are represented by haplotypes (defined below).

[0116] As used herein, the term "germplasm" refers to the totality of the genotype of a population or other individual group (e.g., species). The term "germplasm" can also refer to plant material, e.g., a group of plants that serve as a repository of different alleles. The phrase "adapted germplasm" refers to plant material that has been confirmed to have genetic advantages; for example, for a given environment or geographic region, the phrases "unadapted germplasm," "original germplasm," and "exotic germplasm" refer to plant material with unknown or unconfirmed genetic value; for example, for a given environment or geographic region; like this, the phrase "unadapted germplasm" refers in some embodiments to plant material that does not belong to an established breeding population and has no known relationship with a member of an established breeding population.

[0117] As used herein, the phrase "nucleic acid" refers to any physical monomer unit string that can correspond to a string of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA, or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases that are not typical for biological RNA or DNA, such as 2'-O-methylated oligonucleotides), etc. In some embodiments, nucleic acids can be single-stranded, double-stranded, multi-stranded, or a combination thereof. Unless otherwise indicated, a specific nucleic acid sequence of the subject matter disclosed herein optionally includes or encodes a complementary sequence in addition to any sequence explicitly indicated.

[0118] As used herein, the term "plurality" refers to more than one. Thus, "plurality of individuals" refers to at least two individuals. In some embodiments, the term plurality refers to more than half of a whole. For example, in some embodiments, "plurality of a population" refers to more than half of the members of that population.

[0119] As used herein, the term "progeny" refers to one or more offspring of a particular cross. Typically, progeny are produced by the breeding of two individuals, but some species (particularly some plants and hermaphroditic animals) can be selfed (i.e., the same plant serves as the donor of both male and female gametes). The one or more offspring can be, for example, F 1 、F 2 or any succession.

[0120] The term "recipient plant" is used herein to indicate a plant that will receive DNA obtained from a donor plant, the DNA comprising a modified allele to improve lesion-forming pathogen resistance.

[0121] "Donor plant" is understood within the scope of the present invention to mean a plant that provides modified alleles associated with improved resistance to lesion-forming pathogens. As used herein, the phrase "quality trait" refers to a phenotypic trait controlled by one or a few genes that exhibit a major phenotypic effect. Thus, quality traits are usually simply inherited.

[0122] "Marker-based selection" is understood within the scope of the present invention to mean the detection of one or more nucleic acids from a plant (wherein the nucleic acid is associated with a desired trait), for example using a genetic marker, to identify plants carrying the gene for the desired (or undesirable) trait, so that those plants can be used (or avoided) in a selective breeding program.

[0123] "Single nucleotide polymorphism (SNP)" is a DNA sequence variation that occurs when a single nucleotide in a genome (or other consensus sequence) - A, T, C or G - differs between paired chromosomes of members of a biological species or individuals. For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. In this case, there are two alleles: C and T. The basic principles of SNP arrays are the same as DNA microarrays. These are a fusion of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of SNP arrays are an array containing nucleic acid sequences (i.e., amplified sequences or targets), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets hybridization signals.

[0124] "PCR (polymerase chain reaction)" is understood within the scope of the present invention to mean a method for generating relatively large amounts of specific regions of the genomic DNA or one or more subsets, thereby allowing for possible different analyses based on those regions.

[0125] "PCR primer" is understood within the scope of the present invention to mean a relatively short single-stranded DNA fragment used in PCR amplification of a specific region of DNA.

[0126] "Phenotype" is understood within the scope of the present invention to mean one or more distinguishable characteristics of a genetically controlled trait.

[0127] As used herein, the phrase "phenotypic trait" refers to an outward or other detectable characteristic in an individual resulting from the interaction of the individual's genome, proteome, and / or metabolome with the environment.

[0128] "Polymorphism" is understood within the scope of the present invention to mean the presence in a population of two or more different forms of a gene, a genetic marker or a genetic trait or a gene product obtainable, for example, by alternative splicing, DNA methylation, etc.

[0129] "Selective breeding" is understood within the scope of the present invention to mean a breeding program which uses plants having or showing desirable traits as parents.

[0130] "Tester" plants are understood within the scope of the present invention to mean plants used to genetically characterize traits in test plants. Typically, the test plant is crossed with a "tester" plant and the segregation ratio of the trait in the hybrid progeny is scored.

[0131] As used herein, "probe" refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cell structure and thus allow the detection of the target molecule or structure. In particular, "probe" refers to a labeled DNA or RNA sequence that can be used to detect the presence of a complementary sequence and quantify it by molecular hybridization.

[0132] As used herein, the term "hybridization" refers to conventional hybridization conditions, preferably the following hybridization conditions, wherein 5xSSPE, 1% SDS, 1 times Denhardt solution (Denhardts solution) are used as solutions, and / or the hybridization temperature is between 35°C and 70°C, preferably 65°C. After hybridization, preferably washing is first performed with 2xSSC, 1% SDS, and then washing with 0.2xSSC at a temperature between 35°C and 75°C (especially between 45°C and 65°C, especially 59°C) (for the definition of SSPE, SSC and Denhardt solution, see Sambrook et al. in the above citation). High stringency hybridization conditions such as described by Sambrook et al. above are particularly preferred. If hybridization and washing occur at 65°C as described above, for example, there are particularly preferred stringent hybridization conditions. Non-stringent hybridization conditions such as hybridization and washing performed at 45°C are less preferred and are even less preferred at 35°C.

[0133] According to the present invention, the term "position corresponding to position X" (X being any number that can be found in the corresponding context of the present application) includes not only the corresponding position in the subsequently mentioned SEQ ID NO, but also any sequence corresponding to Pub21 alleles and optionally Pub17 alleles or encoding Pub21 protein and optionally Pub17 protein, wherein, after alignment with the reference SEQ ID NO, the corresponding position may have a different number, but corresponds to the number indicated by the reference SEQ ID NO. The alignment of Pub21 alleles or Pub21 protein sequences and optionally the alignment of Pub17 alleles or Pub17 protein sequences can be achieved by applying various alignment tools in a reasonable manner, for example by applying the tools described below.

[0134] "Sequence identity". In the context of two or more nucleic acids or protein sequences, the term "identical" or "identity" refers to, as measured using one of the following sequence comparison algorithms or by visual estimation, when comparing and aligning maximum correspondence, two or more sequences or subsequences are identical or have a specified percentage of identical amino acid residues or nucleotides. If the two sequences compared to each other are of different lengths, sequence identity preferably relates to the percentage of nucleotide residues of the shorter sequence with the nucleotide residues of the longer sequence having identity. As used herein, the number of spaces and the length of each space (need to introduce them in the optimized comparison of the two sequences) are considered, and the percentage identity / homology between the two sequences is a function of the number of identical positions shared by the sequences (that is, the total number of the number / position of % identity=identical positions x 100). The comparison of sequences and the determination of the percentage identity between the two sequences can be completed using a mathematical algorithm, as described below. For example, sequence identity can be routinely determined using a computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489 to find the segment with the greatest sequence identity between two sequences. When Bestfit or another sequence alignment program is used to determine whether a particular sequence has, for example, 95% identity to a reference sequence of the present invention, the parameters are preferably adjusted so that the percentage of identity is calculated over the entire length of the reference sequence and to allow for homology gaps of up to 5% of the total number of nucleotides in the reference sequence. When using Bestfit, preferably the so-called optional parameters are kept at their preset ("default") values. Deviations occurring in a comparison between a given sequence and the above-mentioned sequences of the invention may be caused by, for example, additions, deletions, substitutions, insertions or recombination.Preferably, such sequence comparisons can also be performed using the program "fasta20u66" (version 2.0u66, September 1998, written by William R. Pearson and the University of Virginia; see also WRPearson (1990), Methods in Enzymology 183, 63-98, the examples attached, and http: / / workbench.sdsc.edu / ). For this purpose, the "default" parameter settings can be used.

[0135] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase: "specifically hybridizes" refers to a molecule that binds, duplexes or hybridizes only to a specific nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Substantially binds" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid, and encompasses minor mismatches, which can be accommodated by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence.

[0136] In the context of nucleic acid hybridization experiments (such as DNA hybridization and RNA hybridization), "stringent hybridization conditions" and "stringent hybridization wash conditions" are sequence-dependent and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization is found in the following literature: Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes [Biochemistry and Molecular Biology Laboratory Technology-Hybridization with Nucleic Acid Probes] Chapter 2 Part I "Overview of principles of hybridization and the strategy of nucleic acid probe assays [Hybridization principles and nucleic acid probe assay strategy overview]" Elsevier [Elsevier Group], New York. Usually, for a specific sequence at a defined ionic strength and pH, highly stringent hybridization and washing conditions are selected to be about 5°C lower than the thermal melting point. Typically, under "stringent conditions", the probe will hybridize to its target subsequence, but not to other sequences.

[0137] "Thermal melting point" is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes with a fully matched probe. Very stringent conditions are selected to be equal to the melting temperature (T.sub.m) of a specific probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids (which have more than 100 complementary residues on filter paper in a DNA or RNA blot) is 50% formamide with 1 mg of heparin, at 42 ° C, and the hybridization is carried out overnight. An example of high stringency washing conditions is 0.15 M NaCl, which lasts for about 15 minutes at 72 ° C. An example of stringent washing conditions is 0.2x SSC washing at 65 ° C for 15 minutes (for a description of SSC buffer, see Sambrook, below). Typically, low stringency washing is performed before high stringency washing to remove background probe signals. An example of medium stringency washing for a duplex of, for example, more than 100 nucleotides is 1x SSC at 45 ° C for 15 minutes. An example of low stringency washing for a duplex of, for example, more than 100 nucleotides is 4-6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve a salt concentration of less than about 1.0 M Na ions, typically about 0.01 to 1.0 M Na ion concentration (or other salts), at pH 7.0 to 8.3, and the temperature is typically at least about 30°C. Stringent conditions can also be achieved by adding a destabilizing agent such as formamide. Typically, in a specific hybridization assay, a signal-to-noise ratio of 2 times (or higher) observed for non-related probes indicates that specific hybridization has been detected. If the proteins encoded by nucleic acids that do not hybridize to each other under stringent conditions are substantially identical, the nucleic acids remain substantially identical. For example, when a nucleic acid copy is generated using the maximum codon degeneracy allowed by the genetic code, this occurs.

[0138] As used herein, "homologue" refers to a functionally equivalent protein, i.e., having the same activity as the Pub21 protein or Pub17 protein having an amino acid sequence as defined herein, but may have a limited number of amino acid substitutions, deletions, insertions or additions in the amino acid sequence. Homologues may have a lower sequence identity, such as at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or higher sequence identity with the Pub21 protein or Pub17 protein identified herein, but are able to perform the same function.

[0139] As used herein, an "orthologue" is a protein that is a homologue and therefore functionally equivalent but is found in a different species, ie has the same activity as a Pub21 protein or Pub17 protein as defined herein but is present in a different plant species.

[0140] Tomato Plants

[0141] As used herein, a "plant" is any plant at any stage of development. Suitably, in most embodiments of the invention, the plant is a tomato plant. Suitably, in most embodiments of the invention, the plant is any one of the following tomato species: Solanum lycopersicum, Solanum habrochaites, Solanum pimpinellifolium, Solanum pennellii, Solanum arcanum, Solanum cheesmaniae, Solanum chilense, Solanum chmielewskii, Solanum corneliomulleri, Solanum galapagense, Solanum neorickii, or Solanum peruvianum. Suitably, in most embodiments of the invention, the plant is a tomato plant.

[0142] Suitably, the plant may be any variety or cultivar of tomato such as, for example: alicante, adoration, azoychka, beefsteak, better boy, black krim, brandywine, campari, celebrity, cherokee, early girl, fourth of July, garden peach, gardeners delight, germajohnson, guilette F1, granadero, great white, green zebra, hanover, hillbilly, japanese black trifele, jersey boy, jubilee, Juliet, lillians yellow, matt's wildcherry, micro-tom, moneymaker, monterosa, montserrat, mortgage lifter, mr. stripey, pantano romanesco, plum, Raf, rebellion, currant, roma, Rutgers, san Marzano, Santorini, super sweet, tomacco, yellow pear, zebra. Suitably, the plant may be a cultivated tomato plant.

[0143] However, in some embodiments, the plant can be any Solanaceae plant. Suitably, the plant can be selected from any Solanaceae plant, such as tomato, tobacco, pepper, potato or eggplant. Suitably, the plant can be selected from any Solanaceae genus of plant, for example: Lycianthes, Cestrum, Nolana, Physalis, Lycium, Solanum, Brunfelsia and Nicotiana. Suitably, the plant may be selected from any Solanaceae species of plant, for example: potato (Solanum tuberosum), tomato (Solanum lycopersicum), bell pepper (Capsicum annuum), pepper species (Capsicum sp.), chili pepper (Capsicum frutescens), eggplant (Solanum melongena), cape gooseberry (Physalis peruviana), mint golden lantern (Physalis pruinosa), tomatillo (Physalis philadelphica), Nicotiana rustica (Nicotiana rustica) and common tobacco (Nicotiana tabacum).

[0144] Suitably, any reference to a tomato plant, part or material thereof as used herein may be replaced with another Solanaceae plant, part or material thereof.

[0145] In one embodiment, the plant is a crop, or an economically and / or agriculturally valuable plant. In one embodiment, the plant is a Solanum crop.

[0146] In some embodiments, the plant is an inbred plant, a doubled haploid plant, or a hybrid plant.

[0147] Plant parts or materials

[0148] The term "plant" or "plant part" or "plant material" refers hereinafter to a plant part, organ or tissue obtainable from a tomato plant according to the invention, including but not limited to leaves, stems, roots, flowers or flower parts, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, meristems, callus, seeds, cuttings, cells or tissue cultures. Suitably, any reference to a "plant" herein also encompasses a plant part or material.

[0149] Suitably the plant part or material may be any plant part, organ or tissue obtainable from a cultivated tomato plant, suitably from a cultivated tomato plant, suitably from a cultivated tomato plant of the present invention.

[0150] Suitably, the tomato plant part or material still exhibits improved resistance to lesion-forming pathogens compared to a reference tomato plant part or material. In some embodiments, this resistance may only exist when the part or material is grown into a tomato plant. Thus, suitably, the tomato plant part or material exhibits a reduction in the level, activity or expression of Pub21 protein compared to a reference tomato plant part or material, and optionally exhibits a reduction in the level, activity or expression of Pub17 protein. Suitably, the tomato plant part comprises a modified Pub21 allele and is suitably capable of expressing the modified Pub21 allele, and optionally the tomato plant part further comprises a modified Pub17 allele and is suitably capable of expressing the modified Pub17 allele.

[0151] Suitably, the term plant material may include propagation material obtainable from a tomato plant according to the present invention. Suitable propagation material may be cuttings, roots, fruits, tubers, bulbs, rhizomes, meristems, etc. Suitably, the propagation material still exhibits improved resistance to lesion-forming pathogens compared to a reference propagation material. Thus, suitably, the propagation material exhibits a reduction in the level, activity or expression of a Pub21 protein compared to a reference propagation material, and optionally further exhibits a reduction in the level, activity or expression of a Pub17 protein. Suitably, the propagation material comprises a modified Pub21 allele and optionally a modified Pub17 allele, and is suitably capable of expressing a modified Pub21 allele, and optionally suitably capable of expressing a modified Pub17 allele. Suitably, the propagation material can be propagated into tomato plants, suitably propagated into tomato plants with improved resistance to lesion-forming pathogens compared to reference tomato plants; suitably propagated into tomato plants with a reduction in the level, activity or expression of Pub21 protein compared to reference tomato plants and optionally further having a reduction in the level, activity or expression of Pub17 protein. Suitably propagated into tomato plants comprising a modified Pub21 allele and optionally further comprising a modified Pub17 allele and capable of expressing a modified Pub21 allele and optionally a modified Pub17 allele. "Propagation" refers to the process of growing a plant from a plant part or material (e.g., a plant protoplast or explant). Such regeneration techniques rely on the manipulation of certain plant hormones in tissue culture growth media. The choice of propagation step method is not important. See, for example, Ammirato et al., Handbook of Plant Cell Culture—Crop Species [Plant Cell Culture Manual—Crop Species] Macmillan Publ. Co. [Macmillan Publishing Company] (1984).

[0152] The invention also extends to fruit. In another aspect of the invention there is provided fruit produced by a tomato plant according to the invention.

[0153] Suitably, the fruit is a tomato fruit. Suitably, the fruit may be obtained from a cultivated tomato plant, more preferably a cultivated tomato plant of the present invention. Suitably, the tomato fruit still exhibits improved resistance to lesion-forming pathogens compared to a reference tomato fruit. Suitably, the tomato fruit exhibits a reduction in the level, activity or expression of the Pub21 protein compared to a reference tomato fruit, and optionally further comprises a reduction in the level, activity or expression of the Pub17 protein. Suitably, the tomato fruit comprises a modified Pub21 allele and is suitably capable of expressing the modified Pub21 allele, and optionally the tomato fruit further comprises a modified Pub17 allele and is suitably capable of expressing the modified Pub17 allele.

[0154] The invention also extends to one or more seeds. In another aspect of the invention there is provided a tomato seed produced by a plant according to the invention.

[0155] As used herein, "plant seeds" are seeds that grow into plants, suitably into tomato plants according to the present invention. The term "seed" encompasses all types of seeds and plant propagules, including but not limited to true seeds, seed pieces, suckers, grains, bulbs, fruits, tubers, grains, cuttings, cuttings, etc.

[0156] Suitably, the seed is capable of producing a tomato plant exhibiting improved resistance to lesion-forming pathogens compared to a reference tomato plant. Suitably, the seed exhibits a reduction in the level, activity or expression of a Pub21 protein and optionally a reduction in the level, activity or expression of a Pub17 protein compared to a reference tomato seed. Suitably, the seed comprises a modified Pub21 allele and is suitably capable of growing into a tomato plant expressing the modified Pub21 allele. Suitably, the seed comprises a modified Pub21 allele and a Pub17 allele and is suitably capable of growing into a tomato plant expressing the modified Pub21 allele and the Pub17 allele.

[0157] In one embodiment, the seed is a tomato seed that produces a tomato plant according to the invention. Suitably, the tomato seed can be obtained from a cultivated tomato plant, more preferably a cultivated tomato plant of the invention. Suitably, the tomato seed comprises a modified Pub21 allele and optionally further comprises a modified Pub17 allele, and is suitably capable of growing into a tomato plant expressing the modified Pub21 allele and optionally further expressing the modified Pub17 allele.

[0158] Seed can be treated or untreated seed. For example, seed can be treated to improve germination, for example by initiating seed, or by sterilizing to prevent seed-borne pathogens. In another example, seed can be coated with any available coating to improve, for example, plantability, seed emergence and protection for seed-borne pathogens. Seed coating can be any form of seed coating, including but not limited to pelleting, film coating and encrustation.

[0159] Methods for reducing the level, activity or expression of Pub21 protein

[0160] Suitably, the level, activity or expression of Pub21 protein and optionally the level, activity or expression of Pub17 protein in the tomato plants of the invention may be reduced by any means. However, suitably it is not reduced by an essentially biological process.

[0161] Suitably, the term "reducing the level, activity or expression of Pub21 protein" may refer to the underexpression, inhibition or temporal or spatial misexpression of Pub21 polypeptides in plants or plant materials and / or the biological effect or activity reduction of Pub21 proteins in plants or plant materials. Suitably, the term "reducing the level, activity or expression of Pub21 protein and Pub17 protein" may refer to the underexpression, inhibition or temporal or spatial misexpression of Pub21 polypeptides and Pub17 polypeptides in plants or plant materials and / or the biological effect or activity reduction of Pub21 protein and Pub17 protein in plants or plant materials.

[0162] Suitably, the term "reducing the level, activity or expression of Pub21 protein and optionally reducing the level, activity or expression of Pub17 protein" may refer to the underexpression, inhibition or temporal or spatial misexpression of Pub21 polypeptide and optionally Pub17 polypeptide in a plant or plant material and / or a reduction in the biological effect or activity of Pub21 protein and optionally Pub17 protein in a plant or plant material.

[0163] This can be achieved by various standard techniques well known in the art. Suitably, the reduction in the level of Pub21 protein and optionally the reduction in the level of Pub17 in the plant can be a reduction in the amount of Pub21 protein and optionally a reduction in the amount of Pub17 protein. Suitably, it is a reduction in the amount of Pub21 protein and optionally Pub17 protein located in plant cells (e.g. leaf tissue cells) compared to the amount of Pub21 protein and (when present) additionally Pub17 protein in the same tissue of a native plant of the same species (i.e., an unmodified reference plant) grown under the same conditions and at the same stage where expression levels are not intentionally altered.

[0164] Suitably, the level, activity or expression of Pub21 protein and optionally the level, activity or expression of Pub17 protein is reduced by modifying the tomato plant. Suitably by genetic modification of the tomato plant. Suitably, the genetic modification of the tomato plant may be transient or stable modification. In one embodiment, the resulting tomato plant is stably modified.

[0165] Suitably, stable transformation refers to the incorporation of a polynucleotide into a plant host chromosome, such that the host genetic material can be permanently and heritably altered, and the transformed cell can continue to express the trait caused by this genetic material, even after several generations of cell division. Suitably, transient transformation of a plant cell refers to the cell containing heterologous DNA or RNA and being able to express the trait conferred by the heterologous genetic material without the genetic material being fully incorporated into the cell's DNA.

[0166] Suitably, genetic modification of tomato plants can be achieved by any means known in the art, such as, for example, by random mutagenesis, transformation, homologous recombination or gene editing. Suitable random mutagenesis techniques can be chemical mutagenesis, gamma-ray mutagenesis, UV mutagenesis or X-ray mutagenesis. For example, suitable gene editing techniques can be by CRISPR-Cas systems (particularly CRISPR-Cas9 or CRISPR-Cas13, any reference to Cas9 hereinafter may also refer to other Cas proteins, such as Cas13), zinc finger nucleases or TALENs.

[0167] Alternatively, the level, activity or expression of Pub21 protein and optionally the level, activity or expression of Pub17 protein is reduced by inhibition. Suitably, the expression of Pub21 protein is inhibited and optionally the expression of Pub17 protein is further inhibited by inhibiting the expression of Pub21 gene and optionally further inhibiting the expression of Pub17 gene. Suitably, the inhibition of Pub21 gene expression and optionally further inhibition of Pub17 gene expression can be achieved using any means known in the art, such as by using RNAi, miRNA, siRNA, nuclease-deficient CRISPR / Cas system, i.e., for example CRISPRi, modified TALE or zinc finger.

[0168] Suitably, the resulting tomato plant or plant material may be transgenic or non-transgenic. In one embodiment, the tomato plant or plant material is non-transgenic.

[0169] The plant, part or plant material of the present invention may be transgenic, i.e. it is produced by a method involving a gene transfer event of some degree; that is, genetic material from one species has been isolated and transferred and incorporated into the genetic material of a recipient plant using gene transfer methods well known to those skilled in the art. The method may also include synthetic nucleic acid sequences produced according to design.

[0170] Alternatively, the plants or plant materials of the invention may be non-transgenic, i.e. the genetic material of the plant, part or cell has been modified by methods involving, for example, Crispr-Cas based gene editing, whereby a modification of the identity of a single nucleotide base or multiple bases is achieved in the genome. Likewise, methods of gene editing of plant genetic material and regeneration of whole plants from the starting point of modified plant protoplasts, plant cells or plant tissues are well known to those skilled in the art.

[0171] In one embodiment, the modification is used to reduce the level, expression or activity of Pub21 protein in tomato plants, and optionally to reduce the level, expression or activity of Pub17 protein in tomato plants. Suitably, the modification is performed by chemical mutagenesis or CRISPR / Cas9-mediated gene editing. Suitably, in such embodiments, the Pub21 gene sequence is modified, and optionally the Pub17 gene sequence is modified. Suitably, the Pub21 gene sequence and optionally the Pub17 gene sequence each comprise one or more modifications as a result of the modification method.

[0172] Suitably, chemical mutagenesis can be carried out by exposing the tomato plant to a chemical mutagen, such as ethyl methanesulfonate (EMS), ethyl nitrosourea (ENU), NMU (nitrosyl methyl urea), methyl methanesulfonate (MMS), ethidium bromide, psoralen, acridine orange or sodium azide. Suitably, the tomato plant is exposed to EMS. Suitably, the seed of the tomato plant is exposed to EMS, and then the tomato plant is grown from the seed. Suitably, the seed can be pre-soaked in distilled water. Suitably, the seed can be pre-soaked for 2 to 15 hours, suitably for about 8 hours. Suitably, the seed is treated with an EMS dilution of 0.5% to 10%, suitably 1%-5%, suitably 1% EMS dilution. Suitably, the seed is treated for 6 to 48 hours, suitably 12 to 245 hours, suitably for about 12 hours.

[0173] Suitably, CRISPR / Cas9 gene editing is performed by introducing components of the CRISPR / Cas9 system into tomato plants. Suitably, the CRISPR-Cas system allows for target-specific cleavage of genomic DNA under the guidance of a Cas9 endonuclease complexed with a guide RNA (gRNA) that complementarily binds to a target DNA sequence. Suitably, the components of the CRISPR / Cas9 system are a Cas9 endonuclease protein and a suitable guide RNA that is complementary to a target sequence in the plant genome.

[0174] As used herein, the term "guide RNA" or "gRNA" generally refers to an RNA molecule (or group of total RNA molecules) that can bind to a CRISPR system effector (such as a Cas or Cpf1 protein) and help target the Cas or Cpf1 protein to a specific location within a target polynucleotide (such as DNA). The guide RNA can be an engineered single RNA molecule (sgRNA), wherein, for example, the sgRNA comprises a crRNA segment and optionally a tracrRNA segment. The guide RNA can also be a dual-guide system, in which the crRNA and tracrRNA molecules are physically distinct molecules that then interact to form a duplex for recruiting a CRISPR system effector (such as Cas9) and for targeting the protein to a target polynucleotide.

[0175] As used herein, the term "crRNA" or "crRNA segment" refers to an RNA molecule or a portion of an RNA molecule that includes a polynucleotide targeting guide sequence, a stem sequence involved in protein binding, and optionally a 3'-overhang sequence. The polynucleotide targeting guide sequence is a nucleic acid sequence complementary to a sequence in a target DNA (e.g., Pub21 allele or Pub17 allele). This polynucleotide targeting guide sequence is also referred to as a "pre-spacer sequence". In other words, the polynucleotide targeting guide sequence of the crRNA molecule interacts with the target DNA via hybridization (i.e., base pairing) in a sequence-specific manner. In this way, the nucleotide sequence of the polynucleotide targeting guide sequence of the crRNA molecule can vary, and determines the position in the target DNA where the guide RNA and the target DNA will interact.

[0176] The polynucleotide targeting guide sequence of crRNA molecules can be modified (e.g., by genetic engineering) so as to hybridize with any desired sequence in target DNA. The polynucleotide targeting guide sequence of crRNA molecules of the present invention can have a length from about 12 nucleotides to about 100 nucleotides. For example, the polynucleotide targeting guide sequence of crRNA can have the following length: from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, or from about 12 nt to about 19 nt. For example, the polynucleotide targeting guide sequence of crRNA can have a length from about 17 nt to about 27 nt.

[0177] Suitably, the CRISPR / Cas9 complex can be introduced into a tomato plant as one or more polynucleotides and / or proteins. Suitably, the CRISPR / Cas9 complex can be introduced into a tomato plant as one or more polynucleotides encoding components of the complex. Suitably, the one or more polynucleotides can be contained on one or more vectors. Suitably, the CRISPR / Cas9 complex can be introduced into a tomato plant by any known means of transformation. It will be appreciated by those skilled in the art that the techniques for CRISPR / Cas9 gene editing in plants are well known, see, for example, Wada, N. et al., (2020) "Precision genome editing in plants: state-of-the-art in CRISPR / Cas9-based genome engineering" BMC Plant Biology [BMC Plant Biology] Vol. 20, Article No.: 234.

[0178] "Transformation" refers to the process of introducing an exogenous nucleic acid molecule (e.g., a recombinant polynucleotide) into a cell or protoplast, and the exogenous nucleic acid molecule is incorporated into the host cell genome or organelle genome (e.g., chloroplast or mitochondria) or is capable of autonomous replication. "Transformed" or "transgenic" refers to a cell, tissue, organ or organism into which an exogenous nucleic acid, such as an expression vector or a recombinant nucleic acid molecule, has been introduced. Suitably, the means of transformation is, or for example, gene transfer by a disarmed Ti plasmid vector carried by Agrobacterium tumefaciens, transformation mediated by Agrobacterium species, vacuum infiltration, floral dip, spraying, particle or microparticle bombardment, protoplast transformation, electroporation, microinjection, electrophoresis, pollen tube pathway, silicon carbide or liposome-mediated transformation, root uptake, direct injection into the xylem or phloem or other forms of direct DNA uptake.

[0179] Suitably, the change of the guide RNA sequence allows the Cas9 endonuclease to be programmed to cut DNA at a site complementary to the guide RNA. Suitable guide RNAs for use in the present invention can be selected from those complementary to or targeting the sequence in the Pub21 gene, and optionally complementary to or targeting the sequence in the Pub17 gene. Suitably, the guide RNA can be complementary to or targeting the sequence in the U box domain or ARM repeat sequence domain of the Pub21 gene (suitably SEQ ID NO: 1 or its straight homologue or homologue) and optionally the Pub17 gene (suitably SEQ ID NO: 39 or its straight homologue or homologue). Suitable guide RNAs can be designed using widely available bioinformatics tools to target specific sequences in the Pub21 gene and optionally the Pub17 gene. Suitably, the guide RNA is a single guide RNA.

[0180] In one embodiment, the guide RNA designed to target a specific sequence in the Pub21 gene is selected from one or more of the following sequences: sgRNA1 of SEQ ID NO: 23, sgRNA2 of SEQ ID NO: 24, and sgRNA3 of SEQ ID NO: 25. Suitably, in some embodiments, more than one guide RNA can be used in combination to guide the CRISPR / Cas9 complex to cut the Pub21 gene at multiple locations. Suitably, in one embodiment of the present invention, all three guide RNAs of SEQ ID NO: 23-25 ​​are used.

[0181] In one embodiment, the optional additional guide RNA designed to target a specific sequence in the Pub17 gene is selected from one or more of the following sequences: sgRNA1 of SEQ ID NO: 51, sgRNA2 of SEQ ID NO: 52, sgRNA3 of SEQ ID NO: 53, and sgRNA4 of SEQ ID NO: 54. Suitably, in some embodiments, more than one guide RNA can be used in combination to guide the CRISPR / Cas9 complex to cut the Pub17 gene at multiple locations. Suitably, in one embodiment of the present invention, all four guide RNAs of SEQ ID NO: 51-54 are used.

[0182] Suitably, in one embodiment of the invention, more than one guide RNA can be used in combination to guide the CRISPR / Cas9 complex to cut the Pub21 gene at multiple locations, and to guide the CRISPR / Cas9 complex to cut the Pub17 gene at multiple locations. Suitably, in such an embodiment, multiple guide RNAs selected from SEQ ID NOs: 23-25 ​​and SEQ ID NOs: 51-54 are used. Suitably, in some embodiments, all guide RNAs of SEQ ID NOs: 23-25 ​​and SEQ ID NOs: 51-54 are used.

[0183] Suitably, the method involving modification of a tomato plant preferably introduces one or more modifications into a Pub21 allele of the tomato plant, and optionally the method involving modification of a tomato plant further introduces one or more modifications into a Pub17 allele of the tomato plant. Thus, suitably, the tomato plant comprises a modified Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele), which allele has a mutation that causes a decrease in Pub21 protein level, activity or expression compared to a reference tomato plant, and optionally the tomato plant further comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele), which allele has a mutation that causes a decrease in Pub17 protein level, activity or expression compared to a reference tomato plant.

[0184] Suitably, the modified Pub21 allele and Pub17 allele each comprises a specific mutation, which is suitably defined below in relation to a modified Pub21 allele and a modified Pub17 allele.

[0185] In another embodiment, inhibition is used to reduce the level, expression or activity of Pub21 protein and optionally Pub17 protein in tomato plants. Suitably, inhibition is performed by RNA interference (also known as RNAi). Suitably, in such embodiments, Pub21 gene sequence and optionally Pub17 gene sequence are not modified. Suitably, in such embodiments, the expression of Pub21 gene sequence and optionally Pub17 gene sequence is inhibited or repressed. Suitably, in such embodiments, the expression of Pub21 gene sequence and optionally Pub17 gene sequence is silenced.

[0186] Suitably, RNAi suppression is carried out by introducing one or more polynucleotide sequences of the coding RNAi agent complementary to the target DNA sequence into tomato plants. Two types of small RNA molecules are the core of RNA interference, i.e., microRNA (miRNA) and small interfering RNA (siRNA). These small RNAs can guide the enzyme complex to degrade messenger RNA (mRNA) molecules, and therefore reduce their activity by preventing translation via post-transcriptional gene silencing. In addition, transcription can be suppressed by the silencing mechanism before transcription of RNA interference, by which the enzyme complex catalyzes DNA methylation at the genomic position complementary to the compound siRNA or miRNA.

[0187] Therefore, in some embodiments of the invention, an inhibitory RNA (e.g., siRNA, miRNA, or another RNAi for inhibiting the expression of Pub21 protein) is used, and an inhibitory RNA (e.g., siRNA, miRNA, or another RNAi for inhibiting the expression of Pub21 protein and optionally Pub17 protein) is optionally used. The inhibitory RNA can be synthesized and delivered to the plant, or it can be expressed in the plant from a suitable expression construct.

[0188] RNAi and its implementation methods are well known in the art. RNAi agents can be chemically or enzymatically synthesized extracellularly and subsequently delivered to cells (see, e.g., Fire et al., Nature [Nature], 391:806-11 (1998); Tuschl et al., Genes and Dev. [Gene and Development], 13:3191-97 (1999); and Elbashir et al., Nature [Nature], 411:494-498 (2001)); or can be expressed in vivo by appropriate vectors in cells (see, e.g., U.S. Patent No. 6,573,099).

[0189] Suitably, the RNAi agent is a miRNA or siRNA. Suitably, the RNAi agent comprises a polynucleotide sequence complementary to a target sequence in the Pub21 gene, and optionally further comprises a polynucleotide sequence complementary to a target sequence in the Pub17 gene. Suitable means for transforming a tomato plant with such a polynucleotide sequence or a vector comprising the polynucleotide sequence are described above.

[0190] Suitable RNAi agent sequences can be selected from those complementary to or targeting sequences in the U box domain, ARM repeat domain, or region between the two domains of the Pub21 gene (suitably SEQ ID NO: 1 or its ortholog or homolog), and optionally additional RNAi agent sequences can be selected from those complementary to or targeting sequences in the UND domain, U box domain, or ARM repeat domain of the Pub17 gene (suitably SEQ ID NO: 39 or its ortholog or homolog). In one embodiment, the sequence of the RNAi agent complementary to or targeting sequences in the region between the U box domain and the ARM repeat domain of the Pub21 gene or in the ARM repeat domain is selected from any one of the following sequences: RNAi1 of SEQ ID NO: 5 and RNAi10 of SEQ ID NO: 6. Suitably, in some embodiments, more than one RNAi agent can be used in combination. Suitably, in one embodiment of the present invention, two RNAi agents of SEQ ID NO: 5 and 6 are used. In one embodiment, the sequence of the RNAi agent complementary to or targeting the sequence in the UND domain or U box domain of the Pub17 gene is selected from any one of the following sequences: RNAi3 of SEQ ID NO: 46 and RNAi7 of SEQ ID NO: 47. Suitably, in some embodiments, more than one RNAi agent can be used in combination. Suitably, in one embodiment of the present invention, two RNAi agents of SEQ ID NO: 46 and 47 are used.

[0191] Suitably, in one embodiment, more than one RNAi agent can be used in combination to target a sequence in the Pub21 gene and to target a sequence in the Pub17 gene. Suitably, in such an embodiment, multiple RNAi agents can be used, and suitably multiple RNAi agents are selected from SEQ ID NOs: 5 and 6, and from SEQ ID NOs: 46 and 47. Suitably, in some embodiments, all RNAi agents of SEQ ID NOs: 5 and 6 and SEQ ID NOs: 46 and 47 are used.

[0192] Modified Pub21 alleles and Pub21 protein

[0193] In some embodiments, the tomato plant comprises a modified Pub21 allele that reduces the level, expression or activity of the corresponding Pub21 protein. Suitably, the modified Pub21 allele is not the result of a substantially biological process. Suitably, the modified Pub21 allele is artificially produced. In some embodiments, the tomato plant or any plant part, seed or product thereof according to the present invention is not obtained solely by a substantially biological process. Suitably, the modified Pub21 allele causes increased resistance to lesion forming pathogens.

[0194] In one embodiment, the tomato plant comprises two copies of the modified Pub21 allele and is therefore homozygous for the modified Pub21 allele.

[0195] Suitably, the modified Pub21 nucleic acid sequence is at least 70% identical to SEQ ID NO: 1 (wild-type Pub21 allele) or an orthologue or homologue thereof, wherein the nucleic acid sequence comprises a mutation that reduces Pub21 protein level, activity or expression. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0196] Suitably, the modified Pub21 nucleic acid sequence has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog. Suitably, at any level of identity, the sequence still comprises a mutation that reduces Pub21 protein level, activity or expression. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0197] Suitably, the modified Pub21 nucleic acid sequence may comprise one or more than one mutation. Suitably, each mutation reduces the level, activity or expression of the Pub21 protein. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0198] Suitably, the modified Pub21 nucleic acid sequence comprises a mutation in the ARM region of SEQ ID NO:1 (wild-type allele), or a mutation in a region corresponding thereto in its ortholog or homolog. Suitably, the mutation is a SNP. Suitably, the SNP is T to ASNP. Suitably, the mutation is at nucleotide position 890 of SEQ ID NO:1 (wild-type Pub21 allele) or a position corresponding thereto (such as in its ortholog or homolog). Therefore, suitably, the modified Pub21 nucleic acid sequence comprises T to ASNP at position 890 of SEQ ID NO:1 (wild-type Pub21 allele) or a position corresponding thereto. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0199] Thus, suitably, the modified Pub21 nucleic acid sequence is at least 70% identical to SEQ ID NO: 1 (wild-type Pub21 allele) or an orthologue or homologue thereof, wherein the nucleic acid sequence comprises a T to A SNP at position 890 of SEQ ID NO: 1 (wild-type Pub21 allele) or a position corresponding thereto, such that the level, activity or expression of the Pub21 protein is reduced. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0200] In one embodiment, the modified Pub21 allele comprises SEQ ID NO: 2 (modified Pub21 allele). In one embodiment, the modified Pub21 allele consists of SEQ ID NO: 2 (modified Pub21 allele).

[0201] Further aspects of the invention relate to an isolated nucleic acid sequence according to SEQ ID NO: 2 (modified Pub21 allele), and to vectors, expression cassettes and host cells comprising said sequence.

[0202] Suitably, the Pub21 protein is encoded by a Pub21 nucleic acid sequence. Thus, suitably, the Pub21 protein is also modified. Suitably, the Pub21 protein modification is caused by modification of the Pub21 nucleic acid sequence of the Pub21 allele as described above.

[0203] Suitably, Pub21 protein is truncated. Suitably, truncation is caused by an early stop codon in the Pub21 nucleic acid sequence. Suitably, the early stop codon is produced by a mutation in the Pub21 nucleic acid sequence, suitably produced by a SNP mutation in the Pub21 nucleic acid sequence. Therefore, suitably, the modified Pub21 protein is truncated at the C-terminus. Suitably, the modified Pub21 protein is truncated at the C-terminus of SEQ ID NO:3 (wild-type Pub21 protein) until position L297 or a position corresponding thereto (such as in its ortholog or homolog).

[0204] Suitably, the Pub21 protein comprises an amino acid sequence according to SEQ ID NO: 3 (wild-type Pub21 protein) or a portion of its ortholog or homolog. Suitably, the Pub21 protein comprises an amino acid sequence according to SEQ ID NO: 3 (wild-type Pub21 protein) or a portion of its ortholog or homolog. Suitably, the Pub21 protein comprises an amino acid sequence of at least 50%, 60%, 70%, 80% or 90% of the total length of its ortholog or homolog. Suitably, the Pub21 protein does not consist of SEQ ID NO: 3 or its ortholog or homolog. Suitably, the Pub21 protein comprises an amino acid sequence of about 60%-70% of the total length of its ortholog or homolog. Suitably, the Pub21 protein comprises an amino acid sequence of 70% of the total length of its ortholog or homolog according to SEQ ID NO: 3 (wild-type Pub21 protein) or a portion of its ortholog or homolog. Suitably, the Pub21 protein comprises an amino acid sequence of 70% of the total length of its ortholog or homolog.

[0205] Suitably, the modified Pub21 protein consists of amino acids 1-296 of SEQ ID NO: 3 (wild-type Pub21 protein).

[0206] Suitably, the modified Pub21 protein consists of an amino acid sequence according to SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof having at least 70% identity thereto. Suitably, the modified Pub21 protein consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereto with SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof.

[0207] Suitably, the modified Pub21 protein consists of the amino acid sequence according to SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof.

[0208] Suitably, the portion of SEQ ID NO: 4 may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the total length of SEQ ID NO: 4 (modified Pub21 protein).

[0209] Suitably, the modified Pub21 protein may comprise one or more than one further mutation. Suitably, each mutation results in a reduction in the level, activity or expression of the Pub21 protein.

[0210] Further aspects of the invention relate to an isolated polypeptide sequence according to SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof, and a host cell comprising the polypeptide.

[0211] In another aspect of the invention there is provided a plant or plant part or seed comprising a modified Pub21 protein as defined herein.

[0212] Modified Pub17 alleles and Pub17 protein

[0213] In some embodiments described elsewhere herein, the tomato plant comprises a modified Pub21 allele that reduces the level, expression, or activity of the corresponding Pub21 protein, and in addition, the tomato plant may further comprise a modified Pub17 allele that also reduces the level, expression, or activity of the corresponding Pub17 protein.

[0214] The "Pub17 allele" or "Pub17 protein" described herein is comprised in a tomato plant in combination with a modified Pub21 allele or modified Pub21 protein as described above.

[0215] Suitably, the modified Pub17 allele is not the result of a substantially biological process. Suitably, the modified Pub17 allele is artificially produced. In some embodiments, the tomato plant according to the invention or any plant part, seed or product thereof is not obtained solely by a substantially biological process. Suitably, the modified Pub21 allele and Pub17 allele cause increased resistance to lesion forming pathogens.

[0216] In one embodiment, the tomato plant comprises two copies of the modified Pub17 allele and is therefore homozygous for the modified Pub17 allele.

[0217] Suitably, the modified Pub17 nucleic acid sequence is at least 70% identical to SEQ ID NO: 39 (wild-type Pub17 allele) or an orthologue or homologue thereof, wherein the nucleic acid sequence comprises a mutation that reduces Pub17 protein level, activity or expression. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0218] Suitably, the modified Pub17 nucleic acid sequence has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog. Suitably, at any level of identity, the sequence still comprises a mutation that reduces Pub17 protein level, activity or expression. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0219] Suitably, the modified Pub17 nucleic acid sequence may comprise one or more than one mutation. Suitably, each mutation reduces the level, activity or expression of the Pub17 protein. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0220] Suitably, the modified Pub17 nucleic acid sequence comprises a mutation in the ARM region of SEQ ID NO:39 (wild-type Pub17 allele), or a mutation in a region corresponding thereto in its ortholog or homolog. Suitably, the mutation is a SNP. Suitably, the SNP is an A to T SNP. Suitably, the mutation is at nucleotide position 1477 of SEQ ID NO:39 (wild-type Pub17 allele) or a position corresponding thereto (such as in its ortholog or homolog). Therefore, suitably, the modified Pub17 nucleic acid sequence comprises an A to T SNP at position 1477 of SEQ ID NO:39 (wild-type Pub17 allele) or a position corresponding thereto. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0221] Thus, suitably, the modified Pub17 nucleic acid sequence is at least 70% identical to SEQ ID NO: 39 (wild-type Pub17 allele) or an orthologue or homologue thereof, wherein the nucleic acid sequence comprises an A to T SNP at position 1477 of SEQ ID NO: 39 (wild-type Pub17 allele) or a position corresponding thereto, such that the level, activity or expression of the Pub17 protein is reduced. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0222] In one embodiment, the modified Pub17 allele comprises SEQ ID NO: 48 (modified Pub17 allele). In one embodiment, the modified Pub17 allele consists of SEQ ID NO: 48 (modified Pub17 allele).

[0223] Further aspects of the invention relate to an isolated nucleic acid sequence according to SEQ ID NO: 48 (modified Pub17 allele), and to vectors, expression cassettes and host cells comprising said sequence.

[0224] Suitably, the Pub17 protein is encoded by a Pub17 nucleic acid sequence. Thus, suitably, the Pub17 protein is also modified. Suitably, the Pub17 protein modification is caused by modification of the Pub17 nucleic acid sequence of the Pub17 allele as described above.

[0225] Suitably, the Pub17 protein is truncated. Suitably, the truncation is caused by an early stop codon in the Pub17 nucleic acid sequence. Suitably, the early stop codon is caused by a mutation in the Pub17 nucleic acid sequence, suitably by a SNP mutation in the Pub17 nucleic acid sequence. Therefore, suitably, the modified Pub17 protein is truncated at the C-terminus. Suitably, the modified Pub17 protein is truncated at the C-terminus of SEQ ID NO: 49 (wild-type Pub17 protein) to position R493 or a position corresponding thereto (such as in its ortholog or homolog).

[0226] Suitably, the Pub17 protein comprises an amino acid sequence according to SEQ ID NO: 49 (wild-type Pub17 protein) or a portion of an orthologue or homologue thereof. Suitably, the Pub17 protein comprises an amino acid sequence according to SEQ ID NO: 49 (wild-type Pub17 protein) or a portion of an orthologue or homologue thereof. Suitably, the Pub17 protein comprises an amino acid sequence according to at least 50%, 60%, 70%, 80% or 90% of the total length thereof. Suitably, the Pub17 protein does not consist of SEQ ID NO: 49 or a orthologue or homologue thereof. Suitably, the Pub17 protein comprises an amino acid sequence according to about 70%, more particularly 72% of the total length thereof, according to SEQ ID NO: 49 (wild-type Pub17 protein) or a orthologue or homologue thereof.

[0227] Suitably, the modified Pub17 protein consists of amino acids 1-492 of SEQ ID NO: 49 (wild-type Pub17 protein).

[0228] Suitably, the modified Pub17 protein consists of an amino acid sequence according to SEQ ID NO: 50 (modified Pub17 protein) or a portion thereof having at least 70% identity thereto. Suitably, the modified Pub17 protein consists of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereto with SEQ ID NO: 50 (modified Pub17 protein) or a portion thereof.

[0229] Suitably, the modified Pub17 protein consists of the amino acid sequence according to SEQ ID NO: 50 (modified Pub17 protein) or a part thereof.

[0230] Suitably, the portion thereof of SEQ ID NO:50 may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the total length of SEQ ID NO:50 (modified Pub17 protein).

[0231] Suitably, the modified Pub17 protein may comprise one or more than one further mutation. Suitably, each mutation results in a reduction in the level, activity or expression of the Pub17 protein.

[0232] Further aspects of the invention relate to an isolated polypeptide sequence according to SEQ ID NO: 50 (modified Pub17 protein) or a portion thereof, and a host cell comprising the polypeptide.

[0233] In another aspect of the invention there is provided a plant or plant part or seed comprising, in addition to a modified Pub21 protein as previously described, a modified Pub17 protein as defined herein.

[0234] Lesion-forming pathogens

[0235] Suitably, the lesion forming pathogen may be any pathogen that forms one or more lesions on the tissue of the tomato plant. Suitably on the stems, leaves and / or fruits of the tomato plant. Suitably, the lesions may be localized necrosis or chlorotic areas of diseased tissue.

[0236] Suitably, the lesion forming pathogen may be a biotrophic, hemibiotrophic or necrotrophic pathogen.In one embodiment, the lesion forming pathogen is a necrotrophic pathogen.

[0237] Suitably, the pathogenesis forming pathogen may be a bacterium, a fungus, a virus, a protozoa or an archaea. Suitably, the pathogenesis forming pathogen is a fungus or a virus or an oomycete, or any combination thereof.

[0238] Suitably, the lesion forming pathogen is an oomycete. Suitably, the lesion forming oomycete may be selected from: Phytophthora infestans, Hyaloperonospora arabidopsidis, Phytophthora aramorum, Phytophthora sojae, Phytophthora capsici, Plasmopara viticola, Phytophthora cinnamomi, Pythium ultimum, Albugo candida and Phytophthora parasitica.

[0239] Suitably, the lesion-forming pathogen is a virus. Suitable lesion-forming viruses may be selected from one or more of the following: for example, tomato mosaic virus (ToMV), tobacco mosaic virus (TMV), tomato spotted wilt virus (TSWV), pomegranate mosaic virus (PepMV), cucumber mosaic virus (CMV), potato virus Y (PVY), combined leaf streak TMV+CMV, tobacco etch virus (TEV), tomato ringspot virus (TRSV), tomato sterility virus (TAV), tomato yellow leaf curl virus (TYLCV) and tomato brown rugose fruit virus (ToBRFV).

[0240] Suitably, the lesion forming pathogen is a fungus. Suitable lesion-forming fungi may be selected from any of the following species: Heterospora, Anthospora, Victoria, Alternaria, Alternaria solani, Alternaria brassicae, Periconia circinata, Pyrenophora tritici-repentis, Bipolaris sacchari, Phyllostictamaydis, Stagnospora nodorum, Stemphylium vesicarium, Botrytis fabae, Botrytis elliptica, Botrytis cinerea, Sclerotinia sclerotiorum, Mollinia fructicola, Fusarium graminearum, Septoria tritici, Cercospora zeae-maydis, Exserohilum turcicum, Leptosphaeria maculans, Ascochyta rabiei, Diaporthe toxica, Phoma medicaginis, Leptosphaerulina trifoli, Pseudopeziza medicaginis, Stemphyllium botryosum, Stagonospora metiloti, Pleiochaetasetosa, Fusarium oxysporum, Rhizoctonia solani, and Pythium species.

[0241] Suitably, the lesion forming pathogen is a pathogen affecting tomato plants. Suitably, for this, the tomato plant is the host. Thus, suitably, the lesion forming pathogen is a tomato pathogen, suitably a necrotrophic tomato pathogen, suitably a necrotrophic fungal tomato pathogen or a necrotrophic viral tomato pathogen. Suitable necrotrophic fungi affecting tomato plants may be selected from Alternaria alternata, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Pseudomonas sclerotiorum, Fusarium oxysporum and Pythium species. Suitable necrotrophic viruses affecting tomato plants may be selected from Tomato Yellow Leaf Curl Virus (TYLCV) and Tomato Brown Rugose Fruit Virus (ToBRFV).

[0242] Suitably, the lesion forming pathogen belongs to the genus Botrytis or Alternaria. Thus, suitably, the lesion forming pathogen may be selected from the following species: Alternaria interspersata, Alternaria solani, Alternaria brassicae, Botrytis viciae, Botrytis ellipsoidea and Botrytis cinerea.

[0243] Alternatively, the lesion forming pathogen may be a hemibiotrophic tomato pathogen, suitably a hemibiotrophic oomycete tomato pathogen. Suitable hemibiotrophic oomycetes affecting tomato plants may be Phytophthora infestans, Phytophthora capsici or Phytophthora parasiticus.

[0244] In one embodiment, the lesion forming pathogen is Botrytis cinerea or Alternaria solani.

[0245] In one embodiment, the lesion forming pathogen is Phytophthora infestans.

[0246] Suitably, the lesion-forming pathogen causes a disease in the plant. Suitable diseases may be selected from the group consisting of: wilt, botrytis wilt, gray mold, white mold, early blight, late blight, leaf blight, powdery mildew, rot, leaf spot, fruit rot, brown spot, black spot, brown spot, gray spot, head blight, ear rot, spot, stem canker, stem blight, black stem, crown rot, wilt, root rot and damping-off of seedlings.

[0247] Suitably, the lesion forming pathogen causes a disease that is a necrotic disease, suitably wherein cell death occurs. Suitably, the lesion forming pathogen causes a disease selected from: a wilt, such as Botrytis blight, early blight or late blight; a mildew, such as gray mold; and a rot. Thus, suitably, the plants of the invention have increased resistance or decreased susceptibility to necrotic diseases. Suitably, increased resistance or decreased susceptibility to: a wilt, such as Botrytis blight, early blight or late blight; a mildew, such as gray mold; or a rot. In one embodiment, the plants of the invention have increased resistance or decreased susceptibility to a wilt, suitably to Botrytis blight.

[0248] In one embodiment, the tomato plants of the present invention have increased resistance to wilt caused by lesion forming pathogens. In one embodiment, the tomato plants of the present invention have increased resistance to wilt caused by lesion forming fungi or oomycetes or viral pathogens. In one embodiment, the tomato plants of the present invention have increased resistance to wilt caused by necrotrophic or hemibiotrophic pathogens. In one embodiment, the tomato plants of the present invention have increased resistance to wilt caused by necrotrophic or hemibiotrophic fungi or oomycete pathogens. In one embodiment, the tomato plants of the present invention have increased resistance to wilt caused by Botrytis or Alternaria pathogens. In one embodiment, the tomato plants of the present invention have increased resistance to wilt caused by Botrytis cinerea or Alternaria solani, suitably Botrytis cinerea.

[0249] Suitably, the tomato plants of the invention may have increased resistance to more than one lesion forming pathogen, and thus may have increased resistance to more than one disease. Suitably, the tomato plants of the invention may have increased resistance to a combination of lesion forming pathogens as described herein, or any combination of diseases as described herein, which diseases suitably may be caused by lesion forming pathogens.

[0250] Suitably, the tomato plants of the present invention may have increased resistance to any combination of fungal lesion forming pathogens, viral lesion forming pathogens and / or oomycete lesion forming pathogens. Suitably, the tomato plants of the present invention may have increased resistance to any combination of the pathogens listed above. Suitably, the tomato plants of the present invention may have increased resistance to any combination of: Botrytis cinerea, Alternaria solani.

[0251] Increased resistance

[0252] Suitably, the tomato plants of the invention have increased resistance relative to a reference tomato plant, suitably increased resistance to lesion forming pathogens relative to a reference tomato plant.

[0253] A suitable reference tomato plant is a control plant. Suitably, such a reference tomato plant comprises the same genetic background as the tomato plant of the present invention, but it does not contain a reduction in Pub21 protein levels and optionally does not contain a reduction in Pub17 protein levels, expression or activity. Suitably, the reference tomato plant may be a wild-type plant. Suitably, the reference tomato plant may be a tomato plant of the same plant variety as the plant of the present invention, and does not contain a reduction in Pub21 protein levels and optionally does not contain a reduction in Pub17 protein levels, expression or activity. The term "plant variety" is understood herein according to the definition of UPOV. Suitably, the reference tomato plant has not been modified to reduce Pub21 protein levels, and optionally has not been modified to reduce Pub17 protein levels, expression or activity. Suitably, the reference tomato plant does not contain a modified Pub21 allele, and optionally does not contain a modified Pub17 allele. Suitably, the reference tomato plant contains a wild-type Pub21 allele and a wild-type Pub17 allele. Suitably, the reference tomato plant is grown for the same length of time under the same conditions as the tomato plant of the present invention. Suitably, the reference tomato plant may be a near-isogenic line, an inbred line or a hybrid, provided that it has the same genetic background as the tomato plant of the invention, except that the reference tomato plant does not contain the modified Pub21 protein level, expression or activity of the invention and optionally does not contain the modified Pub17 protein level, expression or activity of the invention, and suitably does not contain the modified Pub21 allele of the invention and optionally does not contain the modified Pub17 allele of the invention.

[0254] For example, a reference tomato plant in the context of the present invention may comprise the tomato reference genome HEINZ or the tomato reference genome of Moneymaker (https: / / www.ebi.ac.uk / ena / browser / view / SAMEA2340764).

[0255] Suitably, the tomato plants of the invention have a statistically significant increase in resistance to one or more lesion forming pathogens compared to a reference tomato plant.

[0256] Suitably, the resistance to lesion-forming pathogens can be measured by the significant reduction of the number of lesions of each tomato plant or plant material. Suitably, this can be measured using, for example, Mann-Whitney test (α=1%, 2.5% or 5%) or Student's test (P<0.05). Suitably, plant of the present invention has at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% lesions less than reference tomato plant. Suitably, tomato plant of the present invention has 25%-50% lesions less than reference tomato plant.

[0257] Suitably, resistance to lesion-forming pathogens can be measured by a significant reduction in lesion diameter on a tomato plant or plant material, suitably a reduction in the mean diameter of lesions on a tomato plant. Suitably, this can be measured using, for example, a Mann-Whitney test (α=1%, 2.5%, or 5%) or a Student's test (P<0.05). Suitably, tomato plants of the present invention have lesions that are at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% smaller than the lesions on a reference tomato plant, suitably as measured by the mean diameter of lesions on a tomato plant. Suitably, plants of the present invention have lesions that are between 20%-30% smaller than the lesions on a reference tomato plant, suitably as measured by the mean diameter of lesions on a tomato plant.

[0258] Suitably, the measure of such resistance is calculated after the step of exposing the tomato plant or part thereof to the lesion forming pathogen for a suitable period of time. A suitable period of time is the amount of time sufficient for the lesion forming pathogen to infect the tomato plant or part thereof and cause lesions to appear. A suitable period of time may be 1-28 days, suitably 1-14 days, suitably 1-7 days after the tomato plant or part thereof is exposed to the lesion forming pathogen.

[0259] Suitably, resistance to lesion forming pathogens may be enhanced by modifying both the Pub21 allele and the Pub17 allele.

[0260] Suitably, in embodiments where both Pub21 and Pub17 proteins are reduced, the reduction in lesion diameter on the tomato plant or plant material, suitably the reduction in the mean diameter of lesions on the tomato plants, is greater than when either Pub21 or Pub17 protein is reduced alone. Suitably, such plants of the invention have lesions that are between 40%-70% smaller, suitably 40%, 50%, 60% or 70% smaller than lesions on a reference tomato plant, suitably as measured by the mean diameter of lesions on the tomato plants.

[0261] Screening methods

[0262] Aspects of the invention further relate to methods of identifying or selecting tomato plants having increased resistance to one or more lesion forming pathogens.

[0263] Suitably, these methods relate to tomato plants in identification groups, which have the desired trait of increased resistance to one or more pathological pathogens. Suitably, the plant population can be a mutant population or wild population of tomato plants. Suitably, the mutant population of tomato plants can be produced by mutagenesis, as described elsewhere herein. Suitably by chemical mutagenesis, suitably by using chemical mutagens such as EMS. Therefore, suitably, these methods can include the initial step of obtaining or producing a mutant population of tomato plants suitably by EMS mutagenesis.

[0264] Suitably, tomato plants may be directly identified as being resistant to lesion forming pathogens, alternatively or additionally, tomato plants may be indirectly identified by having reduced Pub21 protein levels, expression or activity and optionally further having reduced Pub17 protein levels, expression or activity.

[0265] Suitably, identification of resistance of tomato plants to lesion-forming pathogens can be determined by inoculation or exposure assays. Suitably, wherein the tomato plants are exposed to lesion-forming pathogens, and their responses are assessed compared to reference tomato plants. Resistance to the increase of lesion-forming pathogens can be determined by such assays, such as detached leaf assays, such as those performed in the examples herein. Therefore, suitably, these methods may include the step of inoculating or exposing assays on the or each strain tomato plant, optionally on a tomato plant population. Suitably, such assays may include identifying plants that exhibit a reduction in lesion number and / or average size when exposed to lesion-forming pathogens compared to reference plants. Suitable reduction levels are defined elsewhere herein.

[0266] Alternatively or additionally, resistance of tomato plants to lesion-forming pathogens can be determined by identifying tomato plants with modified Pub21 alleles and optionally further modified Pub17 alleles. Suitably, tomato plants with modified Pub21 alleles and optionally modified Pub17 alleles containing mutations as described above are identified. Suitably, this can be determined by molecular methods such as PCR or genome sequencing of tomato plants. Suitably, this can be determined by genotyping of tomato plants. Genotypic evaluation of plants includes the use of techniques such as isozyme electrophoresis, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), arbitrary primer polymerase chain reaction (AP-PCR), allele-specific PCR (AS-PCR), DNA amplification fingerprint (DAF), sequence characteristic amplification region (SCAR), amplified fragment length polymorphism (AFLP), simple sequence repeat (SSR) (also known as "microsatellite").

[0267] "DNA sequencing" refers to determining the nucleic acid sequence of a section of DNA (e.g., a gene). Standard methods and commercial services are known in the art. Basic methods for DNA sequencing include the Maxam-Gilbert method and the chain termination method. High-throughput technologies have also been developed and are preferably used in the methods of the present invention. These high-throughput technologies include, but are not limited to, massively parallel signature sequencing (MPSS), Polony sequencing, 454 pyrophosphate sequencing, Illumina (Solexa) sequencing, combined probe anchor synthesis (cPAS), SOLiD sequencing, Ion Torrent semiconductor sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, single molecule real-time (SMRT) sequencing, and nanopore DNA sequencing.

[0268] Suitably, the presence or absence of the modified Pub21 allele and optionally the presence or absence of the modified Pub17 allele can be determined by PCR (e.g., real-time PCR using a double-stranded DNA dye or a fluorescent reporter probe). Suitably, a specific primer pair complementary to the modified Pub21 allele as described herein for the kit is used, and optionally a specific primer pair complementary to the modified Pub17 allele as described herein for the kit is further used. Suitably, the primer pair detects the presence of a SNP at position 890 or its corresponding position of the Pub21 allele according to SEQ ID NO:1, and optionally another primer pair detects the presence of a SNP at position 1477 or its corresponding position of the Pub17 allele according to SEQ ID NO:39. Therefore, suitably, these methods may include the following steps: PCR is performed using suitable primers (such as those defined for the kit), and the resulting amplicon is subsequently sequenced, or optionally, the genome sequencing of the or each tomato plant is performed in a tomato plant population.

[0269] As used herein, the term "primer" refers to an oligonucleotide that can anneal to a nucleic acid target and serve as a starting point for DNA synthesis when placed under conditions that induce synthesis of primer extension products (e.g., in the presence of nucleotides and reagents for polymerization (e.g., DNA polymerase) and at a suitable temperature and pH). Primers (in some instances, extension primers, in some instances, amplification primers) can be single-stranded to achieve maximum efficiency for extension and / or amplification. Primers can be oligodeoxyribonucleotides. Primers are typically long enough to initiate the synthesis of extension and / or amplification products in the presence of reagents for polymerization. The minimum length of a primer can depend on many factors, including but not limited to the temperature and composition (A / T vs. G / C content) of the primer. In the case of amplification primers, these amplification primers are typically provided as a pair of bidirectional primers consisting of a forward and a reverse primer, or as a pair of forward primers commonly used in the field of DNA amplification (e.g., in PCR amplification).

[0270] Thus, suitably, methods of identifying or screening tomato plants may comprise using a SNP at position 890 of the Pub21 allele according to SEQ ID NO: 1 or its corresponding position, and optionally these methods may further comprise using a SNP at position 1477 of the Pub17 allele according to SEQ ID NO: 39 or its corresponding position, as one or more markers to identify the presence of resistance to lesion forming pathogens in tomato plants. Suitably identifying the presence of a modified Pub21 allele of the invention and optionally the presence of a modified Pub17 allele of the invention in a tomato plant.

[0271] Therefore, another aspect of the invention is the use of a SNP at position 890 or its corresponding position of the Pub21 allele of SEQ ID NO: 1 for identifying and / or diagnosing a lesion forming pathogen resistance allele in selected and / or genotyping tomato plants or parts thereof, and optionally a SNP at position 1477 or its corresponding position of the Pub17 allele of SEQ ID NO: 39 for identifying and / or diagnosing a lesion forming pathogen resistance allele in selected and / or genotyping tomato plants or parts thereof, suitably in cultivated tomato plants.

[0272] Suitably, the identification or screening method further comprises the step of selecting the or each tomato plant identified as having reduced Pub21 protein levels, expression or activity and optionally further having reduced Pub17 protein levels, expression or activity, and / or thereby selecting the or each tomato plant identified as having increased resistance to one or more lesion forming pathogens.

[0273] Suitably, the identification or screening method may further comprise the steps of breeding the selected tomato plant or the selected tomato plant of each strain, suitably to form a progeny. Suitably, the screening method may further comprise the steps of screening progeny and breeding a selected progeny with a desired trait in several additional rounds. Suitably, this may comprise the additional step of screening the progeny for the presence of the desired trait as explained above, and one or more additional steps of breeding a selected progeny.

[0274] Hybrids and breeding methods

[0275] A hybrid or cultivar may be produced by crossing a first plant of the invention with a second reference plant and obtaining progeny. Suitably, the hybrid or cultivar is a tomato plant.

[0276] Suitably, producing a hybrid tomato plant comprises crossing a first tomato plant according to the present invention with a second reference tomato plant as defined above. Suitably, the reference tomato plant lacks a reduction in Pub21 protein levels, expression or activity, and optionally further lacks a reduction in Pub17 protein levels, expression or activity. Suitably, the reference tomato plant lacks the modified Pub21 alleles described herein. Suitably, the reference tomato plant lacks the modified Pub21 alleles described herein and the Pub17 alleles. However, suitably, the reference plant belongs to the same species as the tomato plant of the present invention, suitably to the same variety as the tomato plant of the present invention. Suitably, the reference plant and plant of the present invention are tomato plants.

[0277] Suitably, the first plant comprises at least one copy, suitably two copies, of a modified Pub21 allele of the invention. Suitably, the first plant comprises at least one copy of a modified Pub21 allele of the invention and at least one copy of a modified Pub17 allele of the invention. Suitably, the first plant comprises two copies of a modified Pub21 allele of the invention and two copies of a modified Pub17 allele of the invention.

[0278] Suitably, there is provided a method of providing a cultivated tomato plant, preferably a cultivated tomato plant, plant part or seed, wherein the method comprises the following steps:

[0279] a) crossing a first plant according to any one of the preceding embodiments with a second plant lacking the Pub21 allele of the present invention and optionally further lacking the Pub17 allele of the present invention,

[0280] b) obtaining progeny plants, and

[0281] c) optionally selecting said progeny plants, characterised in that said plants exhibit improved resistance to lesion forming pathogens.

[0282] Suitably, the tomato plants are hybridized to produce progeny, suitably hybrid progeny. Suitably, the method of producing a hybrid tomato plant may optionally further comprise selecting from the progeny a hybrid tomato plant that exhibits increased resistance to lesion-forming pathogens and / or comprises a reduced Pub21 protein level, expression or activity and optionally further comprises a reduced Pub17 protein level, expression or activity. Suitably, the selection of hybrid tomato plants having the desired trait may be achieved using the screening techniques described above. Thus, suitably, the selection step may be performed by detecting the presence of the modified Pub21 allele of the present invention by performing PCR with primers of SEQ ID NOs: 11 and 12, suitably followed by sequencing of the resulting amplicon, and optionally another selection step may be performed by detecting the presence of the modified Pub17 allele of the present invention by performing PCR with primers of SEQ ID NOs: 41 and 42, suitably followed by sequencing of the resulting amplicon. Alternatively, the selection step may comprise selecting a plant in the progeny that exhibits a reduced number of lesions and / or average size when exposed to lesion-forming pathogens compared to a reference plant. Suitable reduction levels are defined elsewhere herein.

[0283] Another aspect of the present invention relates to a method for producing a cultivated tomato plant, preferably a cultivated tomato plant, which exhibits improved resistance to lesion-forming pathogens compared to a reference tomato plant, the method comprising the following steps:

[0284] a) providing seeds of tomato plants according to the invention;

[0285] b) germinating the seeds and growing mature fertile tomato plants therefrom;

[0286] c) inducing the tomato plant described in a) to self-pollinate, grow tomato fruits and harvest fertile seeds therefrom; and

[0287] d) Growing tomato plants from seeds harvested in c) and selecting tomato plants having increased resistance to lesion forming pathogens.

[0288] Suitably, selection of tomato plants having desirable traits may be achieved using the screening techniques described above.

[0289] Therefore, the plant exemplified herein can be used for breeding programs to develop additional plants with at least partial resistance to lesion-forming pathogens, such as commercial varieties of such plants. According to such methods, the first parent plant can be used for hybridization with the second parent plant, wherein at least one of the first parent plant or the second parent plant contains at least one nucleic acid molecule encoding a modified Pub21 allele as described herein, and optionally at least one of the first parent plant or the second parent plant further contains at least one nucleic acid molecule encoding a modified Pub17 allele as described herein. An application of this process is to produce F1 hybrid plants. Another aspect of this process is that this process can be used to develop new parents, double haploids or inbred lines. For example, plant strains as described herein can be hybridized with any second plant, and the resulting hybrid progeny are self-pollinated and / or sibling mating about 5 to 7 generations or more, thereby providing a large number of different parental strains. These parental strains can then be hybridized with other strains, and the beneficial properties of the resulting hybrid progeny are analyzed. In this way, novel strains with desired characteristics can be identified. Various breeding methods can be used in these methods, including haploidy, pedigree breeding, single seed breeding, improved single seed breeding, recurrent selection, and backcrossing.

[0290] use

[0291] Another aspect of the present invention relates to the use of tomato plants of the present invention or parts thereof, or seeds for growing tomato plants and producing and harvesting crop yields, seeds, and / or fruits therefrom. Suitably, methods for growing plants are known in the art. In one embodiment, crop yields are suitably tomato fruits.

[0292] Another aspect of the present invention relates to the use of the tomato plant of the present invention or its part, or seed for sowing fields, greenhouses, or greenhouses. In another embodiment, the present invention relates to the use of the cultivated plant (preferably cultivated tomato plant, more preferably cultivated tomato plant), plant part or seed according to any one of the preceding embodiments as a rootstock plant.

[0293] Another aspect of the invention relates to the use of lesion forming pathogen resistant propagation material obtainable from a tomato plant according to the invention for growing tomato plants. Suitably, the lesion forming pathogen resistance may be determined in an assay, suitably by assaying the propagation material. A suitable assay may be a detached leaf assay according to the examples herein. Alternatively, the lesion forming pathogen resistance of the propagation material may be determined by molecular methods to identify the presence of the modified Pub21 allele described herein and optionally to further identify the presence of the modified Pub17 allele described herein. Suitably growing tomato plants from the propagation material may be carried out by culturing the propagation material according to techniques known in the art.

[0294] Another aspect of the invention relates to the use of the modified Pub21 allele of the invention to confer increased resistance to lesion forming pathogens on tomato plants lacking the allele, and optionally further to the use of the modified Pub17 allele of the invention to confer increased resistance to lesion forming pathogens on tomato plants lacking the allele. Suitably, further details of the modified Pub21 allele and optionally the modified Pub17 allele are provided above. Suitably, the modified Pub21 allele and optionally the modified Pub17 allele may be introduced into a plant, or the plant may be modified to comprise the modified Pub21 allele and optionally the modified Pub17 allele of the invention. Suitable techniques for providing plants having a modified Pub21 allele and optionally the modified Pub17 allele of the invention are described above.

[0295] Another aspect of the invention relates to the use of a tomato plant according to the invention for introgressing a lesion forming pathogen resistance trait into a tomato plant lacking said trait. Suitably, the trait is conferred by a modified Pub21 allele and optionally a modified Pub17 allele. Suitably, further details of the modified Pub21 allele and optionally the modified Pub17 allele are as defined above. Suitably, methods of introgressing traits into plants are known in the art.

[0296] Reagent test kit

[0297] The present invention further provides a kit for detecting lesion forming pathogen resistance trait alleles in tomato plants. Suitably, a kit for detecting the modified Pub21 allele of the present invention in a plant and optionally for further detecting the modified Pub17 allele of the present invention in a plant. In one embodiment, the plant is a tomato plant.

[0298] Suitably, such a kit may be used in the screening methods described above.

[0299] Suitably, the kit comprises at least one PCR primer pair having a forward primer and a reverse primer that specifically bind to the Pub21 coding sequence. Suitably, the primers used can specifically bind to the Pub21 gene, or specifically bind to the modified Pub21 allele. Suitably, the primers that bind to the Pub21 gene can bind to the region of the SNP at position 890 of the gene, which is suitably flanked by SEQ ID NO:1. Therefore, suitably, in the PCR using such primers, subsequent sequencing is used to identify the modified allele (if present). Suitably, the primers that specifically bind to the modified Pub21 allele can directly detect the presence of the modification. Suitably, a subsequent sequencing step may not be required. Suitably, the kit may comprise a PCR primer pair comprising a forward and reverse primer complementary to the Pub21 coding sequence. Suitably, the forward primer consists of SEQ ID NO:11. Suitably, the reverse primer consists of SEQ ID NO:12. Thus, suitably, the kit may be used to detect a modified Pub21 allele, suitably by subsequent sequencing of the resulting amplicon.Suitably, in such embodiments, the kit is for use in a gene specific PCR.

[0300] Suitably, the resulting amplicon is produced from PCR. Suitably, the amplicon is sequenced and the amplicon comprises a SNP from T to A at position 890 of SEQ ID NO:1 (wild-type Pub21 allele) or at its corresponding position (such as in a straight homologue or homologue sequence). Therefore, suitably, the SNP is used as a marker, suitably the T890A mutation is used as a marker, suitably as a marker for resistance to lesion-forming pathogens.

[0301] Suitably, the test kit may alternatively comprise a PCR primer pair comprising a forward primer and a reverse primer that specifically binds to the modified Pub21 allele of the present invention. Suitably, the forward primer specifically binds to the modified Pub21 allele of the present invention. Suitably, the forward primer is complementary to the modified Pub21 sequence. Suitably, the forward primer consists of SEQ ID NO:36. Suitably, the reverse primer consists of SEQ ID NO:38. Suitably, the test kit may further comprise a second reverse primer that specifically binds to the wild-type Pub21 allele. Suitably, the second reverse primer is complementary to the unmodified Pub21 sequence. Suitably, the second reverse primer consists of SEQ ID NO:37. Suitably, the test kit may comprise all three primers: a forward primer according to SEQ ID NO:36, a first reverse primer according to SEQ ID NO:38, and a second reverse primer according to SEQ ID NO:37. Suitably, the test kit may comprise all three primers: a forward primer according to SEQ ID NO:36, a first reverse primer according to SEQ ID NO:38, and a second reverse primer according to SEQ ID NO:37. Thus, suitably, the kit can detect both the modified Pub21 allele and the wild-type Pub21 allele (if present).

[0302] Suitably, in such an embodiment, the kit is for use in allele-specific PCR, suitably competitive allele-specific PCR (also known as KASP PCR), which is for example described in (Semagn et al. 2014). Thus, suitably, each reverse primer comprises an indicator molecule, such as a fluorescent molecule. Suitably, the indicator molecule is tethered to the reverse primer, suitably tethered to the first and second reverse primers. Suitable fluorescent molecules may be FAM or HEX. Suitably, in an embodiment, the first reverse primer comprises FAM and the second reverse primer comprises HEX.

[0303] In embodiments comprising a modified Pub21 allele and an additional Pub17 allele, the additional set of primers used may specifically bind to the Pub17 gene, or specifically bind to the modified Pub17 allele. Suitably, primers that bind to the Pub17 gene may bind to the region of the SNP at position 1477 of the gene, suitably flanking the SEQ ID NO:39. Therefore, suitably, in PCR using such primers, subsequent sequencing is used to identify the modified allele (if present). Suitably, primers that specifically bind to the modified Pub17 allele may directly detect the presence of the modification. Suitably, a subsequent sequencing step may not be required. Suitably, the kit may include a PCR primer pair comprising a forward and reverse primer complementary to the Pub17 coding sequence. Suitably, the forward primer consists of SEQ ID NO:42. Suitably, the reverse primer consists of SEQ ID NO:41. Thus, suitably the kit may be used to detect a modified Pub17 allele, suitably by subsequent sequencing of the resulting amplicon.Suitably, in such embodiments, the kit is for use in a gene specific PCR.

[0304] Suitably, the resulting amplicon is produced from PCR. Suitably, the amplicon is sequenced and the amplicon is included in the SNP of A to T at position 1477 of SEQ ID NO:39 (wild-type Pub17 allele) or at its corresponding position (such as in a straight homologue or homologue sequence). Therefore, suitably, the SNP is used as a marker, and suitably the A1477T mutation is used as a marker, suitably as a marker for resistance to lesion-forming pathogens.

[0305] Suitably, the kit may alternatively comprise a PCR primer pair comprising a forward primer and a reverse primer that specifically binds to the modified Pub17 allele of the present invention. Suitably, the forward primer specifically binds to the modified Pub17 allele of the present invention. Suitably, the forward primer is complementary to the modified Pub17 sequence. Suitably, the forward primer consists of SEQ ID NO:44. Suitably, the reverse primer consists of SEQ ID NO:45. Suitably, the kit may further comprise a second forward primer that specifically binds to the wild-type Pub17 allele. Suitably, the second forward primer is complementary to the unmodified Pub17 sequence. Suitably, the second forward primer consists of SEQ ID NO:43. Suitably, the kit may comprise all three primers: a first forward primer according to SEQ ID NO:44, a reverse primer according to SEQ ID NO:45, and a second forward primer according to SEQ ID NO:43. Thus, suitably, the kit can detect both the modified Pub17 allele and the wild-type Pub17 allele (if present).

[0306] Suitably, in such an embodiment, the kit is for use in allele-specific PCR, suitably competitive allele-specific PCR (also known as KASP PCR), which is for example described in (Semagn et al. 2014). Thus, suitably, each forward primer comprises an indicator molecule, such as a fluorescent molecule. Suitably, the indicator molecule is tethered to the forward primer, suitably tethered to the first and second forward primers. Suitable fluorescent molecules may be FAM or HEX. Suitably, in an embodiment, the first forward primer comprises FAM and the second forward primer comprises HEX.

[0307] Therefore, suitably, the present invention further discloses the use of the SNP markers according to the present invention for diagnostic selection and / or genotyping of lesion forming pathogen resistance trait alleles in cultivated plants, particularly cultivated tomato plants, more particularly cultivated tomato plants.

[0308] The present invention further discloses the use of the SNP markers according to the present invention for identifying the presence of lesion forming pathogen resistance trait alleles in plants (especially cultivated tomato plants, more especially tomato plants according to the present invention) and / or for monitoring the introgression of lesion forming pathogen resistance trait alleles in cultivated plants (especially cultivated tomato plants, more especially tomato plants according to the present invention and as described herein).

[0309] Suitably, the SNP markers are identified by one of the above PCR methods, suitably using the above primers.

[0310] Suitably, the kit may further comprise other components suitable for performing PCR, such as polymerase, salts, buffers, instructions, etc.

[0311] Another aspect of the invention relates to an amplification product obtained from PCR involving said primer pair which is associated with a lesion forming pathogen resistance trait and thus co-segregates with the lesion forming pathogen resistance trait or with a disclosed marker. Suitably, the amplification product is a nucleic acid.

[0312] Another aspect of the invention is a polynucleotide having at least 70% identity to or hybridizing with the amplified product, suitably having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% identity to the amplified product. Suitably, the amplified product can be used to generate new primers and / or probes for identifying modified Pub21 alleles. Suitably, the amplified product can be used to generate new primers and / or probes for additionally identifying modified Pub17 alleles. Suitably, these are derived markers or probes genetically associated with lesion forming pathogen resistance traits. Suitably, such derived markers or probes can also be used to identify plants with increased resistance to lesion forming pathogens.

[0313] Examples

[0314] Materials and Methods

[0315] Plant materials

[0316] Two different tomato cultivars were used in this experiment: cv. Little Tom (MT) and cv. Moneymaker (MM). MT seeds were obtained from Beekenkamp Plants BV company (Maasdijk, The Netherlands).

[0317] Development of the Little Tom EMS Group

[0318] Considering the advantages offered by the tomato cultivar Little Tom (MT), such as small size, the possibility of growing at high density and having a short life cycle (Meissner et al. 1997), MT was selected as the tomato cultivar for the EMS population in our laboratory (Yan et al. 2021). In total, five batches of approximately 1000 MT seeds (M 0 ) were pre-soaked in distilled water for 8 hours and treated with 1% EMS dilution overnight. 1 Seeds were washed thoroughly with distilled water and sown in a greenhouse. Plants were grown at 21°C / 19°C day / night temperatures at 60% relative humidity during a 16h day / 8h night regime. Three-week-old seedlings were transplanted individually into 14 cm pots and grown until ripe fruits could be harvested. The collected M 2 Seeds were surface sterilized in 2% HCl (hydrogen chloride) and subsequently treated with 10% trisodium phosphate (TSP) solution for at least one hour and then air dried. From the first two batches, 5 to 10 fruits / plant were harvested. However, for the last three batches, all developed fruits were harvested to collect more seeds.

[0319] Botrytis cinerea disease test

[0320] The potato detached leaf assay (DLA) was performed according to a modified version of the one described by Sun et al. (2017). The DLA of MT plants consisted of taking the middle leaflet of the third leaf from each plant, 20 per M2 family, and placing them on a water agar medium ( The DLA of MM consisted of taking the third leaf (3 terminal leaflets, left, middle and right) from 6-week-old plants and placing all three leaflets in a square Petri dish prepared as above. The adaxial side of the leaf was inoculated with 5-6 drops of 2 μl of Botrytis cinerea strain B05.10 (Amselem et al. 2011). The spores were suspended in a mixture of PDA (potato dextrose agar) and PDB (potato dextrose broth) (final concentration was half-strength PDB (12 g / l)) and 0.3% agar at a density of 1 x 10 6 Spores / ml. After inoculation, the culture dishes were grouped (16-18 culture dishes per group), and each group was assembled into a tray containing a damp filter paper. The tray was placed in a plastic bag to obtain 100% humidity. They were maintained at 18°C ​​(16h light / 8h dark). The lesion diameter on the leaf was measured using a caliper with a digital display (Mitutoyo nr 500-161-30, Mitutoyo Nederland BV, Veenendaal, The Netherlands) at 3 and 4 days after inoculation (dpi).

[0321] The stem assay was performed by cutting the 3rd, 4th and 5th leaves from 6-week-old plants, leaving a petiole stump of approximately 2.5 cm. The petiole surface was inoculated with 10 μl of Botrytis cinerea strain B05.10 at a density of 1 x 10 6 Spores / ml. Plants were kept in a plastic tent with high humidity for 24 hours. Symptoms were scored 3, 6, 10, 14, 17 and 21 days after inoculation. Scoring was based on a 0-4 scale, where 0: unchanged petiole stumps were comparable to the mock treatment, 1: petiole stumps were partially or completely thinned and brown; 2: outward stem infection began, where small brown rings were visible on the main stem around the axils of the inoculated petiole stumps, 3: infection spread throughout the entire stem, where the brown rings became irregular and spread up and down along the stem, and 4: complete main stem infection and wilting of the plant, internal browning, stem tissue collapse, and final plant top folding and overturning. In addition, petiole shedding was recorded.

[0322] Alternaria solani disease test

[0323] The potato detached leaf assay (DLA) was performed following a modified version of the one described by Sun et al. (2017). The DLA for MT followed the same procedure as for Botrytis cinerea. The DLA for MM consisted of taking the terminal leaflets of the 3rd, 4th and 5th true leaves from 6-week-old plants and placing all three leaflets in a square Petri dish prepared as above. Five to six 10 μl drops of the Alternaria solani isolate “altNL03003” (accession number CBS143772) were inoculated on the adaxial side of the leaves. Spore collection was performed as previously reported (Wolters et al. 2019). The spores were suspended in a mixture of PDA (potato dextrose agar) and PDB (potato dextrose broth) (final concentration was half-strength PDB (12 g / l)) and 0.3% agar at a density of 1 x 10 5 Spores / ml. After inoculation, the culture dishes were grouped (16-18 culture dishes per group) and each group was assembled into a tray containing a piece of moist filter paper. The tray was placed in a plastic bag to obtain 100% humidity. They were maintained at 18°C ​​(16h light / 8h dark). The lesion diameter on the leaves was measured using a caliper with a digital display (Mitutoyo nr500-161-30, Mitutoyo, Veenendaal, The Netherlands) at 5 and 7 days post-inoculation (dpi).

[0324] Additional disease determinations

[0325] Screening for altered susceptibility to tomato powdery mildew (Pseudoidium neolycopersici) Wageningen isolate On-Ne was performed as described by Bai et al. (2003). Disease assays with P. infestans isolates PIC99177 or C65 were performed using DLA as described by Sun et al. (2016).

[0326] Development of separate groups

[0327] Mutant M2042 showing reduced susceptibility to Botrytis cinerea was selfed until M4 lines were obtained. Four M4 lines (M2042-1-1, M2042-1-2, M2042-1-4 and M2042-1-5) were fixed for mutations in the tomato gene Pub17 (Solyc02g072080) causing reduced susceptibility. M4 plant M2042-1-2-12 was crossed with MM and the progeny from the F2 plant 1-66 (homozygous pub17 mutant) were used for disease testing.

[0328] The M4 strain M2042-1-3 also showed lower susceptibility, but was segregating for (unlinked) additional mutations. This additional mutation (shown as a mutation in the tomato gene Pub21, as described below) caused a different plant morphology (lighter green, smaller leaves) and even stronger reduction in lesion size after infection with Botrytis. The M4 plant (M2042-1-3-10) fixed for stronger resistance and small light green leaves was crossed with MM and F1 seeds were collected. Subsequently, five F1 plants were selfed and F2 seeds were collected. Single and double mutant F3, F4 and F5 strains were selected.

[0329] Screening for d and sp mutations in Little Tom

[0330] The tomato cultivar Little Tom contains at least two mutations responsible for small plant size in the genes self-pruning (Sp; Solyc06g074350) and dwarfing (D; Solyc02g089160) (Martí et al. 2006). A high-resolution melting (HRM) assay was developed to identify the causal Little Tom SNP for the determinant (sp, self-pruning) phenotype. Forward and reverse primers SP_F (TGAGACGGACAAGATGACATGA) SEQ ID NO:7 and SP_R (TGTCATTTCCCCTTCCAAAGT) SEQ ID NO:8 flanking exon 2 were designed, generating a 218 bp PCR product. These primers were used to generate a PCR product with Phire TM Hot Start DNA polymerase (ThermoFischer) and LCGreenTM Plus+ (BioChem) were used in PCR. System (Idaho Technology), amplification conditions were as follows: 98° C. for 30 s; 98° C. for 5 s, 40 cycles; 57° C. for 5 s; and 72° C. for 15 s, followed by 72° C. for 30 s, 94° C. for 30 s, 25° C. for 30 s, and then cooling to 10° C. Three different genotypes (homozygous SpSp, heterozygous Spsp, and homozygous spsp) could be distinguished by melting curve analysis.

[0331] To identify the causal Tom SNP for the dwarf (d) phenotype in the F2 population, the CAPS marker was used with primer C in exon 8 (GGAACTTGGTGTAGCAGAAATTTCCACATTTC) SEQ ID NO: 9 and primer D in exon 9 (TTAGTGAGCTGAAACTCTAATCCGTAGAC) SEQ ID NO: 10 (Martí et al. 2006). PCR was performed using DreamTaq polymerase with a melting temperature of 60°C. The 243 bp PCR product was then incubated with restriction endonuclease HpyCH4V at 47°C for 4 hours. Subsequently, the product was run on a 1.5% TBE gel at 110V for 1 hour. Digestion of the PCR product into 152 bp and 91 bp fragments indicated the presence of the wild-type (MM-like) allele, while the undigested product indicated the presence of the MT allele.

[0332] Identification of mutant genes (Pub17 and Pub21) by cluster segregation analysis combined with whole genome sequencing (BSA-WGS)

[0333] In total, 205 F2 plants from a cross between the EMS mutant M2042-1-3-10 and the wild-type susceptible Moneymaker (MM) were tested for resistance to Botrytis cinerea by detached leaf assay. Three categories of lesion size could be distinguished: large, medium and small. The distribution of plants among these categories (9:6:1) supports the hypothesis that the two mutant genes are responsible for and / or are required for the extreme resistance phenotype. Plants showing very small or very large lesion diameter size were selected and re-inoculated to confirm resistance or susceptibility. Finally, 13 plants with the smallest lesions and 14 plants with the largest lesions were selected. DNA was isolated from leaf samples of these plants using the DNeasy Plant Mini Kit (Qiagen). The DNA was isolated using and (ThermoFisher Scientific). DNA from resistant and susceptible F2 plants was combined in equimolar amounts to generate two DNA pools, M2042-3R and M2042-3S. These DNA pools were sequenced (whole genome sequencing, WGS) by Novogene Ltd (Hong Kong). For this purpose, a 350 bp insert DNA library was prepared. Paired-end sequencing was performed on the HiSeq platform, with a read length of 150 bp (PE150) at each end, and a genome coverage of approximately 35x for each sample. The reads were mapped to the tomato Heinz reference genome (SL2.50 version), and SNP detection was performed using SAMtools.

[0334] In total, 2,028,009 SNPs were identified. For each library, the number of reads containing the reference (Heinz) allele and the number of reads containing alternative alleles at each SNP position were recorded. Many calculations were performed: 1) the sum of the number of reference alleles (REF) and alternative alleles (ALT) reads at each SNP position in each library (total number of reads = coverage = read depth); 2) the percentage of alternative alleles at each SNP position in each library; % ALT = (ALT / [REF + ALT]) * 100; 3) the difference in the percentage of alternative alleles at each SNP position between the resistance library and the susceptible library (% ALT [R] -% ALT [S]). Next, the filtering of each chromosome SNP was performed as follows: 1) only SNPs with a total number of reads ≥ 35 in the resistance library (M2042-3R) were retained (coverage of at least 35); 2) only SNPs with % ALT [R] ≥ 85 were retained. In theory, alternative alleles should be present in the resistance pool at 100%. However, for safety reasons, a lower percentage was selected. Thereafter, more or less continuous regions of each chromosome were examined for occurrence, where the percentage of alternative alleles per SNP position differed greatly between M2042-3R and M2042-3S (%ALT[R]-%ALT[S]>50).

[0335] On chromosome 2, the region between 33 and 47 Mbp (SL2.50 reference genome) meets this criterion. This region contains the Pub17 gene. In the chromosome 2 region, the following SNPs were observed: [T / A] SNP at position SL2.50ch02:41352738 in the gene Solyc02g072080 (SlPub17), resulting in a premature stop codon R493*. In the M2042-3R library, the frequency of the mutant allele of Pub17 was 100%. This mutant allele has previously been found to confer moderate resistance to Botrytis cinerea (details on the identification and confirmation of the Pub17 mutation are provided below).

[0336] Additionally, the percentage of alternative alleles at each SNP position between the pools M2042-3R and M2042-3S shown by the short arm of chromosome 11 differs greatly. The next filtering consists of selecting SNPs for which alternative alleles are not present in the wild-type Little Tom batch (MTWT) and in the resistant and susceptible pools (M2042R and M2042S) obtained to identify Pub17 mutations (details on the identification and confirmation of Pub17 mutations are provided below), but are present in the pools M2042-3R and M2042-3S of the extreme resistance M2042-1-3-10. Subsequently, the SNPs are filtered to select non-synonymous SNPs in the exons of the annotated genes, for which alternative alleles are present in the resistant and susceptible pools (M2042-3R and M2042-3S), but are not present in the wild-type Little Tom pool (MTWT). In this way, a SNP (T890A) was found in the coding sequence of the gene Solyc11g006030 (SlPub21), resulting in a premature stop codon (L297*) in the deduced protein sequence. The presence of the SNP was confirmed by sequencing a 248 bp PCR product obtained using flanking primers AWPUB21F (5'-CATCAAGTGAAAATAACAAGAA-3') SEQ ID NO: 11 and AWPUB21R (5'-CAAAATTGAAGTTGAACATTC-3') SEQ ID NO: 12.

[0337] Identification of mutant genes (Pub17 alone) by cluster segregant analysis combined with whole genome sequencing (BSA-WGS)

[0338] In total, 200 F2 plants from a cross between the EMS mutant M2042 and the wild-type susceptible Moneymaker were tested for resistance to Botrytis cinerea. Plants showing very small or very large lesion diameter sizes were selected and re-inoculated to confirm resistance or susceptibility. Finally, 18 plants with the smallest lesions and 18 plants with the largest lesions were selected. DNA was isolated from leaf samples of these plants and 10 individual wild-type MT plants using the DNeasy Plant Mini Kit (Qiagen). and (Thermo Fisher Scientific). DNA from resistant and susceptible F2 plants and wild-type MT plants was combined in equal moles to generate three DNA pools, M2042R, M2042S and MTWT. These DNA pools were sequenced (whole genome sequencing, WGS) by Novogene (Hong Kong). For this purpose, a 350 bp insert DNA library was prepared. Paired-end sequencing was performed on the HiSeq platform, with a read length of 150 bp (PE150) at each end, and a genome coverage of approximately 35x for each sample. The reads were mapped to the tomato Heinz reference genome (SL2.50 version), and SNP detection was performed using SAMtools.

[0339] In total, 2,659,728 SNPs were identified. For each library, the number of reads containing the reference (Heinz) allele and the number of reads containing alternative alleles at each SNP position were recorded. Many calculations were performed: 1) the sum of the number of reference alleles (REF) and alternative alleles (ALT) reads at each SNP position in each library (total number of reads = coverage = read depth); 2) the percentage of alternative alleles at each SNP position in each library; % ALT = (ALT / [REF + ALT]) * 100; 3) the difference in the percentage of alternative alleles at each SNP position between the resistance library and the susceptible library (% ALT [R] -% ALT [S]). Next, the filtering of each chromosome SNP was performed as follows: 1) only SNPs with a total number of reads ≥ 35 in the resistance library (M2042R) were retained (coverage of at least 35); 2) only SNPs with % ALT [R] ≥ 80 were retained. In theory, alternative alleles should be 100% present in the resistance pool. However, for safety reasons, a lower percentage was selected. Thereafter, the occurrence of more or less continuous regions of each chromosome was examined, where the percentage difference of alternative alleles at each SNP position between M2042R and M2042S was very large (% ALT[R]-% ALT[S]>50). On chromosome 2, there was a 6.6Mbp region between positions 40900926 and 47531242 (SL2.50 reference genome) that met this criterion. The next filtering consisted of the following: SNP positions were selected in the exons of the annotated genes, for which alternative alleles were present in the resistance pool and the susceptible pool (M2042R and M2042S), but not in the wild-type Little Tom pool (MTWT). In the chromosome 2 region, under the conditions of filtering SNP positions ≥35 coverage, %ALT[R]≥80 and %ALT[R]-%ALT[S]>50, a SNP was observed: a [T / A] SNP at position SL2.50ch02:41352738 in gene Solyc02g072080 (SlPub17), resulting in a premature stop codon R493*.

[0340] Linking Pub17 mutations to Botrytis resistance (Pub17)

[0341] For individual F2 plants from the M2042R and M2042S pools, the sequence of the candidate gene Pub17 was examined to determine the presence and homozygosity of the alternative SNP. The progeny were tested for Botrytis resistance to examine whether segregation for disease resistance occurred in order to link resistance to the mutation.

[0342] Determination of gene expression levels (Pub17 and Pub21) by RT-qPCR

[0343] Gene expression levels were determined by RT-qPCR of plant cDNA synthesized using iScript cDNA synthesis kit (BioRad) using RNA extracted by RNeasy plant mini kit (Qiagen). Specific primers PUB17_qPCR_Fw1 (5'-GGAAGTGAAGGTGTTGCGA-3') SEQ ID NO: 13 and PUB17_qPCR_Rv1 (5'-GCAATGAGGAAATGGCAGT AG-3') SEQ ID NO: 14 were developed for Pub17, generating a PCR product of 100 bp. Additionally, specific primers PUB21_qPCR_Fw (5'-TGAAGAAGGG AAACAAAAGGCT-3') SEQ ID NO: 15 and PUB21_qPCR_Rv (5'-AGTTGAACATTCTGTGGCCA-3') SEQ ID NO: 16 were developed for Pub21, generating a PCR product of 100 bp. Elongation factor 1α (Ef1α) was used as a reference gene, with primers Ef1a-Fw (5'-ATTGGAAACGGATATGCCCCT-3') SEQ ID NO: 17 and Ef1a-Rv (5'-TCCTTACCTGAACGCCTGTCA-3') SEQ ID NO: 18, generating a 101 bp PCR product. RT-qPCR was performed using a CFX96 real-time PCR instrument (Bio-Rad), with two technical replicates for each sample. The relative expression of Pub21 was measured using ΔΔC T The calculated values ​​were calculated according to the method (Livak and Schmittgen 2001).

[0344] RNAi and CRISPR transformation for confirmation of candidate gene (Pub21)

[0345] Two Pub21 RNAi constructs were generated using the binary vector pHellsgate8 (Helliwell and Waterhouse 2003). This vector contains the CaMV 35S promoter driving the expression of the inverted repeat and a kanamycin resistance gene as a selection marker. Primers were designed for Pub21 to amplify a fragment of a tomato gDNA sequence from cv. Moneymaker. RNAi fragment 1 was amplified using the forward primer caccATTGAAGCTCGACGAGGGAA SEQ ID NO: 19 and the reverse primer CGTCATCGCCGATAACAAGT SEQ ID NO: 20, generating a 195 bp product (SEQ ID NO: 5) targeting the U-box domain of Pub21 protein. RNAi fragment 10 was amplified using the forward primer caccCGGTGATATACTCTATTATCTC SEQ ID NO: 21 and the reverse primer GTCAATCCATGTTCATAAGC SEQ ID NO: 22, generating a 205 bp product (SEQ ID NO: 6) targeting the ARM repeat domain. The forward primer contained CACC at the 5' end for directional cloning into the pENTR / D-TOPO (ThermoFisher) vector. The primers were used to clone the DNA using Phusion TM High-fidelity DNA polymerase (Thermo Fisher Scientific) was used for blunt-end PCR, and the PCR product was purified using QIAquick PCR purification kit (Qiagen). The resulting DNA was cloned into pENTR / D-TOPO and transformed into Escherichia coli DH5α. The culture was plated on LB medium containing spectinomycin (100 μg / ul) and grown overnight at 37°C. The plasmid DNA of these clones was sequenced to verify the presence of the correct insert.

[0346] CRISPR / Cas9 constructs were designed to generate deletions within the Pub21 coding sequence using three sgRNAs with the Cas9 endonuclease gene and the NPTII plant selection marker. sgRNAs were designed using the CCTop-CRISPR / Cas9 target online predictor tool (https: / / crispr.cos.uni-heidelberg.de / ; Stemmer et al. 2015), with the tomato genome (Tomato cv. Heinz SL2.50) as a reference for target site evaluation. From the table of sgRNAs provided by the online predictor, only sgRNAs without exonic off-target sites were selected. The selected sgRNAs were further controlled by verifying that their GC content was between 30% and 80% ( http: / / www.endmemo.com / bio / gc.php), and their secondary structures were evaluated according to Liang et al. (2016) (http: / / unafold.rna.albany.edu / ?q=mfold / RNA-Folding-Form; Zuker, 2003). Additional scoring tools were used to compare, confirm, and select the best four sgRNAs (https: / / sgrnascorer.cancer.gov / ; Chari et al. 2017), (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-de sign; Sanson et al., 2018), (http: / / crispr.wustl.edu / ; Wong et al. 2015). The distance between sgRNA target sites was 200 to 900 bp. Pub21 sgRNAs were selected to target different protein domains, with sgRNA1 (AAACATCGAGAAATGGATCG) SEQ ID NO: 23 and sgRNA2 (AATCGATTCGTCTCAAGTAA) SEQ ID NO: 24 located in the U box domain, and sgRNA3 (GATAGAGTGGATTGCTTTGA) SEQ ID NO: 25 located in the ARM repeat domain. Constructs were assembled using the Golden Gate cloning system (Engler et al. 2008). The selected sgRNAs were developed using primers containing the sequences (5'-TGTGGTCTCA [sgRNA sequence] GTTTAGAGCTAGAAATAGC AAG-3') SEQ ID NO: 26 (forward primer) and (5'-TGTGGTCTCAAGCGTAATGCCAACTTTGTAC-3') SEQ ID NO: 27 (reverse primer). A 0-stage reaction was performed for each forward and reverse primer pair with plasmid plCH86966 containing the kanamycin resistance gene as a template. The 0-stage product was then PCR cleaned up (QIAquick PCR purification kit, Qiagen) and the purified product was used to assemble the 1-stage reaction. The 1-stage reaction consisted of combining plasmid pICHSL01009 (AtU6 promoter), plasmids designated for each guide position (plCH47751, pICH47761, pICH47772, and pICH47781), and the purified product from the 0-stage reaction. sgRNA3 was cloned twice in the 1-stage plasmids pICH47772 and pICH47781.Reactions were performed by digestion of the indicated plasmids with BsaI / Eco31I, ligation with T4 DNA (Thermo Scientific, Bleiswijk, The Netherlands) and cloning into E. coli DH5α as follows: pICH47751 (sgRNA1 position 1), pICH47761 (sgRNA2 position 2), pICH47772 (sgRNA3 position 3) and pICH47781 (sgRNA3 position 4). Plasmids were purified using a plasmid preparation kit (Qiagen Benelux BV, Venlo, The Netherlands). The Level 1 construct was assembled into the Level 2 binary vector pAGM4723 along with NPTII (pICH47732), Cas9 (pICH47742) and a linker (pICH41822) by digestion with BpiI / BpsI and ligation with T4 DNA and cloned into E. coli DH5α. The Level 2 construct was purified and sequenced for verification.

[0347] Two RNAi constructs and one CRISPR / Cas9 construct of Pub21 were transformed into electrocompetent Agrobacterium tumefaciens AGL1+virG cells. Transformation of tomato cv.MM was performed as previously described by Huibers et al. (2013).

[0348] Analysis of CRISPR and RNAi transformants (Pub21)

[0349] To determine the presence of mutations in CRISPR transformants, DNA was isolated from young leaves using CTAB buffer (1M Tris-HCl pH 7.5, 0.5M EDTA pH 8.0, 5M NaCl, 2% CTAB). Gene-specific PCR was then performed on genomic DNA using the forward primer FWD_MR_GY_CRISPR (5'-TCCATCTCATTTTCTTTGTCCGA-3') SEQ ID NO: 28 and the reverse primer REV_AW_GY_CRISPR (5'-TGCTGAGATCCTCCAAAAC TATCA-3') SEQ ID NO: 29, which flanks all three sgRNAs and produces a 1358 bp PCR product of the wild-type (WT) allele using DreamTaq DNA polymerase (Thermo Scientific, Bleiswijk, The Netherlands). Additionally, primers AWPUB21F2 (5'-AATAAATTCACTTTTCCCATATA-3') SEQ ID NO: 30 and AWPUB21R2 (5'-GCCGATAACAAGTCCTTC-3') SEQ ID NO: 31 flanking sgRNA1 and sgRNA2 and generating a PCR product of 705 bp were used to identify and confirm small indels. PCR products were sent to Macrogen Europe (Amsterdam, The Netherlands) for sequencing.

[0350] To confirm the integration of the T-DNA of the silencing construct in the RNAi transformant genome, PCR was performed to detect the presence of the NPTII gene and the 35S promoter. The forward and reverse primers NPTII_421_Fw (5'-GAAGGGACTGGCTGCTATTG-3') SEQ ID NO: 32 and NPTII_421_Rv (5'-AATATCACGGGTAGCCAACG-3') SEQ ID NO: 33 for detecting the NPTII gene produced a PCR product of 421 bp. The forward and reverse primers 35S_597_Fw (5'-TACAAAGGCGGCAACAAAC-3') SEQ ID NO: 34 and 35S_597_Rv (5'-AGCAAGCCTTGAATCGTCC-3') SEQ ID NO: 35 for detecting the 35S promoter amplified a region of 597 bp.

[0351] RNAi and CRISPR transformation for confirmation of candidate gene (Pub17)

[0352] Two Pub17 RNAi constructs were generated using the binary vector pHellsgate12 (Helliwell and Waterhouse 2003). This vector contains the CaMV 35S promoter driving the expression of the inverted repeat and a kanamycin resistance gene as a selection marker. Primers were designed for Pub17 to amplify a fragment of the tomato gDNA sequence from cv. Moneymaker. The primer sequences are shown in Table 13. RNAi fragment 7 was amplified using the forward primer caccGGTGTGGGAAATTGATGGCA (SEQ ID NO: 57) and the reverse primer AAACGGCAGCCTTTTACCTG (SEQ ID NO: 58), generating a 176 bp product targeting the UND domain of Pub17 protein. RNAi fragment 3 was amplified using the forward primer caccAGCCCACATCCTCAGTTCTC (SEQ ID NO: 55) and the reverse primer CATATGTCTGCCCTGTTGCC (SEQ ID NO: 56), generating a 240 bp product targeting the U box domain. The forward primer contained CACC at the 5' end for directional cloning into the pENTR / D-TOPO (Thermo Fisher Scientific) vector. The primers were used for cloning using Phusion TM High-fidelity DNA polymerase (Thermo Fisher Scientific) was used for blunt-end PCR, and the PCR product was purified using QIAquick PCR purification kit (Qiagen). The resulting DNA was cloned into pENTR / D-TOPO and transformed into Escherichia coli DH5α. The culture was plated on LB medium containing spectinomycin (100 μg / ul) and grown overnight at 37°C. The plasmid DNA of these clones was sequenced to verify the presence of the correct insert.

[0353] CRISPR / Cas9 constructs were designed to generate deletions within the Pub17 coding sequence using four sgRNAs with the Cas9 endonuclease gene and the NPTII plant selection marker. sgRNAs were designed using the CCTop-CRISPR / Cas9 target online predictor tool (https: / / crispr.cos.uni-heidelberg.de / ; Stemmer et al. 2015), with the tomato genome (Tomato cv. Heinz SL2.50) as a reference for target site evaluation. From the sgRNA table provided by the online predictor, only sgRNAs without exonic off-target sites were selected. The selected sgRNAs were further controlled by verifying that their GC content was between 30% and 80% (http: / / www.endmemo.com / bio / gc.php), and their secondary structures were evaluated according to Liang et al. (2016) (http: / / unafold.rna.albany.edu / ?q=mfold / RNA-Folding-Form; Zuker, 2003). Additional scoring tools were used to compare, validate and select the best four sgRNAs (https: / / sgrnascorer.cancer.gov / ; Chari et al. 2017), (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-de sign; Sanson et al., 2018), (http: / / crispr.wustl.edu / ; Wong et al. 2015). The distance between sgRNA target sites was approximately 600 bp. sgRNAs were selected to target different protein domains, with guide 1 (GGAAATGACCTGAAATCGAA) SEQ ID NO: 51 located in the UND domain, guide 2 (TTCTATATCGAGGTGGATGG) SEQ ID NO: 52 located in the U box domain, and guide 3 (GAGATTTGGGCACACCACAG) SEQ ID NO: 53 and guide 4 (CAGGAACAAAGCGCGCAAGG) SEQ ID NO: 54 located in the ARM repeat domain. Constructs were assembled using the Golden Gate cloning system (Engler et al. 2008).The selected sgRNA was developed by using primers containing the sequence (5'-TGTGGTCTCA [sgRNA sequence] GTTTAGAGCTAGAAATAGCAAG-3') SEQ ID NO: 26 (forward primer) and (5'-TGTGGTCTCAAGCGTAATGCCAACTTTGTAC-3') SEQ ID NO: 27 (reverse primer). A 0-stage reaction was performed with each forward and reverse primer pair together with the plasmid plCH86966 containing the kanamycin resistance gene as a template. The 0-stage product was then PCR cleaned up (QIAquick PCR purification kit, Qiagen), and the cleaned-up product was used to assemble the 1-stage reaction. The 1-stage reaction consisted of combining the plasmid pICHSL01009 (AtU6 promoter), the plasmids designated for each guide position (pICH47751, pICH47761, pICH47772, and pICH47781), and the cleaned-up product from the 0-stage reaction. Reactions were performed by digesting the indicated plasmids with BsaI / Eco31I, ligating with T4 DNA (Thermo Scientific, Bleiswijk, The Netherlands), and cloning into E. coli DH5α as follows: pICH47751 (sgRNA guide 1 position 1), pICH47761 (sgRNA guide 2 position 2), pICH47772 (sgRNA guide 3 position 3), and pICH47781 (sgRNA guide 4 position 4). Plasmid preparation kit (Qiagen Benelux B.V., Venlo, The Netherlands) was used to purify the plasmid. The first-level construct was assembled into the second-level binary vector pAGM4723 along with NPTII (pICH47732), Cas9 (pICH47742) and a linker (pICH41822) by digestion with BpiI / BpsI and ligation with T4 DNA and cloned into E. coli DH5α. The second-level construct was purified and sequenced for verification.

[0354] Two RNAi constructs and one CRISPR / Cas9 construct of Pub17 were transformed into electrocompetent Agrobacterium tumefaciens AGL1+virG cells. Transformation of tomato cv.MM was performed as previously described by Huibers et al. (2013).

[0355] Analysis of CRISPR and RNAi transformants (Pub17)

[0356] To determine the presence of mutations in CRISPR transformants, DNA was isolated from young leaves using CTAB buffer (1M Tris-HCl pH 7.5, 0.5M EDTA pH 8.0, 5M NaCl, 2% CTAB). Gene-specific PCR was then performed on genomic DNA using DreamTaq DNA polymerase (Thermo Scientific, Bleiswijk, The Netherlands). Two different forward primers FWD_MR_GX_CRISPR (5'-ACGGCGTTATCTTC TGAGCT-3') SEQ ID NO:40 and AWPUB17_F1 (5'-AGAGAGTGGG ACGCAGATT-3') SEQ ID NO:42 were used, respectively, paired with reverse primer REV_MR_GX_CRISPR (5'-CATGCTCACACCGTTGGAAT-3') SEQ ID NO:41, generating PCR products of 1942 bp and 827 bp of wild-type (WT) alleles, respectively. The PCR products were sent to Macrogen Europe (Amsterdam, The Netherlands) for sequencing.

[0357] To confirm the integration of the T-DNA of the silencing construct in the RNAi transformant genome, PCR was performed to detect the presence of the NPTII gene and the 35S promoter. The forward and reverse primers NPTII_421_Fw (5'-GAAGGGACTGGCTGCTATTG-3') SEQ ID NO: 32 and NPTII_421_Rv (5'-AATATCACGGGTAGCCAACG-3') SEQ ID NO: 33 for detecting the NPTII gene produced a PCR product of 421 bp. The forward and reverse primers 35S_597_Fw (5'-TACAAAGGCGGCAACAAAC-3') SEQ ID NO: 34 and 35S_597_Rv (5'-AGCAAGCCTTGAATCGTCC-3') SEQ ID NO: 35 for detecting the 35S promoter amplified a region of 597 bp.

[0358] Statistical analysis

[0359] ANOVA F test was performed on the data points of each DLA experiment using R studio v 1.1.463 (2016). The ANOVA test was followed by post hoc test using Tukey HSD method for multiple pairwise comparisons.

[0360] Development of KASP markers for Pub21 mutations

[0361] Developing KASP TMMarking assay (Semagn et al. 2014) was used to track EMS-induced mutations in the Pub21 gene in the F2 population. The forward primer KPUB21_RT_Fw76 (5'-AGTGAAAATAACAAGAAAATTGTGTC-3') SEQ ID NO: 36 was used in combination with two reverse primers. The first reverse primer KPUB21_RTWT_Rv1HEX (5'-GAAGGTCGGAGTCAACGGATTCCACAAGCATTTCAACAA CCA-3') SEQ ID NO: 37 was specific for the wild-type allele, while the second reverse primer KPUB21_RTmut_Rv1FAM (5'-GAAGGTGACCAAGTTCATG CTCCACAAGCATTTCAACAACCT-3') SEQ ID NO: 38 was specific for the Pub21 mutant allele. The reverse primer for the WT sequence was labeled with HEX dye, while the reverse primer for the mutant sequence was labeled with FAM dye. For PCR KASP V4.0 2X Master mix 96 / 384, Low Rox (LGC Group) was used. PCR was performed according to the KASP thermal protocol provided by the manufacturer (LCG Group). The plate was read with a plate reader (Bio-Rad C1000 thermal cycler) and the data were analyzed using Bio-Rad CFX Maestro 1.1.

[0362] Development of KASP markers for Pub17 mutations

[0363] Developing KASP TMMarking assay (Semagn et al. 2014) was used to track EMS-induced mutations in the Pub17 gene in the F2 population. Two forward primers were designed: K_RTWT_For1 5'-GAAGGTGACCAAGTTCATGCTG TCTGGCTTTGATAGTTGGAGTTTTGT-3' SEQ ID NO:43 for the wild-type allele and K_RTmut_For1:GAAGGTCGGAGTCAACGGATTGTCTGGCTTTGATAGTTGGAGTTTTGA SEQ ID NO:44 for the pub17 mutant allele. The reverse primer K_RT_Rev70 5'-GTTGCTGCAGCATTTTCCCGTG-3' SEQ ID NO:45 was used in combination with the forward primer. The forward primer for the WT sequence was labeled with HEX dye, while the forward primer for the mutant sequence was labeled with FAM dye. For PCR KASP V4.0 2X Master mix96 / 384, Low Rox (LGC Group) was used. PCR was performed according to the KASP thermal protocol provided by the manufacturer (LCG Group). Plates were read using a plate reader (Bio-Rad C1000 Thermal Cycler) and data were analyzed using Bio-Rad CFX Maestro 1.1.

[0364] result

[0365] Reduced susceptibility to Botrytis cinerea in tomato mutant M2042

[0366] The Little Tom EMS population developed at Wageningen University - Plant Breeding (Yan et al. 2021) was screened for the identification of S-genes targeting necrotrophic fungi. The EMS population consisted of 4500 M2 families, of which 692 were screened for phenotypic changes including: dwarfing, light green leaves, changes in leaf shape, changes in flower morphology and color, and changes in fruit color. The M2 families were tested for diseases including late blight (Phytophthora infestans isolate C65 or PIC99177), gray mold (Botrytis cinerea strain B05.10), and powdery mildew (Pseudoidium neolycopersici strain On-Ne), where each plant was tested with three pathogens. The Botrytis cinerea disease assay allowed the identification of M2 family M2042 ( Figure 1A), with plant 1 showing reduced susceptibility compared to the WT control and less mycelial growth 9 days after inoculation. Additionally, when the same plants from M2042 were tested for P. infestans, plant 1 showed smaller lesions as well as necrotic spots and less / no mycelial growth 14 days after inoculation compared to the wild type. The mutation in M2042 was fixed in the M4 line, and subsequent Botrytis disease assays confirmed moderate resistance, showing a 20%-30% reduction in lesion diameter when compared to Little Tom.

[0367] Early stop codon mutation in Pub21 (Solyc11g006030) in mutant M2042

[0368] The mutation in M2042 responsible for the reduced lesions after infection with Botrytis cinerea and fixed in the M3 lines M2042-1-1 and M2042-1-2 (referred to as intermediate resistance, IR) showed the generation of an early stop codon in the gene Solyc02g072080 (Pub17) (see below). However, the progeny of the M3 plant M2042-1-3 showed highly resistant (R) M4 plants (also referred to as M2042-1-3-10 and M2042-1-3-14) in addition to the intermediate resistant (IR) plants (also referred to as (ao) M2042-1-3-5; Figure 1A ). This suggests the role of another unlinked mutation in addition to the one identified in Solyc02g072080 (Pub17). To identify additional mutations in M2042-1-3-10, this M4 plant was crossed with susceptible Moneymaker (MM) ( Figure 1B ). Make five strain F1 plants self-pollinate to obtain the F2 progeny of separation.Subsequently, extra mutations were mapped by cluster segregation analysis and whole genome sequencing (BSA-WGS) method.By measuring the lesion diameter of all plants, the isolated F2 population of 205 strains of plants was subjected to initial phenotypic analysis, so as to set up three different libraries of high resistance, medium resistance and susceptible plants for Botrytis cinerea.First, DLA was carried out to all 205 strains of plants, and visual inspection was carried out to the plants demonstrating minimum, medium and maximum lesion diameter.This was followed by the second confirmation and further selection of the plants found in extreme cases.Plants with extreme phenotypes were selected for resistance (M2042-3R) and susceptible (M2042-3S) two libraries, and each library had 13 and 14 strains of plants respectively.In library M2042-3R, except the sudden change in gene Solyc02g072080 (Pub17), as described in Materials and Methods, another interesting non-synonymous mutation was identified by further filtering of whole genome sequencing and SNP. The mutation consists of a T→ASNP at position 890 in the coding region of the gene Solyc11g006030, resulting in a premature stop codon L297*( Figure 2 ). This gene is the tomato ortholog of Pub21.

[0369] Early stop codon mutation in Pub17 (Solyc02g072080) in mutant M2042

[0370] The mutations found in M2042 responsible for the reduced lesion size after infection with Botrytis cinerea (termed intermediate resistance, IR) were mapped by cluster segregant analysis and whole genome sequencing (BSA-WGS) approach. The lesion diameters of all plants derived from the cross between M2042-1-2-12 and MM ( Figure 1A ) were subjected to initial phenotypic analysis in order to establish two different pools of resistant and susceptible plants to Botrytis cinerea. First, DLA was performed on all 200 plants and visual inspection was performed on plants showing the smallest and largest lesion diameters. This was followed by a second confirmation and further selection of plants found in extreme cases. Plants with extreme phenotypes were selected for both the "resistant" and susceptible pools, with 18 plants selected for each pool. As a control, a third pool consisting of wild-type Little Tom plants was developed. As described in Materials and Methods, an interesting non-synonymous mutation was initially identified by whole genome sequencing and further filtering of SNPs. The mutation is an A→T SNP at position 1477 of the coding region of the gene Solyc02g072080, which produces an early stop codon R493*( Fig.13 ). This gene is the tomato ortholog of Pub17.

[0371] To determine the relative expression levels of candidate genes, wild-type MT plants and M4 progenies showing moderate resistance (M2042-1-1-17 and M2042-1-2-12, Figure 1A ) were used for RT-qPCR. Leaves were mock-inoculated or inoculated with Botrytis cinerea and sampled at 3 time points (0, 24, and 48 hours post-infection (hpi)). The expression of Pub17 was significantly induced in wild-type MT after infection with Botrytis cinerea ( Fig.14 ). However, Pub17 expression was not induced in mutants M2042-1-1-17 and M2042-1-2-12.

[0372] To examine whether the Pub17 mutation was associated with Botrytis resistance, disease assays were performed using selected progeny of M4 and F2 plants derived from a cross between MM and the M4 plant M2042-1-2-12 ( Figure 1A , Table 1). F3 and M5 progeny plants were tested for resistance to Botrytis cinerea to evaluate whether they segregated phenotypically.

[0373] Table 1. Pub17 genotypes of M2042 M4 control and F2 plants, and the results of Botrytis disease assays of progeny. WT, homozygous for the wild-type allele of Pub17; H, heterozygous for Pub17 SNP; M, homozygous mutant for Pub17 SNP; R, resistant; S, susceptible.

[0374]

[0375]

[0376] The progeny of M4 plants M2042-1-2-7 and M2042-1-2-12 and F2 plants 1-66, 2-59, 3-10 and 3-26 (homozygous mutants for Pub17) all showed smaller lesion sizes than the wild-type control M2042-1-20-19. On the other hand, the progeny of F2 plant 3-39, which was heterozygous for the Pub17 gene (one mutant allele, one wild-type allele), showed segregation in response to Botrytis infection (Table 1).

[0377] The F3 progeny of 3-39 were genotyped for the Pub17 gene. In total, 4 homozygous mutant plants were observed in 24 progeny plants (Table 2). All four homozygous mutant plants produced smaller lesions than heterozygous and homozygous wild-type progeny. In summary, these results support the hypothesis that the mutation that produces an early stop codon in Pub17 is the causal change in the moderate resistance of M2042 to Botrytis cinerea.

[0378] Table 2. Genotyping and phenotyping results of F3 progeny plants of recombinant 3-39. WT, wild type.

[0379]

[0380] Gene expression levels of mutated Pub17 and Pub21 genes

[0381] To determine the relative expression levels of both mutant genes Pub17 and Pub21, RT-qPCR was performed using wild-type MT plants and M4 progeny (double mutant M2042-1-3-14) that showed strong resistance. Leaves were mock-inoculated or inoculated with Botrytis cinerea and sampled at three time points (0, 24, and 48 hours post-infection (hpi)). The expression of Pub17 was significantly induced in wild-type MT after infection with Botrytis cinerea ( Figure 3 A). However, Pub17 expression was not induced in mutant M2042-1-3-14. Similarly, Pub21 expression was highly induced in wild-type MT after infection with Botrytis cinerea ( Figure 3 B), while the expression in mutant M2042-1-3-14 remained low.

[0382] Botrytis resistance in single pub17 mutants, single pub21 mutants, and double pub17pub21 mutants

[0383] In addition to the Pub17 and Pub21 alleles, individual F2 plants from a cross between MM and the EMS mutant M2042-1-3-10 were genotyped for the mutations d (dwarfing) and sp (self-pruning) that are specific to Little Tom. Individuals were selected and self-pollinated to obtain progeny that were homozygous for the MM alleles for D and SP and homozygous for both Pub17 and Pub21 mutant alleles (double mutants) or homozygous for only the Pub21 mutant allele in combination with homozygous for the Pub17 wild-type allele (single Pub21 mutant) ( Figure 1B Six single Pub21 lines and two double mutant lines were screened for Botrytis resistance using the DLA method and compared with lines derived from M2042-1-2-12 ( Figure 1A ) were compared with five single Pub17 mutant lines and control MM plants. The average lesion diameter ( Figure 4 ).

[0384] Single Pub17 mutants and single Pub21 mutants showed comparable mean lesion diameters, which were significantly different from the mean of control MM plants. Thus, both mutations conferred moderate resistance against Botrytis. The double Pub17 / Pub21 mutant showed an even stronger reduction in mean lesion diameter, which is considered a strong resistance response. These results suggest that mutations in Pub17 and Pub21 have an additive effect on Botrytis resistance.

[0385] Silencing Pub21 by RNAi increases resistance to Botrytis cinerea

[0386] To analyze whether silencing of the identified Pub21 gene is sufficient to obtain reduced susceptibility to Botrytis cinerea and does not involve other (linked) genes, two RNAi constructs targeting Pub21 were prepared, where RNAi fragment 1 (195 bp) targets the region between the U-box domain and the ARM repeats and RNAi fragment 10 (205 bp) targets the ARM repeats domain ( Figure 5 ). A total of 18 RNAi transformants were obtained with construct RNAi1, and a total of 17 RNAi transformants were obtained with construct RNAi10. After the transformants were transferred to the greenhouse, it was noted that some RNAi transformants showed slight autonecrosis on the leaves. T2 progeny were obtained from these primary transformants.

[0387] From the isolated T2 families, individual plants were selected based on the presence of a clear and strong fragment after PCR with NPTII primers (indicating the presence of T-DNA). T3 progeny were obtained from these selected plants (Table 3). The relative expression level of Pub21 was determined using qRT-PCR. The expression level of Pub21 was low in wild-type plants, which complicated the accurate measurement of silencing levels. Nevertheless, several RNAi transformant T3 families that showed lower levels of expression than control plants were identified ( Figure 6 ).

[0388] Subsequently, these five Pub21 RNAi T3 families were subjected to disease assays. Each family was tested for the presence or segregation of the NPTII transgene. In the stem assay and detached leaf assay (DLA), NPTII-positive T3 plants were inoculated with strain B05.10 of Botrytis cinerea. Non-transgenic Moneymaker (MM) plants and RNAi family TV202240, which showed the absence of NPTII, were used as susceptible controls.

[0389] Table 3. RNAi Pub21 transformants and coding of T2 and T3 progeny. Transformants with RNAi silencing fragment 1 or 10 were obtained ( Figure 5 ). Pub21 gene expression levels relative to Moneymaker control are indicated.

[0390]

[0391] For the stem assay, petiole stumps were inoculated and monitored for 21 days. The Disease Severity Index (DSI) was scored from 0-4, indicating increased damage observed or "abs" when the petiole stump fell off. Plants began to show disease symptoms 6 days after inoculation. At 14 dpi, there were clear differences between families, with TV202231 and TV202234 showing the least disease symptoms. By day 21, stem damage had progressed in all groups, with Moneymaker showing the most severe stem damage with the highest percentages of DSI 3 and 4.

[0392] Pub21 RNAi families were also subjected to detached leaf assays (DLA) by Botrytis inoculation. Lesion diameters on infected leaves were measured at 3 and 4 days post inoculation (dpi). Figure 7). Pub21 RNAi T3 families TV202218, TV202234 and TV202241 showed the smallest lesions on average, which was significantly different from the negative control. The data were further analyzed to determine whether there were significant differences between the families. Tukey HSD multiple paired comparison tests were performed between the lesion diameter means of each T3 family. At both 3dpi and 4dpi time points, leaves of T3 families TV202218, TV202234 and TV202241 showed significant differences in average lesion diameter when compared to negative controls MM and T3 family TV202240, while the negative controls did not show significant differences from each other. Although plants containing NPTII of T3 families TV202215 and TV202231 were selected for disease determination, the differences in average lesion size between these families and negative controls MM and TV202240 were not significant.

[0393] The three families with the smallest lesion diameters had relative Pub21 expression levels below 0.50 (Table 3), while the two families with lesion diameters similar to the negative control had relative Pub21 expression levels above 0.50. Thus, the level of resistance to Botrytis cinerea correlated with the level of Pub21 silencing.

[0394] In summary, the results from the Pub21 T3 family in both DLA and stem assays further demonstrated that silencing of Pub21 gene expression conferred increased resistance to B. cinerea.

[0395] CRISPR / Cas9 mutation of wild-type Pub21 confers increased resistance to Botrytis cinerea

[0396] To further test whether mutation of Pub21 in EMS mutant M2042 is sufficient to reduce susceptibility to Botrytis cinerea, CRISPR / Cas9-targeted mutagenesis of Pub21 was performed using a construct with three sgRNAs ( Figure 8 ).

[0397] Tomato cv. Moneymaker was transformed with this construct and 37 transformants were obtained. Primary transformants were genotyped using primer pairs FWD_MR_GY_CRISPR and REV_AW_GY_CRISPR that flank all 3 sgRNAs and produce a PCR product of 1358 bp in WT plants ( Figure 8 ). In addition, PCR was performed using primers AWPUB21F2 and AWPUB21R2 flanking sgRNA1 and sgRNA2 ( Figure 8). The PCR products of all 37 transformants were sequenced with both forward and reverse primers. This allowed the identification of 2 transformants with mutant alleles consisting of a small deletion. Two cuttings from each transformant were transferred to the greenhouse for seed production (Table 4).

[0398] Table 4. Pub21 CRISPR transformants carrying mutant alleles.

[0399] Transformant number mutation Location 30A, 30B 4bp deletion Monoallelic sgRNA1 35A, 35B Small indel Chimeric sgRNA1

[0400] T3 progeny (Table 5) can be obtained from these T2 Pub21 CRISPR plants carrying small deletions. T3 family TV202269 is a homozygous mutant with a 4bp deletion. T3 family TV202281 is isolated for a 4bp deletion mutant allele, while T3 family TV202285 is isolated for a 1bp insertion mutant allele. T3 family TV202278 and TV202283 contain only wild-type alleles.

[0401] Table 5. Progeny of Pub21 CRISPR mutants. WT, wild type.

[0402]

[0403] The effect of the mutation on the predicted protein sequence was determined for each mutant allele. A 4 bp deletion in the sgRNA1 target site in families TV202269 and TV202281 resulted in a premature stop codon at amino acid position 64, while a 1 bp insertion in the sgRNA1 target site in family TV202285 resulted in a frameshift and premature stop codon at amino acid position 98. Thus, in both cases, the premature stop codon occurred at an earlier position than in the EMS M2042 pub21 mutant plants.

[0404] The T3 progeny were simultaneously subjected to the Botrytis cinerea stem assay and DLA using strain B05.10. T3 plants from the segregating families were genotyped and clustered into the following three groups: homozygous mutant, heterozygous and homozygous wild type (Table 6). The heterozygous and homozygous wild type plants of these families were used as susceptible controls together with T3 families TV202278 and TV202283 and untransformed MM plants.

[0405] Table 6. Selected plants for disease assays. Het, heterozygous; WT, wild-type Pub21 allele.

[0406]

[0407] For the stem assay, the inoculated petioles were monitored over 21 days. Six days after inoculation, plants began to show disease symptoms, but stem infection (DSI 3) was only evident by day 14. At this time point, there were clear differences between the homozygous mutant plants of families TV202269, TV202281 and TV202285 on the one hand and the heterozygous plants of the control (homozygous WT) families TV202278 and TV202283 and families TV202281 and TV202285 on the other hand. The negative control showed the highest level of susceptibility to Botrytis cinerea.

[0408] In addition to the stem assay, a detached leaf assay (DLA) was performed on the same families. In the detached leaf assay, the lesion diameter ( Fig. 9 ). The susceptible control group showed similar Botrytis cinerea lesion diameters. Smaller Botrytis cinerea lesion diameters were observed on all three homozygous Pub21 CRISPR mutant T3 families / groups compared to the negative control. The data were further analyzed to determine whether the differences between the groups were significant. Tukey HSD multiple pairwise comparisons were performed between the mean values ​​of lesion diameters for each (selected) T3 family for post hoc comparisons between the homozygous mutant group and the control group. Homozygous mutant plants of three families, TV202285, TV202269 and TV202281, were significantly different from the control group consisting of heterozygous and homozygous WT plants (p<0.0001).

[0409] Silencing Pub17 by RNAi increases resistance to Botrytis cinerea

[0410] To analyze whether silencing of the identified Pub17 gene is sufficient to obtain reduced susceptibility to Botrytis cinerea and does not involve other (mutated) genes, two RNAi constructs targeting Pub17 were prepared, with RNAi fragment 7 (176 bp) targeting the UND domain and RNAi fragment 3 (239 bp) targeting the U-box domain ( Fig.15 A total of 50 RNAi transformants were obtained. After the transformants were transferred to the greenhouse, the relative expression levels of Pub17 in 24 RNAi transformants containing fragment 3 and 19 RNAi transformants containing fragment 7 were determined ( Fig.16 ).

[0411] RNAi fragment 3 appeared to be slightly more effective in silencing compared to RNAi fragment 7 ( Fig.16). The transformant T1 RNAi3-5 (T2 progeny TV181088, Table 7) with the lowest Pub17 gene expression was selected as the main candidate for further testing. At the same time, it was noted that some of these RNAi transformants showed slight autonecrosis on the leaves, namely one RNAi3 transformant (3-29, TV181105) and one RNAi7 transformant (7-33, TV181136; not included in Fig.16 We thought that this might be the result of silencing Pub17. Therefore, these two RNAi families, TV181105 and TV181136, were also selected for further testing.

[0412] From the isolated T2 families TV181088 and TV181136, individual plants were selected based on the presence of a clear and strong fragment after PCR with NPTII primers (indicating the presence of T-DNA). T3 progeny were obtained from these selected plants (Table 7). Subsequently, the T3 RNAi-silenced transformants of Pub17 were inoculated with strain B05.10 of Botrytis cinerea in both the stem assay and the detached leaf assay (DLA). MM plants and the RNAi family (TV192024) showing the absence of NPTII were used as susceptible controls.

[0413] For the stem assay, petiole stumps were inoculated and monitored for 21 days. The disease severity index (DSI) was scored from 0-4, indicating an increase in observed damage or "abs" when the petiole stump fell off. Six days after inoculation, plants began to show disease symptoms. The two negative controls, MM and TV192024, showed susceptibility to Botrytis cinerea, indicating a relatively high percentage of petioles with DSI 3 or 4. At the same time, Pub17 RNAi-silenced transformants exhibited a lower level of susceptibility to Botrytis cinerea based on a low percentage of stems showing DSI of 3 or 4, with families TV192027 and TV192029 having the least sensitive phenotypes.

[0414] Table 7. RNAi Pub17 transformants and coding of T2 and T3 progeny. Transformants with RNAi silencing fragments 3 or 7 were obtained ( Fig.15 ).

[0415]

[0416] At the same time, DLA was performed on T3 lines silenced by Pub17 RNAi of T1 transformants 3-5 and 7-33 (Table 7). The lesion diameters on infected leaves were measured at 3 and 4 days post inoculation (dpi). Fig.17 ).

[0417] The results of the DLA test showed that the two controls, MM and TV192024, showed similar Botrytis cinerea lesion diameter sizes ( Fig.17 ). In contrast, significantly smaller Botrytis cinerea lesions were observed on leaves of Pub17 RNAi-silenced families TV192025, TV192026, TV192027, TV192028, and TV192029 at 3 and 4 dpi. Tukey HSD multiple pairwise comparisons were performed on lesion diameters of all groups. At both 3 and 4 dpi, leaves of all Pub17 RNAi-silenced families TV192025, TV192026, TV192027, TV192028, and TV192029 showed significant differences (p<0.05) in mean lesion diameter when compared to negative control MM and T3 family TV192024, while negative controls did not show significant differences from each other.

[0418] From another RNAi-silenced family, T2 TV181105, T3 progeny were obtained only later. Therefore, the isolated T2 families were tested for Botrytis cinerea, including stem and leaf assays. The T2 plants were genotyped for the presence of NPTII to distinguish transgenic from non-transgenic plants. Based on the low percentage of stems showing DSI 3 and the absence of stems showing DSI 4, the stem test results indicated that the transgenic TV181105 plants had a reduced level of susceptibility to Botrytis cinerea compared to non-transgenic T2 plants and the negative control MM. In the detached leaf assay, the control MM and plants without NPTII were compared to T2 plants containing NPTII (TV05, Fig.18 ). As with the previously tested Pub17 RNAi family, significant differences were observed between the lesion diameters of transgenic TV181105 plants and controls. Tukey HSD multiple pairwise comparisons confirmed that transgenic T2 TV181105 plants had smaller lesion diameters than negative controls (p<0.05). At the same time, negative controls also showed statistical differences from each other.

[0419] CRISPR / Cas9 mutation of wild-type Pub17 confers increased resistance to Botrytis cinerea

[0420] To further test whether mutation of Pub17 in EMS mutant M2042 is sufficient to reduce susceptibility to Botrytis cinerea, CRISPR / Cas9-targeted mutagenesis of Pub17 was performed using a construct with four sgRNAs ( Fig.19 ).

[0421] This construct was used to transform the tomato cv. Moneymaker and 56 transformants were obtained. Fig.19 ) or only the last 2 sgRNAs ( Fig.19) were used to genotype the primary transformants (primers are provided in Table 14). Among the 56 CRISPR Pub17 transformants, 4 transformants with obvious mutant alleles were identified by PCR and electrophoresis ( Fig. 20 ).

[0422] For CRISPR transformants 9, 21, and 36, in addition to the PCR product with the size of the wild-type allele, smaller PCR products appeared in two PCRs. For plant 46, the small PCR product of about 700 bp indicated that a large deletion occurred between the first and last sgRNA target sites. Therefore, it was not possible to amplify the mutant allele with the primer combination used in group B. At the same time, plant 36 showed 3 clear PCR fragments, which may indicate a mosaic mutant. The bands were cut from the gel and sequenced using the primers used to obtain the PCR products. The sequences of the mutant alleles were aligned with the WT sequence to find the exact size of each deletion. The results are shown in Fig.21 middle.

[0423] Small deletion or insertion mutations cannot be identified by gel electrophoresis. Therefore, the PCR products of all transformants showing a band of approximately the WT size were also sequenced. This allowed the identification of an additional bi-allelic mutant plant 7, which had a 1 bp deletion and a 1 bp insertion in one mutant allele, while the second mutant allele had two separate 1 bp insertions ( Fig. 22 ).

[0424] A summary of the mutations identified is provided in Table 8. The size of the deletion and the position relative to the Pub17 sgRNA selected for the construct are recorded. The majority of mutations occurred in the region targeted by sgRNA3.

[0425] Table 8. CRISPR-induced mutations in the Pub17 gene analyzed in primary transformants

[0426]

[0427] The effect of the mutation on the predicted protein sequence is determined for each mutant allele.

[0428] The deletions in plants 21, 46 and the 5 bp deletion in one of the alleles of plant 36 resulted in a premature stop codon, while the others resulted in out-of-frame mutations.

[0429] T3 progeny can be obtained from T2 plants carrying deletions as small as 345 bp (Table 9). T3 Pub17 CRISPR transformants were subjected to both the Botrytis cinerea stem assay and DLA using strain B05.10. All transformants tested were homozygous mutants for the indel mutation in Pub17. MM plants and T2 Pub17 CRISPR transformant family TV181133 (which showed no presence of the mutation observed in its T1 parent plant 21) were used as susceptible controls.

[0430] Table 9. Homozygous mutant T3 progeny of Pub17 CRISPR mutants.

[0431]

[0432]

[0433] For the stem assay, inoculated petioles were monitored over 21 days and disease symptoms were detected at 6 dpi. Negative control MM and T2 Pub17 transformant family TV181133 showed the highest level of susceptibility to Botrytis cinerea, followed by T3 families TV192008 and TV192012, as indicated by a relatively high percentage of stems with a DSI of 4. On the other hand, T3 Pub17 CRISPR families TV192007, TV192009, TV192016, TV192019, TV192014, and TV192023 all exhibited reduced susceptibility to Botrytis cinerea (based on a low percentage of stems showing a DSI of 3 or 4).

[0434] In the detached leaf assay, lesion diameters on infected leaves were measured on days 3 and 4 after inoculation ( Fig.23 ). The two control groups, MM and TV181133, showed similar Botrytis cinerea lesion diameters. Significantly smaller Botrytis cinerea lesion diameters were observed on all eight Pub17 CRISPR mutant T3 families compared to the two negative controls (p<0.001).

[0435] Increased resistance to other pathogens

[0436] As mentioned previously, the initial mutant M2042 was found to show reduced susceptibility to the hemibiotrophic oomycete Phytophthora infestans as well as the necrotrophic fungus Botrytis cinerea. The M2042 mutant did not show an altered response to tomato powdery mildew (Pseudoidium neolycopersici, a biotrophic fungus), i.e. the mutant was as susceptible as wild-type Tom. To analyze whether silencing or mutation of the Pub21 gene affects susceptibility to other tomato pathogens, the EMS-derived Pub17 / Pub21 double mutant was first subjected to a detached leaf assay (DLA) using the necrotrophic fungus Alternaria solani, and the mutant was compared to single pub17 mutants and wild-type control plants. Lesion diameter size was measured at 5 dpi and the results are shown in Fig.10 In the determination of Botrytis cinerea ( Figure 4 ), the pub17 single mutant showed smaller lesions than both wild-type controls, and the Pub17 / Pub21 double mutant showed even smaller lesion size. This suggests that the Pub21 mutation also causes reduced susceptibility to A. solani.

[0437] Next, Pub21 RNAi transformants and CRISPR mutants were subjected to DLA against A. solani. The results are shown in Fig.11 and Fig.12 Similar to the results of the Botrytis assay, a clear trend was observed in the RNAi transformants ( Fig.11 ), indicating that there were differences between the negative control and RNAi T3 families TV202218, TV202234, and TV202241. The data were further analyzed to determine if there were significant differences between the groups. The Tukey HSD multiple pairwise comparison test showed that at both 5dpi and 7dpi, T3 families TV202218, TV202234, and TV202241 showed significant differences in mean lesion diameter when compared to the negative control MM and T3 family TV202240, while the negative controls did not show significant differences from each other. On both days 5 and 7, the mean lesion size of plants containing NPTII of T3 families TV202215 and TV202231 was not significantly different from the negative controls MM and TV192024. This may indicate that although families TV202215 and TV202231 contained the Pub21 silencing construct, the level of silencing was not sufficient to achieve reduced susceptibility to A. solani, as was the case for T3 families TV202218, TV202234 and TV202241.

[0438] Similarly, for Pub21 CRISPR mutants ( Fig.12), Alternaria DLA results showed the same trend as Botrytis DLA results. Homozygous mutant T3 plants of CRISPR families TV202285, TV202269, and TV202281 produced significantly smaller lesions than the negative control. Tukey HSD multiple pairwise comparisons showed that homozygous mutant plants of the three families TV202285, TV202269, and TV202281 were significantly different from the control group consisting of heterozygous and homozygous WT plants (p<0.0001).

[0439] In summary, it was shown that silencing or mutation of the tomato Pub21 gene increased resistance to Alternaria solani and Botrytis cinerea.

[0440] Pub17 and pub21 single and double mutants show increased resistance to Phytophthora infestans

[0441] As mentioned above, tomato pub17 and pub21 EMS and CRISPR mutants and double pub17 and pub21 EMS mutants showed smaller lesions when inoculated with Botrytis cinerea and Alternaria solani. Here, these mutants and the pub17 / pub21 double mutant were tested against another pathogen, Phytophthora infestans, and were shown to have increased resistance to this pathogen.

[0442] To test this, the following T4 plant families (12 plants per family) were used. Table 10 shows how the pub17 CRISPR mutant plant family used in this example was derived as a progeny from the T3 family in Table 9 above, where the mutation types of the CRISPR single mutant plant family are listed. Table 11 shows how the pub21 CRISPR mutant plant family used in this example is the T3 family TV202269 described in Table 6 above or is derived as a progeny from the T3 family described in Table 6 above, where the mutation types of the CRISPR single mutant plant family are listed.

[0443] 1. Pub17 CRISPR mutants:

[0444] TV202081-T4: 2 1 bp insertions in pub17

[0445] TV202085-T4: 1 bp deletion and 1 bp insertion in pub17

[0446] TV202099-T4: 5 bp deletion in pub17

[0447] TV202096-T4: 345 bp deletion in pub17

[0448] Table 10. Homozygous mutant T4 progeny of Pub17 CRISPR mutants.

[0449] T3 family T4 Family Mutant allele indel TV192008 TV202085 Allele 1 1bp deletion, 1bp insertion TV192007 TV202081 Allele 2 2x 1bp insert TV192019 TV202099 Allele 3 5bp deletion TV192023 TV202096 Allele 4 345 bp deletion

[0450] 2.pub21 CRISPR mutants:

[0451] TV202269-T3: 4 bp deletion in pub21

[0452] TV212098-T4: 4 bp deletion in pub21

[0453] TV212087-T4: 1 bp insertion in pub21

[0454] Table 11. Homozygous mutant T4 progeny of Pub21 CRISPR mutants.

[0455] T3 family T4 Family Mutant allele indel TV202269 - Allele 1 4bp deletion TV202281 TV212098 Allele 1 4bp deletion TV202285 TV212087 Allele 2 1bp insertion

[0456] like Figure 1C and Figure 1D As shown, the following single and double EMS mutants were derived from the EMS mutants described above.

[0457] 3.pub17 EMS mutant:

[0458] ·21-0252pub17 BC1S2( Figure 1C )

[0459] ·21-0269pub17 BC2S2( Figure 1C )

[0460] 4.pub21 EMS mutant:

[0461] ·A45 pub21 BC2S2( Figure 1D )

[0462] ·A43 pub21 BC2S2( Figure 1D )

[0463] 5. Pub17 / pub21 EMS double mutant:

[0464] A29 double mutant F3 ( Figure 1D )

[0465] A25 double mutant F3 ( Figure 1D )

[0466] 6. Comparison:

[0467] MM (Moneymaker variety, without pub17 or pub21 modifications)

[0468] Detached leaf assays were performed as described above using the P. infestans isolate PIC99177, and disease indices were scored 4 and 7 days after inoculation. Disease scores were in increasing order of disease severity: R9 = 0 or 1, R8 = 2, R7 = 3, V5 = 4, V6 = 5, V7 = 6; wherein the symptoms are described in Table 12.

[0469] Table 12. Disease index scores for Phytophthora infestans using the detached leaf assay.

[0470] Disease index score describe R9 / 1 or 0 Asymptomatic R8 / 2 The magnitude of the hypersensitivity reaction (HR) is the same as that of the inoculation drop R7 / 3 HR is slightly greater than the vaccination point V5 / 4 Medium sized lesions, no spore formation V6 / 5 Large lesions, no spore formation V7 / 6 Spore formation

[0471] As from Fig.24 As can be seen from the results shown, all tested pub mutants tended to have slower disease progression compared to MM. The best results were obtained with the pub17 / pub21 double mutant.

[0472] References

[0473] Amselem J,Cuomo CA,van Kan JAL et al. (2011) Genomic analysis of thenecrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytiscinerea.PLoS Genet 7:e1002230.

[0474] Bai Y, Huang CC, van der Hulst R, Meijer-Dekens F, Bonnema G, Lindhout P (2003) QTLs for tomato powdery mildew resistance (Oidium lycopersici) in Lycopersicum parviflorum G1.1601 co-localize with two qualitative powderymildew resistance genes. Mol Plant-Microbe Interact16:169-176.

[0475] Benito EP,ten Have A,van't Klooster JW,van Kan JAL(1998)Fungal andplant gene expression during synchronized infection of tomato leaves byBotrytis cinerea.Eur J Plant Pathol 104:207-220.

[0476] Chetelat RT,Stamova L(1999)Tolerance to Botrytis cinerea.Acta Hortic487:313-316.

[0477] Cheung N,Tian L,Liu X,Li X(2020)The destructive fungal pathogen Botrytis cinerea-Insights from genes studied with mutant analysis.Pathogens9:9

[0478] Davis J,Yu D,Evans W,Gokirmak T,Chetelat RT,Stotz HU(2009)Mapping ofloci from Solanum lycopersicoides conferring resistance or susceptibility toBotrytis cinerea in tomato.Theor Appl Genet 119:305-314.

[0479] Dean R, van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD(2012)The top 10 fungal pathogens in molecular plant pathology.Mol Plant Pathol 13:414-430.

[0480] Ten MJ,Nut F(2008)Tomato.In:Vegetables II(pp.249-323).Springer,NewYork,NY.

[0481] Egashira H,Kuwashima A,Ishiguro H,Fukushima K,Kaya T,Imanishi S(2000)Screening of wild accessions resistant to gray mold (Botrytis cinerea Pers.)inLycopersicon.Acta Physiologiae Plantarum 22:324-326.

[0482] Elad Y,Williamson B,Tudzynski P,Delen N(eds)(2007)Botrytis:Biology,Pathology and Control.Springer,Dordrecht,The Netherlands.

[0483] Engler C, Kandzia R, Marillonnet S(2008)A one pot, one step, precision cloning method with high throughput capability.PloS One 3:e3647.

[0484] Finkers R,van den Berg P,van Berloo R,ten Have A,van Heusden AW,vanKan JAL,Lindhout P(2007a)Three QTLs for Botrytis cinerea resistance intomato.Theor Appl Genet 114:585-593.

[0485] Finkers R,van Heusden AW,Meijer-Dekens F,van Kan JAL,Maris P,LindhoutP(2007b)The construction of a Solanum habrochaites LYC4 introgression linepopulation and the identification of QTLs for resistance to Botrytiscinerea.Theor Appl Genet 114:1071-1080.

[0486] Finkers R,Bai Y,van den Berg P,van Berloo R,Meijer-Dekens F,ten HaveA,van Kan J,Lindhout P,van Heusden AW(2008)Quantitative resistance toBotrytis cinerea from Solanum neorickii.Euphytica 159:83-92.

[0487] RL,Chetelat RT,Stotz HU(2004)Resistance to Botrytiscinerea in Solanum lycopersicoides is dominant in hybrids with tomato,andinvolves induced hyphal death.Eur J Plant Pathol 110:13-23.

[0488] Hanika K,Schipper D,Chinnappa S,Oortwijn M,Schouten HJ,Thomma BPHJ,Bai Y(2021)Impairment of tomato WAT1 enhances resistance to vascular wiltfungi despite severe growth defects.Front Plant Sci 12:721674.

[0489] He Q,McLellan H,Boevink PC,Sadanandom A,Xie C,Birch PRJ,Tian Z(2015)U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specificimmune pathways triggered by Phytophthora infestans.J Exp Bot 66:3189-3199.

[0490] Huibers RP,Loonen AEHM,Gao D,Van den Ackerveken G,Visser RGF,Bai Y(2013)Powdery mildew resistance in tomato by impairment of SlPMR4 andSlDMR1.PLoS One 8:e67467.

[0491] Jiang Y,Yu D(2016)The WRKY57 transcription factor affects theexpression of jasmonate ZIM-domain genes transcriptionally to compromiseBotrytis cinerea resistance.Plant Physiol 171:2771-2782.

[0492] IH(1992)Discovery,characterization and exploitation of Mlopowdery mildew resistance in barley.Euphytica 63:141-152.

[0493] Kusch S,Panstruga R(2017)mlo-based resistance:an apparently universal“weapon”to defeat powdery mildew disease.Mol Plant-Microbe Interact 30:179-189.

[0494] Lin T,Zhu G,Zhang J,Xu X,Yu Q,Zheng Z,Zhang Z,Lun Y,Li S,Wang X,HuangZ,Li J,Zhang C,Wang T,Zhang Y,Wang A,Zhang Y,Lin K,Li C,Xiong G,Xue Y,Mazzucato A,Causse M,Fei Z,Giovannoni JJ,Chetelat RT,Zamir D, T,Li J,Ye Z,Du Y,Huang S(2014)Genomic analyses provide insights into the history oftomato breeding.Nature Genet 46:1220-1226.

[0495] Livak KJ,Schmittgen TD(2001)Analysis of relative gene expression datausing real-time quantitative PCR and the 2 -ΔΔC T method.Methods 25:402-408.

[0496] MartíE,Gisbert C,Bishop GJ,Dion MS,García-Martínez JL(2006)Geneticand physiological characterization of tomato cv.Micro-Tom.J Exp Bot 57:2037-2047.

[0497] McLellan H,Chen K,He Q,Wu X,Boevink PC,Tian Z,Birch PRJ(2020)Theubiquitin E3 ligase PUB17 positively regulates immunity by targeting anegative regulator,KH17,for degradation.Plant Comm 1:100020.

[0498] Meissner R,Jacobson Y,Melamed S,Levyatuv S,Shalev G,Ashri A,Elkind Y,Levy A(1997)A new model system for tomato genetics.Plant J 12:1465-1472.

[0499] Ni X,Tian Z,Liu J,Song B,Li J,Shi X,Xie C(2010)StPUB17,a novel potatoUND / PUB / ARM repeat type gene,is associated with late blight resistance andNaCl stress.Plant Sci 178:158-169.

[0500] Nicot PC,Moretti A,Romiti C,Bardin M,Caranta C,Ferrière H(2002)Differences in susceptibility of pruning wounds and leaves to infection byBotrytis cinerea among wild tomato accessions.TGS Report 52:24-26.

[0501] Prins TW,Tudzynski P,von Tiedemann A,Tudzynski B,Ten Have A,HansenME,Tenberge K,van Kan JAL(2000)Infection strategies of Botrytis cinerea andrelated necrotrophic pathogens.In Kronstad JW(ed)Fungal Pathology(pp.33-64).Springer,Dordrecht.

[0502] Qin T,Liu S,Zhang Z,Sun L,He X,Lindsey K,Zhu L,Zhang X(2019)GhCyP3improves the resistance of cotton to Verticillium dahliae by inhibiting theE3 ubiquitin ligase activity of GhPUB17.Plant Mol Biol 99:379-393.

[0503] Richards JK,Xiao C-L,Jurick II WM(2021)Botrytis spp.:A contemporaryperspective and synthesis of recent scientific developments of a widespreadgenus that threatens global food security.Phytopathol111:432-436.

[0504] RStudio Team(2016).RStudio:Integrated Development for R.RStudio,Inc.,Boston,MA URL http: / / www.rstudio.com / .

[0505] Semagn K,Babu R,Hearne S,Olsen M(2014)Single nucleotide polymorphismgenotyping using Kompetitive Allele Specific PCR(KASP):overview of thetechnology and its application in crop improvement.Mol Breed 33:1-14.

[0506] Schouten HJ,Tikunov Y,Verkerke W,Finkers R,Bovy A,Bai Y,Visser RGF(2019)Breeding has increased the diversity of cultivated tomato in TheNetherlands.Front Plant Sci 10:1606.

[0507] Smith JE,Mengesha B,Tang H,Mengiste T,Bluhm BH(2014)Resistance toBotrytis cinerea in Solanum lycopersicoides involves widespreadtranscriptional reprogramming.BMC Genomics 15:334.

[0508] Sun K,van Tuinen A,van Kan JAL,Wolters AMA,Jacobsen E,Visser RGF,BaiY(2017)Silencing of DND1 in potato and tomato impedes conidial germination,attachment and hyphal growth of Botrytis cinerea.BMC Plant Biology 17:235.

[0509] Sun K,Wolters AMA,Loonen AEHM,Huibers RP,van der Vlugt R,Goverse A,Jacobsen E,Visser RGF,Bai Y(2016)Down-regulation of Arabidopsis DND1orthologs in potato and tomato leads to broad-spectrum resistance to lateblight and Rewdery mildew. 25:123-138.

[0510] ten Have A,van Berloo R,Lindhout P,van Kan JAL(2007)Partial stem andleaf resistance against the fungal pathogen Botrytis cinerea in wildrelatives of tomato.Eur J Plant Pathol 117:153-166.

[0511] van Baarlen P,Woltering EJ,Staats M,van Kan JAL(2007)Histochemicaland genetic analysis of host and non-host interactions of Arabidopsis withthree Botrytis species:an important role for cell death control.MolecularPlant Pathology 8:41-54.

[0512] van Kan JAL(2006)Licensed to kill:the lifestyle of a necrotrophicplant pathogen.Trends Plant Sci 11:247-253.

[0513] van Kan JAL,Shaw MW,Grant-Downton RT(2014)Botrytis species:relentlessnecrotrophic thugs or endophytes gone rogue?Mol Plant Pathol 15:957-961.

[0514] Verlaan MG,Szinay D,Hutton SF,de Jong H,Kormelink R,Visser RGF,ScottJW,Bai Y(2011)Chromosomal rearrangements between tomato and Solanum chilensehamper mapping and breeding of the TYLCV resistance gene Ty-1.Plant J 68:1093-1103.

[0515] Williamson B,Tudzynski B,Tudzynski P,van Kan JAL(2007)Botrytiscinerea:the cause of grey mould disease.Mol Plant Pathol 8:561-580.

[0516] Yan Z,Appiano M,van Tuinen A,Meijer-Dekens F,Schipper D,Gao D,HuibersR,Visser RGF,Bai Y,Wolters AMA(2021)Discovery and characterization of a novel tomato mlo mutant from an EMS mutagenized Micro-Tom population.Gene 12:719.

[0517] Yang CW,Gonzalez-Lamothe R,Ewan RA,Rowland O,Yoshioka H,Shenton M,YeH,O'Donnell E,Jones JDG,Sadanandom A(2006)The E3 ubiquitin ligase activity ofArabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 arerequired for cell death and defense.Plant Cell 18:1084–1098.

[0518] Zhang H, Zhang W, Jian G, Qi F, Si N(2016)The genes involved in theprotective effects of phytohormones in response to Verticillium dahliae infection in Gossypium hirsutum.J Plant Biol 59:194-202

[0519] Documentation, distribution and distribution of Pub21(SEQ ID NO:1)

[0520]

[0521] Coding sequence, mutant Pub21, SNP T to A shown in bold (SEQ ID NO:2)

[0522] ATGATTTTTTCGTGGATACGTAAAAAGAAGGTTACAAAATTGAACTCTTGTAAAGAACTTACGATTCCATCTCATTTTCTTTGTCCGATTTCTCTTGATTTAATGAAAGATCCAGTCACATTATGTACTGGAATTTCATATGATCGTGAAAACATCGAGAAATGGATCGAGGCACGGAACTCAACGTGCCCCGTGACGAATCAACATTTGAGAAATTTCAATCTCATACCAAACCATGCCATAAGGAAAACGATTCAAGATTGGTGTGTGGAGAACAAAAACTATGGCATTGAAAGAGTTCCAACTCCTAGAATTCCAATCGATTCGTCTCAAGTAACGGAGATTTGCTCGAGGCTAATGATTGAAGCTCGACGAGGGAACGAGATGAAATGCAGAGAGTTAGTTGGACGAGTCAGGATTTTAGCTAAAGAGAGCGATAGAAACAAGAAATGCATAGTGGAATGTGGGGTAGGTTATGTTTTTGCAACATGTTTCGAGATTTTCTCTATGGGAATTCAGGATGAACTCTTGAAGGACTTGTTATCGGCGATGACGTGGATGTTTCCTATTGGTCAAGAGGGGATATCGAAACTCGTGTCATCGACGTCTTTACGTTGCATGGCAAGGTTCATGAAAGGTGAAGATTTATCAGCAAGACAAAACGTAGTTATAGTCATGAAGGAATTGCTCTATTATGACCAAAGTTGCACAAATGTGTTAATAGATATCGAAGATTTGGTTGAATCTTTGTACCAAATGGTGAAAGTACCGATTTGCCCCTCCACGACGAAAGCGTCGTTAACGGTGATATACTCTATTATCTCATATACATCAAGTGAAAATAACAAGAAAATTGTGTCTAAATTTGTAAACATGGGGATTGTTTGTT AGGTTGTTGAAATGCTTGTGGATTGTGAAAAGAGTATAATAGAGAAGGGGTTGGCTATTTTGGACATAATTTGCAATTTTGAAGAAGGGAAACAAAAGGCTTATGAACATGGATTGACTATGGCAATAATAGCCAAAAAAATAATGAGAGTTACAGAAATGGCCACAGAATGTTCAACTTCAATTTTGTGGAAACTTTGCAAAAGTGGAAATAATGAGAATAATTCAGTAATTGAGGCATTGGAATTAGGTGTATTTCAAAAATTATTGGTGGTTTTACAAGTGGGATGTGGTGAAAAAACTAAGGAAAAAGCTACTGAATTGTTGAAATTGATGAATCTTTACAAAGATAGAGTGGATTGCTTTGATGGATCAACTTTCAAGTATCTCAAGAAGTCATATTGA

[0523] Protein sequence, Little Tom wild-type Pub21 (SEQ ID NO:3)

[0524] MIFSWIRKKKVTKLNSCKELTIPSHFLCPISLDLMKDPVTLCTGISYDRENIEKWIEARNSTCPVTNQHLRNFNLIPNHAIRKTIQDWCVENKNYGIERVPTPRIPIDSSQVTEICSRLMIEARRGNEMKCRELVGRVRILAKESDRNKKCIVECGVGYVFATCFEIFSMGIQDELLKDLLSAMTWMFPIGQEGISKLVSSTSLRCMARFMKGEDLSARQNVVIVMKELLYYDQSCTNVLIDIEDLVESLYQMVKVPICPSTTKASLTVIYSIISYTSSENNKKIVSKFVNMGIVCLVVEMLVDCEKSIIEKGLAILDIICNFEEGKQKAYEHGLTMAIIAKKIMRVTEMATECSTSILWKLCKSGNNENNSVIEALELGVFQKLLVVLQVGCGEKTKEKATELLKLMNLYKDRVDCFDGSTFKYLKKSY

[0525] Protein sequence, mutant Pub21, premature stop codon at position 297 is shown in bold (SEQ ID NO:4)

[0526] MIFSWIRKKKVTKLNSCKELTIPSHFLCPISLDLMKDPVTLCTGISYDRENIEKWIEARNSTCPVTNQHLRNFNLIPNHAIRKTIQDWCVENKNYGIERVPTPRIPIDSSQVTEICSRLMIEARRGNEMKCRELVGRVRILAKESDRNKKCIVECGVGYVFATCFEIFSMGIQDELLKDLLSAMTWMFPIGQEGISKLVSSTSLRCMARFMKGEDLSARQNVVIVMKELLYYDQSCTNVLIDIEDLVESLYQMVKVPICPSTTKASLTVIYSIISYTSSENNKKIVSKFVNMGIVC ＊

[0527] Sequence of the 195bp RNAi1 Pub21 silencing fragment (SEQ ID NO:5)

[0528] ATTGAAGCTCGACGAGGGAACGAGATGAAATGCAGAGAGTTAGTTGGACGAGTCAGGATTTTAGCTAAAGAGAGCGATAGAAACAAGAAATGCATAGTGGAATGTGGGGTAGGTTATGTTTTTGCAACATGTTTCGAGATTTTCTCTATGGGAATTCAGGATGAACTCTTGAAGGACTTGTTATCGGCGATGACG

[0529] Sequence of the 205bp RNAi10 Pub21 silencing fragment (SEQ ID NO:6)

[0530] CGGTGATATACTCTATTATCTCATATACATCAAGTGAAAATAACAAGAAAATTGTGTCTAAATTTGTAAACATGGGGATTGTTTGTTTGGTTGTTGAAATGCTTGTGGATTGTGAAAAGAGTATAATAGAGAAGGGGTTGGCTATTTTGGACATAATTTGCAATTTTGAAGAAGGGAAACAAAAGGCTTATGAACATGGATTGAC

[0531] Table 13

[0532]

[0533]

[0534]

[0535] Pub17 sequences

[0536] Pub17 Little Tom wild-type allele sequence (SEQ ID NO: 39)

[0537]

[0538] Table 14. Primers used for genotyping Pub17

[0539]

[0540]

[0541] Pub17-KASP assay K_RTWT_For1 primer (SEQ ID NO: 43)

[0542] GAAGGTGACCAAGTTCATGCTGTCTGGCTTTGATAGTTGGAGTTTTGT

[0543] Pub17-KASP assay K_RTmut_For1 primer (SEQ ID NO: 44)

[0544] GAAGGTCGGAGTCAACGGATTGTCTGGCTTTGATAGTTGGAGTTTTGA

[0545] Pub17 KASP assay K_RT_Rev70 primer (SEQ ID NO: 45)

[0546] GTTGCTGCAGCATTTTCCCGTG

[0547] Sequence of RNAi3 Pub17 silencing fragment (SEQ ID NO:46)

[0548] AGCCCACATCCTCAGTTCTCAACGGGTTTGTGGCGTTGATGCGATACTGCAGGTTTTGCTATTTGGCTTTGAAGAGGATGATATGGGGTTGAGATTGGGTAAGCATAAGAAGCCGAAGAGAGGGCTGATTAGTCAAGAGATTGCAGAGACATTCATTTCTGTACCAAAGGACTTCTGTTGTCCGATATCGTTGGATTTGATGAGGGATCCAGTTATTGTGGCAACAGGGCAGACATATG

[0549] Sequence of RNAi7 Pub17 silencing fragment (SEQ ID NO: 47)

[0550] GGTGTGGGAAATTGATGGCATCTGCTGCAATTTTCTCATCGTTGAAGACAAAGGTCGCCGACACTGGAAGCGTTCTTGGCGCCGGTGGATCTGACAGATGTTGGGTTGTTGCAAACTTTAACGGCGTTATCTTCTGAGCTGATTTCTGCATATTCAGGTAAAAGGCTGCCGTTT

[0551] Pub17 Little Tom modified allele sequence: SNP A to T at position 1477 is shown in bold (SEQ ID NO: 48)

[0552] T GATTTGGGCACACCACAGAGGCACGGGAAAATGCTGCAGCAACATTATTCAGTCTGTCAGCTGTTCATGACTATAAGAGGCAAATAGCAAAAGAAGATGGGGCAGTCGAGGCCTTAGCGGGTCTGTTGCGAGAAGGTTCTCCCAGAGGGAAGAAAGATGCAGTAACTGCTCTATTTAATTTATCCACCCACACAGATAATTGTGCGAGGATGATAGAGTCTGGAGCTGTTACTGCTCTAGTTGGAGCTTTGGGAAGTGAAGGTGTTGCTGAAGAAGCTGCTGGTGCATTGGCGCTGATTGTTAGGCAGCAAGTTGGTGCTACAGCTGTTGGCAATGAGGAAATGGCAGTAGCAGGGCTCATTGCAATGATGCGATGTGGGACACCAAGAGGGAAGGAGAATGCTGTTGCTGCATTACTTGAATTATGCCGCGGTGGTGGAGCAGCTGCTACTGAGAGGGTCTTGAAGGCGCCGTCATTAGCAAGTTTACTTCAGACGTTGCTCTTTACAGGAACAAAGCGCGCAAGGAGGAAAGCAGCATCGCTTGCTAGAGTATTCCAACGGTGTGAGCATGCAGCAGTTCATTATAGTGGGTTTGGTGTAGGATATGCATTTGCTGGAAACTCAGCTGCTGCTAGGGATTCAACTTTTCCTGGTGATGTCTCAGTGTCCATGTCCATTTCAGTTCCAGTATTATAG

[0553] Pub17 wild-type amino acid sequence of Little Tom (SEQ ID NO: 49)

[0554] MASAAIFSSLRRQRSPTLEAFLAPVDLTDVGLLQTLTALSSELISAYSGKRLPFYQRKNCKSLLRKIQVFSVLLECLLENKKNRSSGSSDLPFTAFLCFKELYLLLYRSKILLDYCSYSSKLWLLLQNHSISGHFHDLNQEISTLLDVFPLKDLKNLSEDVREQVELLKKQARKSQLFVDKYDEMLRLKLFSFLNEFENGGVPDYAQLYSFFVEKLGICNPRSCRVEIEFLEEQIVNHEGDIEPTSSVLNGFVALMRYCRFLLFGFEEDDMGLRLGKHKKPKRGLISQEIAETFISVPKDFCCPISLDLMRDPVIVATGQTYDRASISRWMEEGHCTCPKTGQLLDHTRLVPNRALRNLIMHWCAARKIPYDPLESGDPCVECFPSASPSRAALEANKATAALLIKQLESGTQIAKTIAAQEIRLLAKTGKENRAYIAEAGAIPHLKNLLSSPDAVAQENSVTAMLNLSIFDKNKGRIIDEVGCLALIVGVLRFGHTTEARENAAATLFSLSAVHDYKRQIAKEDGAVEALAGLLREGSPRGKKDAVTALFNLSTHTDNCARMIESGAVTALVGALGSEGVAEEAAGALALIVRQQVGATAVGNEEMAVAGLIAMMRCGTPRGKENAVAALLELCRGGGAAATERVLKAPSLASLLQTLLFTGTKRARRKAASLARVFQRCEHAAVHYSGFGVGYAFAGNSAAARDSTFPGDVSVSMSISVPVL

[0555] Modified amino acid sequence of Pub17 little Tom: The premature stop codon at position 493 is shown in bold (SEQ ID NO: 50)

[0556] MASAAIFSSLRRQRSPTLEAFLAPVDLTDVGLLQTLTALSSELISAYSGKRLPFYQRKNCKSLLRKIQVFSVLLECLLENKKNRSSGSSDLPFTAFLCFKELYLLLYRSKILLDYCSYSSKLWLLLQNHSISGHFHDLNQEISTLLDVFPLKDLKNLSEDVREQVELLKKQARKSQLFVDKYDEMLRLKLFSFLNEFENGGVPDYAQLYSFFVEKLGICNPRSCRVEIEFLEEQIVNHEGDIEPTSSVLNGFVALMRYCRFLLFGFEEDDMGLRLGKHKKPKRGLISQEIAETFISVPKDFCCPISLDLMRDPVIVATGQTYDRASISRWMEEGHCTCPKTGQLLDHTRLVPNRALRNLIMHWCAARKIPYDPLESGDPCVECFPSASPSRAALEANKATAALLIKQLESGTQIAKTIAAQEIRLLAKTGKENRAYIAEAGAIPHLKNLLSSPDAVAQENSVTAMLNLSIFDKNKGRIIDEVGCLALIVGVL *

[0557] Pub17 sgRNA1(SEQ ID NO:51)

[0558] GGAAATGACCTGAAATCGAA

[0559] Pub17 sgRNA2(SEQ ID NO:52)

[0560] TTCTATATCGAGGTGGATGG

[0561] Pub17 sgRNA3(SEQ ID NO:53)

[0562] GAGATTTGGGCACACCACAG

[0563] Pub17 sgRNA4(SEQ ID NO:54)

[0564] CAGGAACAAAGCGCGCAAGG

[0565] Pub17 RNAi3 FWD(SEQ ID NO:55)

[0566] caccAGCCCACATCCTCAGTTCTC

[0567] Pub17 RNAi3 REV(SEQ ID NO:56)

[0568] CATATGTCTGCCCTGTTGCC

[0569] Pub17 RNAi7 FWD(SEQ ID NO:57)

[0570] caccGGTGTGGGAAATTGATGGCA

[0571] Pub17 RNAi7 REV(SEQ ID NO:58)

[0572] AAACGGCAGCCTTTTACCTG

Claims

1. A tomato plant or plant material having reduced Pub21 protein levels, activity or expression, thereby conferring increased resistance to lesion forming pathogens relative to a reference tomato plant or plant material.

2. The tomato plant or plant material according to claim 1, wherein the tomato plant or plant material has been modified to reduce the level, activity or expression of Pub21 protein.

3. The tomato plant or plant material according to claim 1 or 2, wherein the tomato plant or plant material comprises a modified Pub21 allele.

4. A tomato plant or plant material according to claim 3, wherein the modified Pub21 allele has at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an orthologue or homologue thereof, and wherein the Pub21 allele comprises a mutation, optionally wherein the mutation is at nucleotide position 890 of SEQ ID NO: 1 (wild-type Pub21 allele) or a position corresponding thereto.

5. The tomato plant or plant material according to claim 4, wherein the mutation is a SNP, preferably a T to A SNP.

6. The tomato plant or plant material according to any one of claims 1 to 5, further having reduced Pub17 protein level, activity or expression.

7. A plant part obtained from the tomato plant according to any one of claims 1 to 6.

8. A seed capable of producing a tomato plant according to any one of claims 1 to 6.

9. A method of increasing the resistance of a tomato plant or plant material to a lesion-forming pathogen, the method comprising: Reducing the level, activity or expression of Pub21 protein in said tomato plant or plant material, and optionally further comprising reducing the level, activity or expression of Pub17 protein in said tomato plant or plant material.

10. A method of producing a tomato plant having increased resistance to lesion forming pathogens, the method comprising: Reducing the level, activity or expression of Pub21 protein in said tomato plant or plant material, and optionally further comprising reducing the level, activity or expression of Pub17 protein in said tomato plant or plant material.

11. The method of claim 9 or 10, wherein the method comprises modifying the tomato plant or plant material to reduce the level, activity or expression of Pub21 protein in the tomato plant or plant material, optionally wherein the method further comprises modifying the tomato plant or plant material to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.

12. The method according to any one of claims 9 to 11, wherein the method comprises obtaining a mutant population of tomato plants, and selecting a modified tomato plant comprising a modified Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an orthologue or homologue thereof and comprising a mutation that reduces the level, activity or expression of Pub21 in the tomato plant or plant material, optionally wherein the modified tomato plant further comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or one or more orthologues or homologues thereof and comprising a mutation that reduces the level, activity or expression of Pub17 in the tomato plant or plant material.

13. A method of identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material, the method comprising: (a) determining the level, activity or expression of Pub21 protein and optionally Pub17 protein in one or more tomato plants and comparing it to the level, activity or expression of Pub21 protein and optionally Pub17 protein in a reference tomato plant; and (b) selecting tomato plants having reduced levels, activity or expression of said Pub21 protein and optionally said Pub17 protein relative to said reference tomato plants; wherein a reduction in the level, activity or expression of said Pub21 protein and optionally said Pub17 protein indicates increased resistance to lesion forming pathogens relative to said reference tomato plants.

14. A method of identifying a tomato plant having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material, wherein the method comprises the following steps: (a) obtaining a mutant population of tomato plants; (b) screening the tomato plant population for the presence of a Pub21 allele that is at least 70% identical to SEQ ID NO: 1 (wild-type Pub21 allele) or a direct homologue or homologue thereof and contains a mutation that reduces the level, activity or expression of Pub21 protein in the tomato plants or plant materials, and optionally screening the tomato plant population for the presence of a Pub17 allele that is at least 70% identical to SEQ ID NO: 39 (wild-type Pub17 allele) or a direct homologue or homologue thereof and contains a mutation that reduces the level, activity or expression of Pub17 protein in the tomato plants or plant materials; and (c) selecting tomato plants having the Pub21 allele and optionally the Pub17 allele.

15. The tomato plant or plant material according to any one of claims 1 to 6, the plant part according to claim 7, the seed according to claim 8 or the method according to any one of claims 9 to 14, wherein the lesion forming pathogen is a necrotrophic fungal pathogen, preferably selected from the group consisting of Alternaria internecine, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Stem Cell Pseudomonas, Fusarium oxysporum and Pythium species, preferably wherein the lesion forming pathogen is Botrytis cinerea.

Images