Gene editing target gene to enhance natural killer cell function

Abstract

Several embodiments of the methods and compositions disclosed herein relate to immune cells that are gene edited (e.g., using Crispr / Cas) to modulate, reduce, or otherwise eliminate expression of one or more endogenous genes. In several embodiments, the edited cells are engineered to express chimeric antigen receptors that target tumor antigens (e.g., CD19, ligands of the NKG2D receptor, CD70, and / or BCMA, etc.). In several embodiments, the editing enhances one or more aspects of immune cell efficacy in cellular immunotherapy, including cytotoxicity (e.g., ADCC) and / or persistence.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 370,357 filed on August 3, 2022, U.S. Provisional Patent Application No. 63 / 489,965 filed on March 13, 2023, and U.S. Provisional Patent Application No. 63 / 498,166 filed on April 25, 2023, the entire contents of each of the above applications are incorporated herein by reference. Field of the Invention

[0002] Several embodiments disclosed herein relate to methods and compositions comprising genetically engineered and edited immune cells for cancer immunotherapy. In several embodiments, the disclosure relates to cells engineered to express chimeric antigen receptors (CARs). In several embodiments, cells expressing CARs are also gene-edited to enhance their amplification capacity, cytotoxicity to target cells, persistence (e.g., survival period) after administration, and / or to reduce potential side effects of these cells for cancer immunotherapy. background

[0003] As we learn more about various cancers and the characteristics that cancer cells use to specifically distinguish them from healthy cells, we are developing treatments that exploit the unique characteristics of cancer cells. Immunotherapy using engineered and / or edited immune cells is one approach to treating cancer. Incorporation by Reference of Material in Sequence Listing Documents

[0004] This application incorporates by reference the materials contained in the sequence listing XML file submitted concurrently with this application: File name: NKT089WO_ST26.xml; created on August 2, 2023, size 1,364,361 bytes. Summary of the Invention

[0005] Immunotherapy is a new technological advancement in the treatment of disease in which immune cells are engineered to express certain targeting and / or effector molecules that are able to specifically recognize and respond to diseased or damaged cells. This represents a promising advance, at least in part due to the potential to specifically target diseased or damaged cells, as opposed to more traditional approaches such as chemotherapy, in which all cells are affected and the expected outcome is that a sufficient number of healthy cells survive to allow the patient to survive. One type of immunotherapy is the recombinant expression of cytotoxic receptors (e.g., chimeric receptors) in immune cells to enable targeted recognition and destruction of abnormal cells of interest.

[0006] In several embodiments, provided herein are populations of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, the immune cells being gene-edited within a target sequence in the MED12 gene and within a target sequence in the CISH gene; and the editing resulting in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene, as compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene.

[0007] In several embodiments, the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998. In several embodiments, the target sequence within the MED12 gene comprises a plurality of target sites selected from SEQ ID NOs: 997, 938-944, 996, and 998.

[0008] In several embodiments, the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, 463-466, or 1012. In several embodiments, the target sequence in the CISH gene comprises a plurality of target sites selected from SEQ ID NOs: 1013, 153-157, 463-466, and 1012.

[0009] In several embodiments, the extracellular ligand binding domain targets an antigen selected from BCMA, NKG2D ligands, CD19, and CD70. In several embodiments, the extracellular ligand binding domain targets the BCMA antigen. In several embodiments, the extracellular ligand binding domain targets an NKG2D ligand. In several embodiments, the extracellular ligand binding domain targets the CD19 antigen. In several embodiments, the extracellular ligand binding domain targets the CD70 antigen.

[0010] In several embodiments, the transmembrane domain comprises CD8, CD28, or a portion thereof, optionally wherein the transmembrane domain comprises CD8α or a portion thereof. In several embodiments, the transmembrane domain comprises CD8 or a portion thereof. In several embodiments, the transmembrane domain comprises CD28 or a portion thereof. According to an embodiment, the transmembrane domain optionally comprises CD8α or a portion thereof, in combination with CD8 or CD28.

[0011] In several embodiments, the cytotoxic signaling complex comprises a CD3 zeta domain, and / or the cytotoxic signaling complex comprises an intracellular signaling domain of OX40, 4-1BB, CD28, or a signaling portion thereof, optionally an intracellular signaling domain of OX40, or a signaling portion thereof.

[0012] In several embodiments, at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15). In some such embodiments, the cytotoxic receptor and mbIL15 are optionally encoded by the same nucleic acid molecule, optionally wherein the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide. In some such embodiments, the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, optionally wherein the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide. In some such embodiments, wherein the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, wherein the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

[0013] In several embodiments, the cell is further gene-edited within a target sequence in the CBLB gene, wherein the target sequence in the CBLB gene comprises any one of SEQ ID NOs: 164, 165-166, 453-456, or 1005-1008.

[0014] In several embodiments, the cells are further gene-edited within a target sequence in the A disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) gene, the target sequence comprising any one of SEQ ID NOs: 682-687.

[0015] In several embodiments, the cells are further gene-edited within a target sequence in the hypoxia-inducible factor 1-alpha (HIF1-alpha) gene, the target sequence comprising any one of SEQ ID NOs: 750-760.

[0016] In several embodiments, the cell is further gene-edited within a target sequence in the DGKze gene, and the target sequence comprises any one of SEQ ID NOs: 688-723.

[0017] In several embodiments, the cell is further gene-edited within a target sequence in the GSK-3β gene, and the target sequence comprises any one of SEQ ID NOs: 724-749.

[0018] In several embodiments, the cell is further gene-edited within a target sequence in the LAG3 gene, and the target sequence comprises any one of SEQ ID NOs: 761-789.

[0019] In several embodiments, the cell is further gene-edited within a target sequence in the TIM3 gene, and the target sequence comprises any one of SEQ ID NOs: 790-825.

[0020] In several embodiments, the cell is further gene-edited within a target sequence in the TRIM29 gene, and the target sequence comprises any one of SEQ ID NOs: 826-835 or 1009-1011.

[0021] In several embodiments, the cell is further gene-edited within a target sequence in the IL-1R8 gene, and the target sequence comprises any one of SEQ ID NOs: 836-865.

[0022] In several embodiments, the cells are further gene-edited within a target sequence in the CD38 gene, and the target sequence comprises any one of SEQ ID NOs: 866-874.

[0023] In several embodiments, the cell is further gene-edited within a target sequence in the FBP-1 gene, and the target sequence comprises any one of SEQ ID NOs: 875-889.

[0024] In several embodiments, the cell is further gene-edited within a target sequence in the INSIG1 gene, and the target sequence comprises any one of SEQ ID NOs: 890-934.

[0025] In several embodiments, the cell is further gene-edited within a target sequence in the CDK8 gene, and the target sequence comprises any one of SEQ ID NOs: 949-955.

[0026] In several embodiments, the cell is further gene-edited within a target sequence in the CCNC gene, and the target sequence comprises any one of SEQ ID NOs: 956-961 or 999-1001.

[0027] In several embodiments, the cell is further gene-edited within a target sequence in the ID3 gene, and the target sequence comprises any one of SEQ ID NOs: 963-969.

[0028] In several embodiments, the cell is further gene-edited within a target sequence in the SOX4 gene, and the target sequence comprises any one of SEQ ID NOs: 970-976.

[0029] In several embodiments, editing of one or more target sequences is performed using an RNA-guided endonuclease. In several embodiments, editing of one or more target sequences is performed using a CRISPR / Cas9 system.

[0030] In several embodiments, the immune cells comprise natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, iPSC-derived T cells, NK-92 cells, or any combination thereof.

[0031] In several embodiments, a population of gene-edited immune cells is provided, wherein the immune cells are gene-edited within a target sequence in the MED12 gene and within a target sequence in the CISH gene, and the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene, as compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene. In several embodiments, the gene-edited immune cells are genetically engineered immune cells that express a cytotoxic receptor that comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, and the extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer.

[0032] In several embodiments, a population of genetically engineered and gene-edited immune cells expressing a cytotoxic receptor is provided, wherein the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in the MED12 gene, the target sequence within the MED12 gene comprising any one of SEQ ID NO: 997, 938-944, 996, or 998, and the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene, as compared to immune cells that have not been edited within the target sequence in the MED12 gene.

[0033] In several embodiments, a composition is provided comprising a population of genetically engineered and / or gene-edited immune cells as disclosed herein.

[0034] In several embodiments, provided is a method of treating a subject having a disease or disorder comprising administering to the subject a population of genetically engineered and gene-edited immune cells as disclosed herein.

[0035] In several embodiments, provided are uses of genetically engineered and edited immune cells as disclosed herein for treating a subject with a disease or disorder. In several embodiments, the disease or disorder is an infectious disease, an autoimmune disease, a cancer, or a tumor.

[0036] In several embodiments, the immune cell is a NK cell.

[0037] Also provided herein is a population of gene-edited and genetically engineered immune cells comprising immune cells that are (i) genetically engineered to express a cytotoxic receptor and (ii) gene-edited within a target sequence in a gene selected from the group consisting of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, and SOX4.

[0038] In several embodiments, RNA-guided endonucleases are used to gene-edit immune cells.

[0039] In several embodiments, a gene-edited immune cell population is provided, comprising immune cells that are gene-edited within a target sequence in the MED12 gene. In some embodiments, the immune cells are genetically engineered to express a cytotoxic receptor. In several embodiments, a gene-edited and genetically engineered immune cell population is provided, comprising immune cells that (i) are genetically engineered to express a cytotoxic receptor and (ii) are gene-edited within a target sequence in the MED12 gene.

[0040] In some embodiments, the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by cells of a target tumor or cancer. In some embodiments, gene editing is within a target sequence in the MED12 gene, and the target sequence comprises any one of SEQ ID NOs: 938-994 or 996-998. In some embodiments, gene editing of MED12 reduces the expression and / or function of the MED12 protein encoded by the MED12 gene, such as compared to immune cells not edited within the target sequence. In some embodiments, gene editing of MED12 reduces the expression of the MED12 protein encoded by the MED12 gene, such as compared to immune cells not edited within the target sequence. In some embodiments, gene editing of MED12 reduces the expression function of the MED12 protein encoded by the MED12 gene, such as compared to immune cells not edited within the target sequence. In some embodiments, gene editing of MED12 reduces expression and function of the MED12 protein encoded by the MED12 gene, as compared to immune cells that have not been edited within the target sequence. In several embodiments, editing of the MED12 gene is performed using an RNA-guided endonuclease. In some embodiments, the immune cell is a natural killer cell.

[0041] In several embodiments, there is provided a gene-edited immune cell group, which includes immune cells that carry out gene editing within the target sequence in the ADAM17 gene. In some embodiments, the immune cells are genetically engineered to express cytotoxic receptors. In some embodiments, the cytotoxic receptors include an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain is combined with an antigen expressed by the cells of the target tumor or cancer. In some embodiments, the gene editing within the target sequence in the ADAM17 gene reduces the expression and / or function of the ADAM17 protein encoded by the ADAM17 gene, such as compared with the immune cells not edited within the target sequence. In some embodiments, the gene editing within the target sequence in the ADAM17 gene reduces the expression of the ADAM17 protein encoded by the ADAM17 gene, such as compared with the immune cells not edited within the target sequence. In some embodiments, the gene editing within the target sequence in the ADAM17 gene reduces the function of the ADAM17 protein encoded by the ADAM17 gene, such as compared with the immune cells not edited within the target sequence. In some embodiments, gene editing within a target sequence in the ADAM17 gene reduces the expression and function of the ADAM17 protein encoded by the ADAM17 gene, as compared to immune cells that are not edited within the target sequence. In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing cytotoxic receptors, the cytotoxic receptors comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) gene, the editing resulting in reduced expression and / or function of the ADAM17 protein encoded by the ADAM17 gene, as compared to immune cells that are not edited within the target sequence in the ADAM17 gene, and the editing of the ADAM17 gene is performed using an RNA-guided endonuclease.

[0042] In several embodiments, a gene-edited immune cell group is provided, comprising immune cells that perform gene editing within a target sequence in the MED12 gene. In several embodiments, immune cells also perform gene editing within a target sequence in the CISH gene. In several embodiments, a gene-edited immune cell group is provided, comprising immune cells that (i) perform gene editing within a target sequence in the MED12 gene; and (ii) perform gene editing within a target sequence in the CISH gene. In several embodiments, a gene-edited immune cell group is provided, comprising immune cells that perform gene editing within a target sequence in the MED12 gene and within a target sequence in the CISH gene. In some embodiments, immune cells are genetically engineered to express cytotoxic receptors. In some embodiments, the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by cells of a target tumor or cancer. In some embodiments, gene editing within the target sequence in the MED12 gene reduces the expression and / or function of the MED12 protein encoded by the MED12 gene, as compared to immune cells that are not edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression and / or function of the CIS protein encoded by the CIS gene, as compared to immune cells that are not edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression of the CIS protein encoded by the CIS gene, as compared to immune cells that are not edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the function of the CIS protein encoded by the CIS gene, as compared to immune cells that are not edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression and function of the CIS protein encoded by the CIS gene, as compared to immune cells that are not edited within the target sequence. In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer, the immune cells are gene-edited within a target sequence in the MED12 gene, the editing resulting in reduced expression and / or function of the Mediator complex subunit 12 (MED12) protein encoded by the MED12 gene, as compared to immune cells that have not been edited within the target sequence in the MED12 gene, and the editing of the MED12 gene is performed using an RNA-guided endonuclease.In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene, the editing resulting in reduced expression and / or function of the mediator complex subunit 12 (MED12) protein and the CIS protein, as compared to immune cells not edited within the target sequences in the MED12 and CISH genes, and the editing is performed using an RNA-guided endonuclease. In some embodiments, the immune cells are natural killer cells.

[0043] Also provided herein is a genetically engineered and gene-edited immune cell population comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, the immune cells being gene-edited within a target sequence in the hypoxia-inducible factor 1-alpha (HIF1-alpha) gene, the editing resulting in reduced expression and / or function of the HIF1-alpha protein encoded by the HIF1-alpha gene, as compared to immune cells not edited within the target sequence in the HIF1-alpha gene, and the editing of the HIF1-alpha gene being performed using an RNA-guided endonuclease.

[0044] In some such embodiments, the immune cells are optionally edited within an additional target sequence in a target gene to result in reduced expression levels of a protein encoded by the target gene, as compared to immune cells that have not been edited within the additional target sequence.

[0045] In another embodiment, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells express a protein selected from the group consisting of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, ME D12, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof, wherein gene editing is performed within a target sequence in a target gene, wherein the editing results in reduced expression and / or function of a protein encoded by the target gene, such as compared to an immune cell that has not been edited within the target sequence in the target gene, wherein immune cells are edited at an additional target sequence within the target gene to result in reduced expression levels of a protein encoded by the target gene, such as compared to immune cells that have not been edited at the additional target sequence, and wherein the editing of the target gene is performed using an RNA-guided nuclease.

[0046] In several embodiments, editing of the target gene is performed using the CRISPR / Cas9 system.

[0047] In several embodiments, the extracellular ligand binding domain targets an antigen selected from the group consisting of NKG2D ligands, CD19, CD70, and BCMA. In several embodiments, the extracellular ligand binding domain targets an NKG2D ligand. In several embodiments, the extracellular ligand binding domain targets CD19. In several embodiments, the extracellular ligand binding domain targets CD70. In several embodiments, the extracellular ligand binding domain targets BCMA.

[0048] In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, the antigen being selected from the group consisting of a ligand of an NKG2D receptor, CD19, CD70, and BCMA, and the immune cells expressing a cytotoxic receptor selected from the group consisting of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, F Gene editing is performed within a target sequence in a target gene of BP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof, such that the editing results in reduced expression and / or function of a protein encoded by the target gene, as compared to an immune cell that has not been edited within the target sequence in the target gene, and immune cells are edited within an additional target sequence within the target gene to result in reduced expression levels of a protein encoded by the target gene, as compared to immune cells that have not been edited within the additional target sequence, and the editing of one or more target genes is performed using a CRISPR / Cas system.

[0049] In several embodiments, the genetically engineered and gene-edited immune cells provided herein exhibit enhanced expansion capacity, enhanced cytotoxicity towards target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that do not comprise the one or more edits.

[0050] In several embodiments, a method for producing a population of gene-edited immune cells is provided, comprising contacting the population of immune cells with a targeted endonuclease that edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, CISH, CBLB, or any combination thereof, wherein the gene-edited immune cells exhibit: enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that have not been edited within the target sequence in the target gene.

[0051] In several embodiments, a method for making a population of gene-edited immune cells is provided, comprising contacting the population of immune cells with an RNA-guided endonuclease that edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the gene-edited immune cells exhibit: enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that have not been edited within the target sequence in the target gene.

[0052] In several embodiments, a method for producing a population of gene-edited immune cells is provided, comprising contacting the population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP), wherein: the RNP edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, the Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof, and the gene-edited immune cells exhibit: enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that are not edited within the target sequence in the target gene.

[0053] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKζ. In some embodiments, the gene is GSK-3β. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0054] In several embodiments, a method of making a population of gene-edited immune cells is provided, comprising: (a) contacting the population of immune cells with a first RNA-guided endonuclease, wherein the RNA-guided endonuclease edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and (b) contacting the population of immune cells with a second RNA-guided endonuclease, wherein the second RNA-guided endonuclease edits within a target sequence in the CISH gene to result in reduced expression levels of a CIS protein encoded by the CISH gene, as compared to immune cells that have not been edited within the target sequence in the CISH gene, wherein the gene-edited immune cells exhibit: enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target gene and the target sequence in the CISH gene.

[0055] In several embodiments, a method for making a gene-edited immune cell population is provided, comprising (a) contacting the immune cell population with a first Cas-gRNA ribonucleoprotein (RNP) complex, wherein the RNP complex edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the first RNP complex comprises Cas9, CasX, CasY, or any combination thereof. combination; and (b) contacting the immune cell population with a second Cas-gRNA RNP complex, wherein the second RNP complex edits within the target sequence in the CISH gene to result in reduced expression levels of the CIS protein encoded by the CISH gene, as compared to immune cells that are not edited within the target sequence in the CISH gene, and wherein the Cas of the second RNP complex comprises Cas9, CasX, CasY, or a combination thereof, wherein the gene-edited immune cells exhibit: enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that are not edited within the target sequence in the target gene and the CISH gene.

[0056] In several embodiments, a method of making a gene-edited immune cell population is provided, comprising (a) contacting the immune cell population with a first Cas-gRNA ribonucleoprotein (RNPP) complex, wherein the RNP edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the first RNP complex comprises Cas9, CasX, CasY, or any combination thereof. combination; and (b) contacting the immune cell population with a second Cas-gRNA RNP complex, wherein the second RNP complex edits within the target sequence in the CBLB gene to result in reduced expression levels of CBLB protein encoded by the CBLB gene, compared to immune cells that have not been edited within the target sequence in the CBLB gene, and wherein the Cas of the second RNP complex comprises Cas9, CasX, CasY, or a combination thereof, wherein the gene-edited immune cells exhibit: enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence in the target gene and the CBLB gene.

[0057] In several embodiments, a method of making a gene-edited immune cell population is provided, comprising (a) contacting the immune cell population with a first RNA-guided endonuclease, wherein the first endonuclease edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and (b) contacting the immune cell population with a second RNA-guided endonuclease, wherein the second RNA-guided endonuclease edits within a target sequence in the CISH gene to result in the C (c) contacting the population of immune cells with a third RNA-guided endonuclease, wherein the third RNA-guided endonuclease edits within a target sequence in a CBLB gene to result in reduced expression of a CBLB protein encoded by the CBLB gene, as compared to immune cells that have not been edited within the target sequence in the CBLB gene, wherein as compared to immune cells that have not been edited within the target sequence in the target gene, the CISH, and the CBLB genes, wherein the gene-edited immune cells exhibit: enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof.

[0058] In several embodiments, a method of making a gene-edited immune cell population is provided, comprising (a) contacting the immune cell population with a first Cas-gRNA ribonucleoprotein (RNP) complex, wherein the first RNP complex edits within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and (b) contacting the immune cell population with a second RNP complex, wherein the second RNP complex edits within a target sequence in a CISH gene to result in expression of a CIS protein encoded by the CISH gene. The method further provides for the step of: (a) contacting the population of immune cells with a third RNP complex, wherein the third RNP complex edits the target sequence in the CBLB gene to result in reduced expression of the CBLB protein encoded by the CBLB gene, as compared to immune cells that are not edited within the target sequence in the CBLB gene, wherein the Cas of each of the first, second, and third RNP complexes comprises Cas9, CasX, CasY, or a combination thereof, and the gene-edited immune cells exhibit: enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that are not edited within the target sequence in the target gene, CISH, and CBLB genes.

[0059] In several embodiments, a method of making a gene-edited immune cell population is provided, comprising (a) contacting the immune cell population with a first Cas-gRNA ribonucleoprotein (RNP) complex, wherein the RNP complex edits within a target sequence in the MED12 gene; and (b) contacting the immune cell population with a second Cas-gRNA RNP complex, wherein the second RNP complex edits within a target sequence in the CISH gene.

[0060] In several embodiments, a method of making a population of gene-edited immune cells is provided, comprising contacting the population of immune cells with a plurality of Cas-gRNA ribonucleoprotein (RNP) complexes, wherein the plurality of RNPs edit within a target sequence in a CISH gene to result in reduced expression levels of a CIS protein encoded by the CISH gene, as compared to immune cells that have not been edited within the target sequence in the CISH gene; the plurality of RNP complexes edit within a target sequence in a CBLB gene to result in reduced expression levels of a CBLB protein encoded by the CBLB gene, as compared to immune cells that have not been edited within the target sequence in the CBLB gene; the plurality of RNP complexes induce expression of a gene selected from Editing within a target sequence in a target gene of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the Cas of each of the multiple RNP complexes comprises Cas9, CasX, CasY, or a combination thereof, and the gene-edited immune cells exhibit: enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that have not been edited within the target sequence in CISH, CBLB, and the target gene.

[0061] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKζ. In some embodiments, the gene is GSK-3β. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0062] In several embodiments, the manufacturing method further comprises contacting the immune cell population with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.

[0063] In several embodiments, immune cells are gene-edited within a target sequence in the ADAM17 gene, and the target sequence comprises any one of SEQ ID NOs: 682-687. In several embodiments, immune cells are gene-edited within a target sequence in the HIF-1α gene, and the target sequence comprises any one of SEQ ID NOs: 750-760. In several embodiments, immune cells are gene-edited within a target sequence in the DGKζ gene, and the target sequence comprises any one of SEQ ID NOs: 688-723. In several embodiments, immune cells are gene-edited within a target sequence in the GSK-3β gene, and the target sequence comprises any one of SEQ ID NOs: 724-749. In several embodiments, immune cells are gene-edited within a target sequence in the LAG3 gene, and the target sequence comprises any one of SEQ ID NOs: 761-789. In several embodiments, immune cells are gene-edited within a target sequence in the TIM3 gene, and the target sequence comprises any one of SEQ ID NOs: 790-825. In several embodiments, immune cells are gene-edited within a target sequence in the TRIM29 gene, and the target sequence comprises any one of SEQ ID NOs: 826-835. In several embodiments, immune cells are gene-edited within a target sequence in the IL-1R8 gene, and the target sequence comprises any one of SEQ ID NOs: 836-865. In several embodiments, immune cells are gene-edited within a target sequence in the CD38 gene, and the target sequence comprises any one of SEQ ID NOs: 866-874. In several embodiments, immune cells are gene-edited within a target sequence in the FBP-1 gene, and the target sequence comprises SEQ ID NOs: 875-889. In several embodiments, immune cells are gene-edited within a target sequence in the INSIG1 gene, and the target sequence comprises any one of SEQ ID NOs: 890-934. In several embodiments, immune cells are gene-edited within a target sequence in the MED12 gene, wherein the target sequence comprises any one of SEQ ID NOs: 938-944. In several embodiments, the immune cells are gene-edited within a target sequence in the MED12 gene, and a target sequence comprising SEQ ID NOs: 938-944 is used to target the MED12 gene, and optionally, wherein the immune cells are gene-edited within a target sequence in the MED13 gene, and the target sequence comprises any one of SEQ ID NOs: 945-948. In several embodiments, the immune cells are gene-edited within a target sequence in the MED13 gene, wherein the target sequence comprises SEQ ID NOs: 945-948.In several embodiments, immune cells are gene-edited within a target sequence in the CDK8 gene, and the target sequence comprises any one of SEQ ID NOs: 949-955. In several embodiments, immune cells are gene-edited within a target sequence in the CCNC gene, and the target sequence comprises any one of SEQ ID NOs: 956-962. In several embodiments, immune cells are gene-edited within a target sequence in the ID3 gene, and the target sequence comprises any one of SEQ ID NOs: 963-969. In several embodiments, immune cells are gene-edited within a target sequence in the SOX4 gene, and the target sequence comprises any one of SEQ ID NOs: 970-976. In several embodiments, immune cells are gene-edited within a target sequence in the CISH gene, and the target sequence comprises any one of SEQ ID NOs: 153-157 or 463-466. In several embodiments, immune cells are gene-edited within a target sequence in the CBLB gene, and the target sequence comprises any one of SEQ ID NOs: 164 to 166 or 453-456. In several embodiments, cells are gene-edited within a target sequence in the MED12 gene. In several embodiments, the target sequence in the MED12 gene comprises any one of SEQ ID NOs: 996-998. In several embodiments, cells are gene-edited within a target sequence in the CCNC gene. In several embodiments, the target sequence in the CCNC gene comprises any one of SEQ ID NOs: 999-1001. In several embodiments, cells are gene-edited within a target sequence in the SOCS2 gene. In several embodiments, the target sequence in the SOCS2 gene comprises any one of SEQ ID NOs: 1002-1004. In several embodiments, cells are gene-edited within a target sequence in the CISH gene. In several embodiments, the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1012-1013. In several embodiments, the cells are gene-edited within a target sequence in the CBLB gene. In several embodiments, the target sequence in the CBLB gene comprises any one of SEQ ID NOs: 1005-1008. In several embodiments, the cells are gene-edited within a target sequence in the TRIM29 gene. In several embodiments, the target sequence in the TRIM29 gene comprises any one of SEQ ID NOs: 1009-1011. In several embodiments, the cells are gene-edited within a target sequence in the CD70 gene.In several embodiments, cells are gene-edited within target sequences in the TGFBR2 gene, TIGIT gene, adenosine A2a receptor (ADORA2A) gene, SMAD3 gene, MAPKAPK3 gene, CEACAM1 gene, DDIT4 gene, NKG2A gene, SOCS2 gene, B2M gene, PDCD1 gene, and / or TRAC gene.

[0064] In several embodiments, at least a portion of the genetically engineered immune cells are engineered to express interleukin-15 (IL15). In some embodiments, the IL15 is membrane-bound IL15 (mbIL15). In several embodiments, at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15). The cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule. In several embodiments, the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

[0065] In several embodiments, cells are edited within target sequences in the CISH, CBLB, and ADAM17 genes.

[0066] In several embodiments, cells are edited within target sequences in the CISH, CBLB, and HIF1α genes.

[0067] In several embodiments, cells are edited within target sequences in the CISH, CBLB, and FBP-1 genes.

[0068] In several embodiments, cells are edited within target sequences in the CISH, CBLB, and / or MED12 genes. In several embodiments, cells are edited within target sequences in the CISH and MED12 genes. In several embodiments, cells are edited within target sequences in the CBLB and MED12 genes. In several embodiments, cells are edited within target sequences in the CISH, CBLB, and MED12 genes.

[0069] In several embodiments, the cells are also edited within a target sequence in the CD70 gene, and the method further comprises contacting the immune cell population with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain that targets CD70, a transmembrane domain, and a cytotoxic signaling complex.

[0070] In several embodiments, the method does not include editing the CD70 gene. In several embodiments, the method does not include editing the CD70 gene, and the immune cells express their normal amount of endogenous CD70. In several embodiments, the cells are not edited within the target sequence in the CD70 gene.

[0071] In several embodiments, the cytotoxic receptor binds to BCMA, CD19, CD70, an NKG2D ligand, CD38, GPRC5D, CD138, DLL3, EGFR, PSMA, FLT3, KREMEN2, or a combination thereof. In some embodiments, the cytotoxic receptor binds to BCMA. In some embodiments, the cytotoxic receptor binds to CD19. In some embodiments, the cytotoxic receptor binds to CD70. In some embodiments, the cytotoxic receptor binds to an NKG2D ligand. In some embodiments, the cytotoxic receptor binds to CD38. In some embodiments, the cytotoxic receptor binds to GPRC5D. In some embodiments, the cytotoxic receptor binds to CD138. In some embodiments, the cytotoxic receptor binds to GPRC5D. In some embodiments, the cytotoxic receptor binds to DLL3. In some embodiments, the cytotoxic receptor binds to EGFR. In some embodiments, the cytotoxic receptor binds to PSMA. In some embodiments, the cytotoxic receptor binds to FLT3. In some embodiments, the cytotoxic receptor binds to KREMEN2.

[0072] In several embodiments, the cytotoxic receptor does not target CD19.

[0073] In several embodiments, the cytotoxic receptor does not target an NKG2D ligand.

[0074] In several embodiments, immune cells include natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSC), iPSC-derived NK cells, iPSC-derived T cells, NK-92 cells, or a combination thereof. In several embodiments, immune cells include natural killer (NK) cells. In several embodiments, immune cells include T cells. In several embodiments, immune cells include natural killer (NK) cells and T cells.

[0075] In several embodiments, the immune cells comprise a mixture of NK cells and T cells or a mixture of iPSC-derived NK cells and T cells. In several embodiments, the immune cells comprise a mixture of iPSC-derived NK cells and / or iPSC-derived T cells.

[0076] Also provided herein is a method of treating cancer in a subject, comprising administering to the subject a population of genetically engineered immune cells provided herein. In some embodiments, the cancer cells express an antigen that is bound by a cytotoxic receptor.

[0077] In several embodiments, the immune cells are allogeneic with respect to the subject. In some embodiments, the immune cells are obtained from a donor who does not have cancer.

[0078] In several embodiments, the methods of treatment or uses provided herein further comprise administering IL2.

[0079] In several embodiments, the transmembrane domain of the expressed cytotoxic receptor comprises CD8, CD28 or a portion thereof, optionally wherein the transmembrane domain comprises CD8α or a portion thereof. In several embodiments, the transmembrane domain of the expressed cytotoxic receptor comprises CD8. In several embodiments, the transmembrane domain of the expressed cytotoxic receptor comprises CD8α. In several embodiments, the cytotoxic signaling complex of the expressed cytotoxic receptor comprises a CD3ζ domain and an intracellular signaling domain. In several embodiments, the cytotoxic signaling complex of the expressed cytotoxic receptor comprises a CD3ζ domain and an intracellular signaling domain of OX40, 4-1BB, CD28 or a signaling portion thereof, optionally an intracellular signaling domain of OX40 or a signaling portion thereof. In several embodiments, the cytotoxic signaling complex of the expressed cytotoxic receptor comprises a CD3ζ domain and an intracellular signaling domain of OX40. In several embodiments, at least a portion of the genetically engineered immune cells are engineered to express interleukin-15 (IL15). In some embodiments, the IL15 is membrane-bound IL15 (mbIL15).In several embodiments, at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15).

[0080] In several embodiments, a composition is provided herein comprising a genetically engineered and gene-edited immune cell population as provided herein. In several embodiments, a composition is provided herein comprising a genetically engineered and gene-edited immune cell population as provided herein. In several embodiments, a composition is provided herein comprising a genetically engineered and gene-edited immune cell population as provided herein and a pharmaceutically acceptable excipient. In several embodiments, a composition is provided herein comprising a genetically engineered and gene-edited immune cell population as provided herein and a pharmaceutically acceptable excipient.

[0081] Also provided herein is a method for treating a subject with a disease or condition, the method comprising administering to the subject a genetically engineered and gene-edited immune cell group or composition as disclosed herein. Also provided herein is the use of a genetically engineered and gene-edited immune cell group or composition as disclosed herein in treating a subject with a disease or condition. Also provided herein is the use of a genetically engineered and gene-edited immune cell group or composition as disclosed herein in the preparation of a medicament for treating a subject with a disease or condition. Also provided herein is a method for treating a subject with a disease or condition, the method comprising administering to the subject a genetically edited immune cell group or composition as disclosed herein. Also provided herein is the use of a genetically edited immune cell group or composition as disclosed herein in treating a subject with a disease or condition. Also provided herein is the use of a genetically edited immune cell group or composition as disclosed herein in the preparation of a medicament for treating a subject with a disease or condition.

[0082] In several embodiments, the disease or condition is an infectious disease, an autoimmune disease, a cancer, or a tumor. In several embodiments, the disease or condition is a cancer. In several embodiments, the disease or condition is a cancer that expresses an NKG2D ligand. In several embodiments, the disease or condition is a cancer that expresses CD19. In several embodiments, the disease or condition is a cancer that expresses CD70. In several embodiments, the disease or condition is a cancer that expresses BCMA. In several embodiments, the immune cells comprise natural killer (NK) cells. In several embodiments, the immune cells are allogeneic to the subject.

[0083] Provided herein is a gene-edited immune cell group, the immune cell group has been gene-edited within a target sequence in a gene encoding a disintegrin and a protein 17 (ADAM17) containing a metalloproteinase domain, wherein the editing results in reduced expression and / or function of the ADAM17 protein compared to immune cells not edited within the target sequence in the ADAM17 gene. In some embodiments, the gene-edited immune cells are genetically engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by a cancer or tumor cell.

[0084] Also provided herein is a genetically engineered and gene-edited immune cell group, which includes genetically engineered immune cells that express cytotoxic receptors, which include extracellular ligand binding domains, transmembrane domains, and cytotoxic signaling complexes, wherein the extracellular ligand binding domains target tumor markers expressed by target tumor cells, wherein the immune cells perform gene editing within the target sequence in the ADAM17 gene, and as compared with immune cells not edited within the target sequence in the ADAM17 gene, the editing results in reduced expression and / or function of ADAM17 protein. In several embodiments, the immune cells are edited within the additional target sequences in the genome of the immune cells to cause a reduction in protein expression levels encoded by the genes comprising the additional target sequences, as compared with unedited immune cells. In several embodiments, the protein encoded by the genes comprising the editing within the additional target sequences is ADAM17. In several embodiments, the protein encoded by the genes comprising the editing within the additional target sequences is not ADAM17. In some embodiments, the editing of the ADAM17 gene is performed using an RNA-guided endonuclease. In some embodiments, the editing of the additional position is performed using an RNA-guided endonuclease. In several embodiments, compared with immune cells that do not comprise gene editing positions, the genetically engineered and edited immune cells exhibit one or more of enhanced amplification capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence.

[0085] In several embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets a tumor marker expressed by target tumor cells, wherein the immune cells are gene-edited at one or more positions in an ADAM17 target gene encoding the corresponding protein to result in reduced expression and / or function of the corresponding ADAM17 protein, as compared to immune cells that are not edited at the one or more positions in the ADAM17 gene, wherein the immune cells are optionally edited at one or more additional target sites in the immune cell genome to result in reduced expression levels of proteins encoded by genes comprising the edited target sites, as compared to unedited immune cells, wherein editing of the one or more target genes is performed using an RNA-guided endonuclease, and the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, as compared to immune cells that do not comprise the one or more gene-edited target sites.

[0086] Provided herein is a population of gene-edited immune cells that have been gene-edited within a target sequence in a gene encoding a mediator subunit 12 (MED12) protein of an RNA polymerase II transcript, wherein the editing results in reduced expression and / or function of the MED12 protein, as compared to immune cells that have not been edited within a target sequence in the MED12 gene. In some embodiments, the gene-edited immune cells are genetically engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by a cancer or tumor cell.

[0087] Also provided herein is a genetically engineered and gene-edited immune cell population comprising genetically engineered immune cells, the immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and the immune cells are gene-edited within a target sequence in the MED12 gene. Also provided herein is a genetically engineered and gene-edited immune cell population comprising genetically engineered immune cells, the immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, wherein the immune cells are gene-edited within a target sequence in the MED12 gene, and wherein the editing results in reduced expression and / or function of the MED12 protein, as compared to immune cells that have not been edited within the target sequence in the MED12 gene. In several embodiments, the immune cells are edited within an additional target sequence in the genome of the immune cells to result in reduced expression levels of a protein encoded by a gene comprising an edit within the additional target sequence, compared to unedited immune cells. In several embodiments, the protein encoded by a gene comprising an edit within the additional target sequence is MED12. In several embodiments, the protein encoded by a gene comprising an edit within the additional target sequence is not MED12. In some embodiments, the editing of the MED12 gene is performed using an RNA-guided endonuclease. In some embodiments, the editing of the additional position is performed using an RNA-guided endonuclease. In several embodiments, the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence, as compared to immune cells that do not comprise genetically edited positions.

[0088] In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and wherein the immune cells are gene-edited at one or more positions in a MED12 target gene encoding a corresponding protein, the editing resulting in reduced expression and / or function of the corresponding MED12 protein, such as compared to the one or more positions not in the MED12 gene. The invention relates to a method for producing an immune cell that is genetically engineered to produce an edited immune cell, wherein the immune cell is optionally edited at one or more additional target sites in the immune cell genome to result in reduced expression levels of a protein encoded by a gene comprising the edited target site, as compared to an unedited immune cell, wherein editing of the one or more target genes is performed using an RNA-guided endonuclease, and wherein the genetically engineered and edited immune cell exhibits one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, as compared to an immune cell that does not comprise the genetically edited one or more target sites.

[0089] Provided herein is a population of gene-edited immune cells that are gene-edited within a target sequence in a gene encoding a hypoxia-inducible factor 1-α (HIF1-α) protein, wherein the editing results in reduced expression and / or function of the HIF1-α protein, as compared to immune cells that have not been edited within a target sequence in the HIF1α gene. In some embodiments, the gene-edited immune cells are genetically engineered to express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by a cancer or tumor cell.

[0090] In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, wherein the immune cells are gene-edited at one or more positions in a HIF1-α target gene encoding a corresponding HIF1-α protein, wherein the editing results in reduced expression and / or function of the corresponding HIF1-α protein, such as compared to a position not in the HIF1-α gene. The genetically engineered and edited immune cells are optionally edited at one or more additional target sites in the immune cell genome to result in reduced expression levels of proteins encoded by genes comprising the edited target sites, as compared to unedited immune cells, wherein editing of the one or more target genes is performed using an RNA-guided nuclease, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence, as compared to immune cells that do not contain the genetically edited one or more target sites.

[0091] In several embodiments, immune cells are gene-edited within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In several embodiments, the editing results in reduced expression and / or function of the corresponding protein, as compared to immune cells that have not been edited within the target sequence in the target gene. In several embodiments, the editing is performed using an RNA-guided endonuclease. In some embodiments, the editing is performed using a CRISPR / Cas system. In some embodiments, Cas is Cas9. In some embodiments, the editing is performed using a CRISPR / Cas9 system. In several embodiments, the genetically engineered and edited immune cells exhibit enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof, as compared to immune cells that have not been edited within one or more target sequences.

[0092] In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, wherein the immune cell is gene-edited at one or more positions in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. , wherein each of the genes encodes a corresponding protein, wherein the editing results in reduced expression and / or function of the corresponding protein, as compared to an immune cell that has not been edited at one or more locations of the corresponding gene, wherein the immune cell is edited at one or more additional target sites in the immune cell genome to result in reduced expression levels of proteins encoded by genes comprising the edited target sites, as compared to unedited immune cells, wherein the editing of the one or more target genes is performed using an RNA-guided nuclease, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, as compared to immune cells that do not contain the one or more genetically edited target sites.

[0093] In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, wherein the immune cell is gene-edited at one or more positions in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, Each of the genes encodes a corresponding protein, wherein the editing results in reduced expression and / or function of the corresponding protein, as compared to an immune cell that has not been edited at one or more locations of the corresponding gene, wherein the immune cell is edited at one or more additional target sites in the genome of the immune cell to result in reduced expression levels of the protein encoded by the gene comprising the edited target site, as compared to an unedited immune cell, wherein the editing of the one or more target genes is performed using the CRISPR / Cas9 system, and wherein the genetically engineered and edited immune cell exhibits one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, as compared to an immune cell that does not comprise the one or more genetically edited target sites.

[0094] In several embodiments, a genetically engineered and gene-edited immune cell population is also provided, comprising genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, wherein the tumor marker expressed by the target tumor cell is selected from a ligand of an NKG2D receptor, CD19, or CD70, wherein the immune cells express a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. One or more positions are gene-edited, wherein each of the genes encodes a corresponding protein, wherein the editing results in reduced expression and / or function of the corresponding protein, as compared to an immune cell that has not been edited at the one or more positions of the corresponding gene, wherein the immune cell is edited at one or more additional target sites in the genome of the immune cell to result in reduced expression levels of proteins encoded by genes comprising the edited target sites, as compared to unedited immune cells, wherein the editing of the one or more target genes is performed using a CRISPR / Cas system or other guide nuclease, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence, as compared to immune cells that do not contain the one or more gene-edited target sites.

[0095] In several embodiments, a method for producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the population of immune cells with a targeting endonuclease, wherein the targeting endonuclease cleaves nucleic acid at two or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, CISH, CBLB, or any combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence as compared to immune cells that do not contain the gene-edited one or more target sites.

[0096] In several embodiments, a method for producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the population of immune cells with an RNA-guided endonuclease, wherein the RNA-guided endonuclease edits one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence as compared to immune cells that do not contain the one or more gene-edited target sites.

[0097] In several embodiments, a method for producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence as compared to immune cells that do not contain the gene-edited one or more target sites.

[0098] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKζ. In some embodiments, the gene is GSK-3β. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0099] In several embodiments, a method for producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the immune cell population with a first RNA-guided endonuclease, wherein the endonuclease edits at one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and contacting the immune cell population with a second RNA-guided endonuclease, wherein the second endonuclease edits at one or more target sites in the CISH gene of the immune cells to result in reduced expression levels of the CIS protein encoded by the CISH gene, as compared to immune cells that have not been edited in the CISH gene, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, as compared to immune cells that do not contain the gene-edited one or more target sites.

[0100] In several embodiments, a method for producing a gene-edited immune cell population for cancer immunotherapy is provided, comprising contacting the immune cell population with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits at one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the Cas of the RNP comprises Cas 9. CasX, CasY or a combination thereof; and contacting the immune cell population with a second RNP complex, wherein the second RNP edits one or more target sites in the CISH gene of the immune cell to result in reduced expression of the CIS protein encoded by the CISH gene, such as the Cas of the RNP comprises Cas9, CasX, CasY or a combination thereof, compared to immune cells that have not been edited in the CISH gene, and the gene-edited immune cells exhibit one or more of enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence compared to immune cells that do not contain the one or more gene-edited target sites.

[0101] In several embodiments, a method for producing a gene-edited immune cell population for cancer immunotherapy is provided, comprising contacting the immune cell population with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the Cas of the RNP comprises Cas9, C asX, CasY or a combination thereof; and contacting the immune cell population with a second RNP complex, wherein the second RNP edits one or more target sites in the CBLB gene of the immune cells to result in reduced expression levels of CBLB protein encoded by the CBLB gene, compared to immune cells that have not been edited in the CBLB gene, wherein the Cas of the RNP comprises Cas9, CasX, CasY or a combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence as compared to immune cells that do not contain the one or more gene-edited target sites.

[0102] In several embodiments, a method for producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the immune cell population with a first RNA-guided endonuclease, wherein the first endonuclease edits at one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and contacting the immune cell population with second and third RNA-guided endonucleases, wherein the second RNA-guided endonuclease One or more target sites in the CISH gene of the immune cell are edited to result in reduced expression levels of the CIS protein encoded by the CISH gene, as compared to immune cells that have not been edited at the CISH gene, wherein a third RNA-guided nuclease edits one or more target sites in the CBLB gene of the immune cell to result in reduced expression levels of the CBLB protein encoded by the CBLB gene, as compared to immune cells that have not been edited at the CBLB gene, and wherein the gene-edited immune cell exhibits one or more of enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence compared to immune cells that do not contain the gene-edited one or more target sites.

[0103] In several embodiments, a method for producing a gene-edited immune cell population for cancer immunotherapy is provided, comprising contacting the immune cell population with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP edits one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and contacting the immune cell population with a second and a third RNP complex, wherein the second ... the group consisting of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; One or more target sites are edited to result in reduced expression levels of the CIS protein encoded by the CISH gene, such as compared to immune cells that have not been edited in the CISH gene, wherein the third RNP is edited at one or more target sites in the CBLB gene of the immune cells to result in reduced expression levels of the CBLB protein encoded by the CBLB gene, such as compared to immune cells that have not been edited in the CBLB gene, the Cas of each RNP comprises Cas9, CasX, CasY or a combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells and enhanced persistence, such as compared to immune cells that do not contain the gene-edited one or more target sites.

[0104] In several embodiments, a method for producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the population of immune cells with a plurality of Cas-gRNA ribonucleoprotein complexes (RNPs), wherein the plurality of RNPs induce editing of one or more target sites in the CISH gene of the immune cells, resulting in a decrease in the expression level of the CIS protein encoded by the CISH gene, as compared to immune cells that have not undergone editing in the CISH gene, wherein the plurality of RNPs induce editing of one or more target sites in the CBLB gene of the immune cells, resulting in a decrease in the expression level of the CBLB protein encoded by the CBLB gene, as compared to immune cells that have not undergone editing in the CBLB gene, wherein Multiple RNPs induce editing of one or more target sites in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the Cas of each RNP comprises Cas9, CasX, CasY, or a combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence as compared to immune cells that do not contain the gene-edited one or more target sites.

[0105] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKζ. In some embodiments, the gene is GSK-3β. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0106] In several embodiments, the preparation method further comprises contacting the immune cell population with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.

[0107] Also provided herein is a method for treating a subject with a disease or illness, the method comprising administering to the subject a group of genetically edited natural killer (NK) cells that have been genetically edited within a target sequence in the MED12 gene. In some embodiments, the immune cells are genetically engineered to express cytotoxic receptors. In some embodiments, the cytotoxic receptors comprise an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by a target tumor or cancer cell. In some embodiments, gene editing is within a target sequence in the MED12 gene, and the target sequence comprises any one of SEQ ID NO:938-994 or 996-998. In some embodiments, gene editing of MED12 reduces expression and / or function of the MED12 protein encoded by the MED12 gene, as compared to immune cells that are not edited within the target sequence. In several embodiments, editing of the MED12 gene is performed using an RNA-guided endonuclease.

[0108] In some embodiments, there is provided herein a method for treating a subject with a disease or illness, the method comprising administering to the subject a natural killer (NK) cell group that is gene-edited within a target sequence in the MED12 gene. In some embodiments, there is provided herein a method for treating a subject with a disease or illness, the method comprising administering to the subject a natural killer (NK) cell group that is gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene. In several embodiments, there is provided a gene-edited immune cell group that is included in immune cells that are gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene. In some embodiments, the immune cells are genetically engineered to express cytotoxic receptors. In some embodiments, the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand binding domain binds to an antigen expressed by a target tumor or cancer cell. In some embodiments, gene editing within the target sequence in the MED12 gene reduces expression and / or function of the MED12 protein encoded by the MED12 gene, as compared to immune cells in which the editing has not occurred within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces expression and / or function of the CIS protein encoded by the CIS gene, as compared to immune cells in which the editing has not occurred within the target sequence. In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by a target tumor or cancer cell, the immune cells are gene-edited within a target sequence in the MED12 gene, the editing resulting in reduced expression and / or function of the Mediator complex subunit 12 (MED12) protein encoded by the MED12 gene, as compared to immune cells that have not been edited within the target sequence in the MED12 gene, and the editing of the MED12 gene is performed using an RNA-guided endonuclease.In several embodiments, a genetically engineered and gene-edited immune cell population is provided, comprising genetically engineered immune cells, the immune cells expressing cytotoxic receptors comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand binding domain targets an antigen expressed by a target tumor or cancer cell, and the immune cells are gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene, the editing resulting in reduced expression and / or function of the mediator complex subunit 12 (MED12) protein and the CIS protein, as compared to immune cells not edited within the target sequences in the MED12 and CISH genes, and the editing is performed using an RNA-guided endonuclease. In several embodiments, the disease or condition is cancer. In several embodiments, the immune cells are allogeneic to the subject.

[0109] Also provided herein is a method for treating a subject's disease or condition, the method comprising administering to the subject a genetically engineered immune cell population, wherein the immune cell expresses a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cell is gene-edited within a target sequence in the CISH gene, and wherein the immune cell is edited within a target sequence in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In some embodiments, the disease or condition is an autoimmune disease, an infectious disease, or cancer. In several embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is an autoimmune disease. In some embodiments, the disease or condition is an infectious disease. In several embodiments, provided herein is a method for treating cancer in a subject, the method comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are gene-edited at one or more target sites in the CISH gene encoding a CIS protein, wherein the editing results in reduced expression and / or function of CIS, as compared to immune cells that have not been edited at the one or more sites in the CISH gene, wherein the immune cells express a protein selected from the group consisting of ADAM17, HIF-1α, DGKζ, One or more target locations in one or more target genes of GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof are edited, wherein the editing is performed using an RNA-guided endonuclease, and wherein the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence, particularly in a hypoxic tumor microenvironment, as compared to immune cells that do not contain the one or more genetically edited target sites.

[0110] Also provided herein is a method for treating a subject's disease or condition, the method comprising administering to the subject a genetically engineered immune cell population, wherein the immune cell expresses a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cell performs gene editing within a target sequence in the CISH gene, wherein the immune cell performs gene editing within a target sequence in the CBLB gene, and wherein the immune cell is selected from the group consisting of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In some embodiments, the disease or condition is an autoimmune disease, an infectious disease, or cancer. In several embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is an autoimmune disease. In some embodiments, the disease or condition is an infectious disease. Also provided herein is a method of treating cancer in a subject, the method comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the immune cells are gene-edited at one or more target positions in a CISH gene encoding a CIS protein, wherein the editing results in reduced expression and / or function of CIS, as compared to immune cells not edited at the one or more positions in the CISH gene, wherein the immune cells are gene-edited at one or more target positions in a CBLB gene encoding a CBLB protein, wherein the editing results in reduced expression and / or function of CIS, as compared to immune cells not edited at the one or more positions in the CBLB gene. The invention relates to an immune cell that is edited by a method comprising: editing a target gene or a target site selected from one or more target genes of ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the editing is performed using an RNA-guided endonuclease, and wherein the genetically engineered and edited immune cells exhibit enhanced amplification capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence compared to immune cells that do not comprise the gene-edited target gene, particularly in a hypoxic tumor microenvironment. In several embodiments, the administered immune cells are allogeneic to the subject. In several embodiments, the method further comprises administering IL-2.

[0111] In several embodiments, immune cells are gene-edited within a target sequence in the ADAM17 gene. In several embodiments, immune cells are gene-edited within a target sequence in the HIF1α gene. In several embodiments, immune cells are gene-edited within a target sequence in the DGKζ gene. In several embodiments, immune cells are gene-edited within a target sequence in the GSK3β gene. In several embodiments, immune cells are gene-edited within a target sequence in the LAG3 gene. In several embodiments, immune cells are gene-edited within a target sequence in the TIM3 gene. In several embodiments, immune cells are gene-edited within a target sequence in the TRIM29 gene. In several embodiments, immune cells are gene-edited within a target sequence in the IL1R8 gene. In several embodiments, immune cells are gene-edited within a target sequence in the CD38 gene. In several embodiments, immune cells are gene-edited within a target sequence in the FBP1 gene. In several embodiments, immune cells are gene-edited within a target sequence in the INSIG1 gene. In several embodiments, immune cells are gene-edited within a target sequence in the MED12 gene. In several embodiments, immune cells are gene-edited within a target sequence in the MED13 gene. In several embodiments, immune cells are gene-edited within a target sequence in the CCNC gene. In several embodiments, immune cells are gene-edited within a target sequence in the CDK8 gene. In several embodiments, immune cells are gene-edited within a target sequence in the ID3 gene. In several embodiments, immune cells are gene-edited within a target sequence in the SOX4 gene.

[0112] In several embodiments, ADAM17 is edited, and wherein the guide sequence of any one of SEQ ID NO:682-687 is used to target the ADAM17 gene. In some embodiments, ADAM17 is edited at the target sequence comprising SEQ ID NO:682. In some embodiments, ADAM17 is edited at the target sequence comprising SEQ ID NO:683. In some embodiments, ADAM17 is edited at the target sequence comprising SEQ ID NO:684. In some embodiments, ADAM17 is edited at the target sequence comprising SEQ ID NO:685. In some embodiments, ADAM17 is edited at the target sequence comprising SEQ ID NO:686. In some embodiments, ADAM17 is edited at the target sequence comprising SEQ ID NO:687.

[0113] In several embodiments, ADAM17 is edited and the target sequence comprises any one of SEQ ID NOs: 682-687. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 682. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 683. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 684. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 685. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 686. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 687.

[0114] In several embodiments, MED12 is edited, and wherein a guide sequence of any one of SEQ ID NOs: 938-944 is used to target the MED12 gene. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 938. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 939. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 940. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 941. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 942. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 943. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 944. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 996. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 997. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 998.

[0115] In several embodiments, MED12 is edited and the target sequence comprises any one of SEQ ID NOs: 938-944. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 938. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 939. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 940. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 941. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 942. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 943. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 944. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 996. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 997. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 998.

[0116] In several embodiments, CISH is edited and the target sequence comprises any one of SEQ ID NOs: 153-157, 463-466, or 1012-1013. In some embodiments, the target sequence comprises SEQ ID NO: 153. In some embodiments, the target sequence comprises SEQ ID NO: 154. In some embodiments, the target sequence comprises SEQ ID NO: 155. In some embodiments, the target sequence comprises SEQ ID NO: 156. In some embodiments, the target sequence comprises SEQ ID NO: 157. In some embodiments, the target sequence comprises SEQ ID NO: 463. In some embodiments, the target sequence comprises SEQ ID NO: 464. In some embodiments, the target sequence comprises SEQ ID NO: 465. In some embodiments, the target sequence comprises SEQ ID NO: 466. In some embodiments, the target sequence comprises SEQ ID NO: 1012. In some embodiments, the target sequence comprises SEQ ID NO: 1013.

[0117] In several embodiments, HIF-1α is edited, and wherein the guide sequence of any one of SEQ ID NOs: 750-760 is used to target the HIF-1α gene. In several embodiments, HIF-1α is edited, and the target sequence comprises any one of SEQ ID NOs: 750-760. In several embodiments, DGKζ is edited, and wherein the guide sequence of any one of SEQ ID NOs: 688-723 is used to target the DGKζ gene. In several embodiments, DGKζ is edited, and the target sequence comprises any one of SEQ ID NOs: 688-723. In several embodiments, GSK-3β is edited, and wherein the guide sequence of any one of SEQ ID NOs: 724-749 is used to target the GSK-3β gene. In several embodiments, GSK-3β is edited, and wherein the target sequence comprises any one of SEQ ID NOs: 724-749. In several embodiments, LAG3 is edited, and a guide sequence of any one of SEQ ID NOs: 761-789 is used to target the LAG3 gene. In several embodiments, LAG3 is edited, and the target sequence comprises any one of SEQ ID NOs: 761-789. In several embodiments, TIM3 is edited, and a guide sequence of any one of SEQ ID NOs: 790-825 is used to target the TIM3 gene. In several embodiments, TIM3 is edited, and the target sequence comprises any one of SEQ ID NOs: 790-825. In several embodiments, TRIM29 is edited, and a guide sequence of any one of SEQ ID NOs: 826-835 is used to target the TRIM29 gene. In several embodiments, TRIM29 is edited, and the target sequence comprises any one of SEQ ID NOs: 826-835. In several embodiments, TRIM29 is edited, and a guide sequence of any one of SEQ ID NOs: 167-169, 826-835, or 1009-1011 is used to target the TRIM29 gene. In several embodiments, TRIM29 is edited, and the target sequence comprises any one of SEQ ID NOs: 167-169, 826-835, or 1009-1011. In several embodiments, IL-1R8 is edited, and a guide sequence of any one of SEQ ID NOs: 836-865 is used to target the IL-1R8 gene. In several embodiments, IL-1R8 is edited, and the target sequence comprises any one of SEQ ID NOs: 836-865.In several embodiments, CD38 is edited, and a guide sequence of any one of SEQ ID NOs: 866-874 is used to target the CD38 gene. In several embodiments, CD38 is edited, and the target sequence comprises any one of SEQ ID NOs: 866-874. In several embodiments, FBP-1 is edited, and a guide sequence of any one of SEQ ID NOs: 875-889 is used to target the FBP-1 gene. In several embodiments, FBP-1 is edited, and the target sequence comprises any one of SEQ ID NOs: 875-889. In several embodiments, INSIG1 is edited, and a guide sequence of any one of SEQ ID NOs: 890-934 is used to target the INSIG1 gene. In several embodiments, INSIG1 is edited, and the target sequence comprises any one of SEQ ID NOs: 890-934. In several embodiments, MED12 is edited, and the guide sequence FBP-1 of any one of SEQ ID NOs: 938-944 is used to target the MED12 gene. In several embodiments, MED12 is edited, and the guide sequence of any one of SEQ ID NOs: 938-944 or 996-998 is used to target the MED12 gene. In several embodiments, MED12 is edited, and the target sequence comprises any one of SEQ ID NOs: 938-944. In several embodiments, MED12 is edited, and the target sequence comprises any one of SEQ ID NOs: 938-944 or 996-998. In several embodiments, MED13 is edited, and the guide sequence of any one of SEQ ID NOs: 945-948 is used to target the MED13 gene. In several embodiments, MED13 is edited, and the target sequence comprises any one of SEQ ID NOs: 945-948. In several embodiments, CDK8 is edited, and a guide sequence of any one of SEQ ID NOs: 949-955 is used to target the CDK8 gene. In several embodiments, CDK8 is edited, and the target sequence comprises any one of SEQ ID NOs: 949-955. In several embodiments, CCNC is edited, and a guide sequence of any one of SEQ ID NOs: 956-961 is used to target the CCNC gene. In several embodiments, CCNC is edited, and a guide sequence of any one of SEQ ID NOs: 956-961 or 999-1001 is used to target the CCNC gene. In several embodiments, CCNC is edited, and the target sequence comprises any one of SEQ ID NOs: 956-961.In several embodiments, CCNC is edited, and the target sequence comprises any one of SEQ ID NOs: 956-961 or 999-1001. In several embodiments, ID3 is edited, and wherein the guide sequence of any one of SEQ ID NOs: 963-969 is used to target the ID3 gene. In several embodiments, ID3 is edited, and wherein the guide sequence of any one of SEQ ID NOs: 963-969 is used to target the SOX4 gene. In several embodiments, SOX4 is edited, and wherein the guide sequence of any one of SEQ ID NOs: 970-976 is used to target the SOX4 gene. In several embodiments, SOX4 is edited, and the target sequence comprises any one of SEQ ID NOs: 970-976. In several embodiments, immune cells are also edited at the CISH gene encoding the CIS protein. In several embodiments, the guide sequence of any one of SEQ ID NOs: 153-157 or 463-466 is used to target the CISH gene. In several embodiments, the guide sequence of any one of SEQ ID NOs: 153-157, 463-466, or 1012-1013 is used to target the CISH gene. In several embodiments, CISH is edited and the target sequence comprises any one of SEQ ID NOs: 153-157 or 463-466. In several embodiments, CISH is edited and the target sequence comprises any one of SEQ ID NOs: 153-157, 463-466, or 1012-1013. In several embodiments, the cell is edited at an additional target site in the CBLB gene. In several embodiments, the guide sequence of any one of SEQ ID NOs: 164-166 or 453-456 is used to target the CBLB gene. In several embodiments, the guide sequence of any one of SEQ ID NOs: 164-166, 453-456, or 1005-1008 is used to target the CBLB gene. In several embodiments, CBLB is edited and the target sequence comprises any one of SEQ ID NOs: 164-166 or 453-456. In several embodiments, CBLB is edited and the target sequence comprises any one of SEQ ID NOs: 164-166, 453-456, or 1005-1008.

[0118] According to several embodiments, the cells are optionally further edited at the gene encoding CD70. In several embodiments, the cells are optionally edited at the TGFBR2 gene, TIGIT gene, adenosine A2 receptor gene, SMAD3 gene, MAPKAPK3 gene, CEACAM1 gene, DDIT4 gene, NKG2A gene, SOCS2 gene, B2M gene, PD-1 gene and / or TCRα gene.

[0119] In several embodiments, at least a portion of genetically engineered immune cells are engineered to express membrane-bound IL-15. In several embodiments, genetically engineered immune cells are engineered to express membrane-bound IL-15. In some embodiments, IL-15 is expressed by a separate box on a construct comprising any one of the CARs disclosed herein. In some embodiments, IL-15 is expressed by a separate box on a construct comprising any one of the cytotoxic receptors disclosed herein. In some embodiments, IL-15 and any one of the CARs disclosed herein are expressed by the same box. In some embodiments, IL-15 and any one of the cytotoxic receptors disclosed herein are expressed by the same box. In some embodiments, IL-15 and cytotoxic receptors are expressed in a bicistronic form. In some embodiments, chimeric receptors and IL-15 are separated by nucleic acid sequences encoding cleavage sites (e.g., proteolytic cleavage sites or T2A, P2A, E2A or F2A self-cleavage peptide cleavage sites). In some embodiments, chimeric receptors and IL-15 are separated by T2A sequences. In some embodiments, the IL-15 is membrane-bound IL-15 (mbIL-15).

[0120] In several embodiments, immune cells include natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSC), iPSC-derived NK cells, NK-92 cells or a combination thereof. In several embodiments, immune cells include natural killer (NK) cells. In several embodiments, genetically engineered and edited immune cells are suitable for allogeneic cancer cell therapy, and wherein the cells maintain enhanced cytotoxicity and / or persistence in a hypoxic tumor microenvironment. In several embodiments, as compared to genetically engineered cells not edited at the target sequence, the genetically engineered and edited immune cells show increased persistence in vivo.

[0121] In several embodiments, the genetically engineered and edited immune cells are used to treat a disease or condition. In some embodiments, the disease or condition is an autoimmune disease. In several embodiments, the disease or condition is cancer. In several embodiments, the genetically engineered and edited immune cells are used to treat cancer. In several embodiments, the genetically engineered and edited immune cells are used to prepare a medicament for treating a disease or condition. In several embodiments, the disease or condition is an autoimmune disease. In several embodiments, the disease or condition is cancer. In several embodiments, the genetically engineered and edited immune cells are used to prepare a medicament for treating cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0122] Figures 1A-1D depict non-limiting examples of tumor-targeted chimeric antigen receptors.

[0123] Figure 2 Depicted is a schematic workflow for evaluating gene editing as disclosed herein.

[0124] Figures 3A-3B Data are presented relating to the expression of non-limiting examples of CD19-directed chimeric antigen receptors (CARs) when cells are edited to disrupt expression of designated target genes. Figure 3A Data for DGKζ, GSK-3β, HIF-1α, TRIM29, IL-1R8, CD38, and FBP-1 after editing or electroporation (EP) control are shown. Figure 3B Data are shown for ADAM17, LAG3, TIM3, INSIG1, CISH-15 after editing or EP-untransduced controls. Similar results were achieved in cells from other donors (data not shown).

[0125] Figures 4A-4C Data are presented relating to the knockout efficiency of ADAM17, LAG3, and TIM3 in a non-limiting example of NK cells expressing a CD19-directed CAR when the cells were edited to disrupt expression of the indicated target genes. Figure 4A ADAM17 KO efficiency in cells at day 11 is depicted, along with an APC isotype control and a non-transduced electroporation control. Figure 4B TIM3 and CD38 KO efficiency in cells at day 11 is depicted. Figure 4C Depicted are LAG3 KO efficiencies in cells at day 11. Similar results were achieved in cells from other donors (data not shown).

[0126] Figure 5A-C depicts summary data of expression of the indicated genes after editing in a non-limiting example of a CD19-directed CAR. Figure 5A The data from the first donor (512) are summarized. Figure 5C The data from the second donor (558) were summarized. Figure 5B Data from a third donor (548) are summarized.

[0127] Figure 6 Depicted are the results of on-target INDEL analysis performed by CRISPR for the indicated genes in donors 558, 548, and 512, in a non-limiting example of a CD19-directed CAR.

[0128] Figure 7A -B depicts a summary of the fold expansion of cells expressing CD19-directed CARs when cells were edited to disrupt expression of the indicated target genes. Figure 7A ) and 558( Figure 7B ) cells, and the fold expansion was determined on days 0-7, 7-14, and 0-14.

[0129] Figures 8A-8B Figure 8 shows data related to the following: expressing CD19-directed CAR and from day 14 ( Figure 8A ) and day 21 ( Figure 8B ) NK cells of a non-limiting example were tested starting as shown (single editing). Similar results were seen in cells from other donors (data not shown).

[0130] Figures 9A-9B Involves glycolytic stress testing and hypoxia data. Figure 9A Shown are the corresponding extracellular acidification rate (ECAR) data for NK cells expressing CD19-directed CAR and edited as indicated. Figure 9B Additional data are presented for evaluation of cellular oxygen consumption rate (OCR) and mitochondrial versus non-mitochondrial respiration in NK cells expressing CD19-CAR and edited as indicated.

[0131] Figure 10 Depicted are the results of cytokine production evaluation of NK cells from donor 512 expressing CD19-CAR and edited as indicated, after 3 days of coculture with Raji cells, where the results of the gene-edited group expressing CD19-CAR were compared with cytokine levels in EP controls, Raji cells, and CD19-CAR-expressing cells without additional gene editing.

[0132] Figure 11Depicted is a schematic workflow for evaluating gene editing disclosed herein.

[0133] Figure 12 Depicted are summary expression data for cells expressing a non-limiting example of a CD70-directed CAR and edited to disrupt expression of the indicated target gene. Each group indicates % viability, % CD70-positive cells, and % CAR-positive cells compared to unedited, untransduced controls.

[0134] Figure 13 Depicted is a summary of the fold expansion results for cells expressing a non-limiting example of a CD70-directed CAR when the cells were edited to disrupt expression of the indicated target genes. Fold expansion was determined at days 0-6, 6-7, 7-14, and 0-14.

[0135] Figure 14 In vitro cytotoxicity data against tumor cells are depicted. Figure 14 Data are shown for NK cells from donor 512 expressing a non-limiting example of a CD70-directed CAR and edited as indicated, against HL60 and Molm13 cells on day 14. Each assay was performed at a 1:2 ratio of effector cells to target cells (E:T), with controls being target (tumor) cells alone and target (tumor) cells incubated with unedited, untransduced NK cells (EP).

[0136] Figure 15 Depicted are the results of a cellular mitochondrial stress assay in which NK cells expressing a non-limiting example of a CD70-directed CAR and edited as indicated were treated with lactate for 3 days prior to assessment of OCR.

[0137] Figure 16 Depicted is a schematic workflow for evaluating gene editing disclosed herein.

[0138] Figure 17 Depicts summary expression data for cells expressing non-limiting examples of CD70-directed CARs and edited to disrupt expression of designated target genes. % ADAM17 positive cells, % CD70 positive cells, and % CAR positive cells are indicated for each group compared to unedited, untransduced controls (EP).

[0139] Figure 18 Depicted is a summary of fold expansion results for cells expressing a non-limiting example of a CD70-directed CAR when the cells were edited to disrupt expression of the indicated target genes. Fold expansion was determined at days 0-7, 7-15, and 1-15.

[0140] Figures 19A-19D In vitro cytotoxicity data against tumor cells are depicted. Figures 19A-19BData are presented for NK cells expressing a non-limiting example of a CD70-directed CAR and tested against 786-O cells as indicated starting on day 14, wherein Figure 19A The ratio of effector cells to target cells (E:T) is 1:2. Figure 19B The ratio in China is 1:4. Figures 19C-19D Cytotoxicity data for NK cells expressing a non-limiting example of a CD70-directed CAR and tested against HL60 cells as indicated starting from day 14 are shown, wherein Figure 19C The E:T ratio is 1:1. Figure 19D The ratio in China is 1:2.

[0141] Figure 20 Depicted are the results of a cellular mitochondrial stress assay under hypoxic conditions for NK cells expressing a non-limiting example of a CD70-directed CAR and edited as indicated.

[0142] Figure 21 Depicted is a schematic workflow for evaluating gene editing disclosed herein.

[0143] Figures 22A-22B Data are presented relating to the expression of a non-limiting example of a CD19-directed CAR when cells are edited to disrupt ADAM17 expression. Figure 22A Depicted is the expression of CD19 CAR on NK cells at day 4 post-transduction. Figure 22B Depicted are the validation results of ADAM17 knockout in NK cells from donors 512 and 558.

[0144] Figures 23A-23B Depicted is the assessment of CD16 and CD62L expression in cells expressing a non-limiting example of a CD19-directed CAR and editing at ADAM17 (ADAM17KO) and treated with DMSO (control) or stimulated with 1 ug / mL phorbol myristate acetate (PMA) for 1 hour. Similar results were seen in cells from other donors (data not shown). Figure 23B Summary Figure 23A Data are presented and the percentage of CD16 and CD62L positivity and mean fluorescence intensity (MFI) are reported for cells from two donors under control and PMA-treated conditions, EP controls, and cells edited with ADAM17 with or without NKX19.

[0145] Figure 23C Depicted are the evaluation of expression of various ADAM17 substrates in cells expressing a non-limiting example of a CD70-directed CAR and editing at ADAM17 (ADAM17KO) and treated with DMSO (control) or stimulated with 1 ug / mL PMA for 1 hour.

[0146] Figures 24A-24G Depicted are in vitro cytotoxicity data against tumor cells of NK cells edited as indicated. Figure 24A Describes a study evaluating CD20 expression on Raji and Nalm6 cells. Figure 24B The results of cytotoxicity assays of ADAM17-edited cells from donors 512 and 558 against Raji cells at an E:T ratio of 2:1 are shown. Figures 24C-24G In this study, Raji cells were pre-coated with cetuximab (anti-EGFR) or rituximab (anti-CD20) for 30 minutes to determine whether antibody-dependent cellular cytotoxicity (ADCC) was enhanced when antibody-coated Raji cells were incubated with ADAM17-edited CAR-NK cells. Figure 24C NK cells expressing CD70-directed CAR and edited as indicated are shown, with or without cetuximab at an E:T ratio of 1:2 ( Figure 24C ) or 1:4( Figure 24D ). Additional ADCC assays were performed after target cells were incubated with rituximab, with an E:T ratio of 1:2 ( Figure 24E ) and 1:4( Figure 24F ) were measured, and in the absence of CD19 guidance, the E:T was 1:1 ( Figure 24G ).

[0147] Figure 25 Depicted is a schematic workflow for evaluating gene editing disclosed herein.

[0148] Figure 26 Summarized are the % viability and fold expansion data on days 1 and 3 for NK cells expressing a non-limiting example of a CD70-directed CAR and edited as indicated.

[0149] Figures 27A-27F Depicted are flow cytometry results of NK cells expressing a non-limiting example of a CD70-directed CAR and edited as indicated. Figures 27A-27B Depicted are CD56 and CD70 staining of NK cells expressing CD70-directed CAR and edited as indicated. Figures 27C-27E Depicts the targeting of CD38 ( Figure 27C )、LAG3( Figure 27D )、ADAM17( Figure 27E ) % of CD70 positive cells in edited cells. Figure 27F Summarizes from Figures 27C-27E data.

[0150] Figure 28Depicted are the results of a cellular mitochondrial stress assay under hypoxic conditions for NK cells expressing a non-limiting example of a CD70-directed CAR and edited as indicated.

[0151] Figures 29A-29B Depicted are in vitro cytotoxicity data against tumor cells of NK cells expressing a non-limiting example of a CD70-directed CAR and edited as indicated. Figure 29A Cytotoxicity data are presented for a CD70-directed CAR edited for triple gene knockout. Figure 29B Cytotoxicity data are presented for a CD70-directed CAR edited to create a quadruple knockout.

[0152] Figure 30A Depicted are the results of an in vivo anti-tumor activity assay in which mice were injected with 786-O cells on day -7, followed by injection on day 0 of NK cells expressing a non-limiting example of a CD70-directed CAR and edited to be double knockout (CISH / CBLB) or triple knockout (CISH / CBLB / HIF1α, CISH / CBLB / ADAM17, or CISH / CBLB / FBP1) as indicated, and tumor volume (TV) was assessed over a 25-day period.

[0153] Figure 30B Depicted are the results of an in vivo anti-tumor activity assay in which mice were injected with HL60 cells on day -2, followed by injection on day 0 with NK cells expressing a non-limiting example of a CD70-directed CAR and edited to be double knockout (CISH / CBLB) or triple knockout (CISH / CBLB / ADAM17) as indicated, and tumor volume (TV) was assessed over a 30-day period.

[0154] Figure 31 Depicted is a schematic workflow for evaluating gene editing disclosed herein.

[0155] Figures 32A-32B Depicted are in vitro cytotoxicity data against tumor cells of NK cells expressing a non-limiting example of a CD70-directed CAR and edited for the following genes: MED12, CCNC, CDK8, ID3, SOX4 as indicated.

[0156] Figure 33 Depicted is the expression of a CD70-targeting CAR in NK cells from three different donors edited for the following genes: CD70, MED12, CDK8, CCNC, CISH, ID3, SOX4 as indicated.

[0157] Figures 34A-34B They involve glycolytic stress test and glycolytic capacity respectively. Figure 34A and Figure 34B Shown are the corresponding extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) data for NK cells expressing CD70-directed CAR and edited as indicated.

[0158] Figure 35 Depicted is the expression of a CD19-targeting CAR in NK cells from one donor edited at the indicated target gene.

[0159] Figures 36A-36B In vitro cytotoxicity data against Nalm6 tumor cells are depicted. Figures 36A-36B Data are shown for NK cells expressing a non-limiting example of a CD19-directed CAR and edited as indicated against Nalm6 cells at a 1:1 effector to target ratio (E:T) on day 6. Figure 36A showed that in the absence of TGF-β, Figure 36B Shown in the presence of TGF-β.

[0160] Figure 37 Extracellular acidification rate (ECAR) data involving NK cells expressing CD19-directed CAR and edited as indicated.

[0162] Figures 38A-38B The proliferative capacity of NK cells expressing a CD19-directed chimeric antigen receptor (CAR) and edited as indicated was involved. Figure 38A The proliferation capacity of edited CD19-CAR NK cells from three different healthy donors is depicted. Figure 38B Depicts Figure 38A Quantitation of the data shown in .

[0162] Figure 39 Depicted is a schematic workflow for evaluating gene editing as disclosed herein.

[0163] Figures 40A-40B In vitro cytotoxicity data against Nalm6 tumor cells are depicted. Figures 40A-40B A non-limiting example of expressing a CD19-directed CAR is shown and starting from day 14, in the absence of ( Figure 40A ) or exists ( Figure 40B ) Data for NK cells against Nalm6 cells at an effector cell to target cell ratio (E:T) of 1:2 or 1:1 in the presence of TGF-β.

[0164] Figure 40C Depicted through Multiplex assay evaluating cytokine production by CD19-CAR NK cells from a single donor, edited as indicated, against Nalm6 cells at a 1:1 E:T ratio on day 6 in the absence or presence of TGF-β.

[0165] Figure 41A Schematic diagram depicting in vivo treatment of CD19 CAR NK cells edited as indicated.

[0166] Figures 41B-41C Figure 3 depicts tumor burden in a mouse model of acute lymphoblastic leukemia (ALL). Figure 41B ) and the persistence of CD19 CAR NK cells ( Figure 41C ).

[0167] Figures 42A-42B Depicted are the cytotoxicity of NK cells expressing the BCMA1 CAR edited at the indicated targets against BCMA-expressing Daudi cells at effector to target cell ratios (E:T) of 1:2 and 1:4, respectively.

[0168] Figures 43A-43B Depicted are the cytotoxicity of NK cells expressing the BCMA2 CAR edited at the indicated targets against BCMA-expressing MM.1S cells at effector to target cell ratios (E:T) of 1:1 and 1:2, respectively. Specific implementation plan

[0169] Some embodiments of the methods and compositions provided herein relate to engineered immune cells and combinations thereof for immunotherapy. In several embodiments, engineered cells are engineered in various ways, for example, to express a receptor complex that induces cytotoxicity. As used herein, the term "cytotoxic receptor complex" should have its usual meaning, and (unless otherwise specified) also refers to chimeric antigen receptors (CARs) and chimeric receptors (also referred to as activating chimeric receptors for NKG2D chimeric receptors). In several embodiments, cells are further engineered to achieve changes in the responsiveness of cells to non-tumor tissues. Several embodiments relate to modifying T cells by various genetic engineering methods so that the alloreactivity of the resulting T cells is reduced and / or eliminated. Such T cells without alloreactivity can also be engineered to express chimeric antigen receptors (CARs), which allow T cells without alloreactivity to produce cytotoxic effects on tumor cells. In several embodiments, natural killer (NK) cells are also engineered to express receptor complexes (e.g., chimeric antigen receptors or chimeric receptors) that induce cytotoxicity. In several embodiments, combinations of these engineered immune cell types are used in immunotherapy to produce both rapid (NK cell-based) and durable (T cell-based) anti-tumor effects, with the advantage of little or no graft-versus-host disease (GvHD). Some embodiments include methods of using the compositions or cells in immunotherapy.

[0170] Although autologous CAR-T cell therapies have been developed and shown to have significant durability and efficacy in vivo, the majority of patients treated with autologous CAR T cell therapies experience cytokine release syndrome (CRS) and / or neurotoxicity. In addition, autologous CAR T cell therapies face numerous challenges, including the need to leukapheresis of patients and then prepare qualified CAR T cell products from patients who are often extremely ill, heavily pretreated, or both. It may be difficult or, in some cases, impossible to produce sufficient numbers of CAR T cells from such patients. In addition, potential patients may not survive the time required to produce the final CAR T cell product from their own T cells.

[0171] In contrast, NK cell therapy, including allogeneic NK cell therapy made from healthy donors, can avoid many of these challenges. For example, due to the better quality of the donor cells input, the manufacturing success rate of allogeneic CAR-NK cells may be higher. Allogeneic CAR-NK cell therapy can also be provided when the patient needs it, without having to wait for the preparation of the patient's own cells. Therefore, allogeneic NK cell therapy is being studied as a ready-made product. Although NK cells offer potential advantages, their persistence in the body is not as good as T cells. Therefore, it is necessary to find a solution to overcome this challenge. This article describes gene editing that can increase the persistence, efficacy (e.g., cytotoxicity) or both of NK cells. Embodiments of such gene-edited NK cells include compositions and methods of use for treating a disease or disorder (e.g., cancer) in a subject. For example, experiments described herein found that destroying specific genes (including, for example, ADAM17, MED12, CISH, CBLB, or a combination thereof) brought unexpected beneficial effects to NK cells, including enhanced cytotoxicity in vitro and in vivo. These results were observed in NK cells expressing CARs against different antigens (e.g., BCMA, CD19, or CD70). Without wishing to be bound by theory, these findings are consistent with the observation that such gene editing can provide advantages to NK cells expressing CARs, regardless of the specific antigen targeted by the CAR.

[0172] The term "anti-cancer effect" refers to a biological effect that can be manifested in various ways, including but not limited to a reduction in tumor size, a reduction in the number of cancer cells, a reduction in the number of metastases, an increase in life expectancy, a reduction in cancer cell proliferation, a reduction in cancer cell survival, and / or an improvement in various physiological symptoms associated with cancerous conditions. Cell type

[0173] Some embodiments of the methods and compositions provided herein relate to cells such as immune cells. In some embodiments, immune cells are engineered to express chimeric receptors that bind to antigens (e.g., antigens expressed by cancer cells). For example, immune cells (e.g., T cells) can be engineered to include chimeric receptors (e.g., chimeric receptors directed by CD19), or engineered to include nucleic acids encoding the chimeric receptors as described herein. In some embodiments, natural killer (NK) cells are engineered to express chimeric receptors that bind to antigens (e.g., antigens expressed by cancer cells). Additional embodiments relate to engineering a second group of cells so that they express another cytotoxic receptor complex, such as the NKG2D chimeric receptor complex disclosed herein. Therefore, in some embodiments, a combination or composition comprising two different types of immune cells (e.g., T cells and NK cells) is contemplated. In some embodiments, engineered T cells and engineered NK cells express the same chimeric receptor. In some embodiments, engineered T cells and engineered NK cells express different chimeric receptors. In some embodiments, engineered T cells and engineered NK cells express chimeric receptors that bind to the same antigen (e.g., different epitopes of the same antigen). In some embodiments, the engineered T cells and engineered NK cells express chimeric receptors that bind different antigens.

[0174] Additional embodiments relate to further genetic manipulation of NK cells (e.g., donor NK cells) to increase the persistence and / or efficacy of engineered NK cells. Still additional embodiments relate to further genetic manipulation of T cells (e.g., donor T cells) to reduce, disrupt, minimize, and / or eliminate the ability of donor T cells to produce allogeneic responses (graft-versus-host disease) to recipient cells. For example, in some embodiments, T cells are engineered to reduce allogeneic responses to recipient cells.

[0175] Traditional anti-cancer therapies rely on surgery, radiation therapy, chemotherapy, or a combination of these methods. As research has given people a deeper understanding of some of the pathogenesis of certain cancers, this knowledge has been used to develop targeted cancer therapies. Targeted therapy is a type of cancer treatment method that uses certain drugs that target specific genes or proteins in cancer cells or cells that support cancer growth (such as blood vessel cells) to reduce or prevent cancer cell growth. Recently, genetic engineering technology has made it possible to develop methods that utilize certain characteristics of the immune system to fight cancer. In some cases, the patient's own immune cells are modified to specifically eradicate the type of cancer that the patient suffers from. Various types of immune cells can be used, such as T cells, natural killer (NK) cells, or a combination thereof, as described in more detail below.

[0176] In order to promote cancer immunotherapy, provided herein are polynucleotides (e.g., encoding chimeric receptors), polypeptides (e.g., chimeric receptors), and vectors encoding chimeric antigen receptors (CARs), which comprise target binding moieties (e.g., extracellular binders of ligands, or chimeric receptors targeted by tumor markers expressed by cancer cells) and cytotoxic signaling complexes. For example, some embodiments include a polynucleotide, polypeptide, or vector encoding, for example, a chimeric antigen receptor for tumor markers (e.g., CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc.) to promote immune cell targeting of cancer and exert cytotoxic effects on cancer cells. Also provided herein are engineered immune cells (e.g., T cells or NK cells) expressing such CARs. In some embodiments, the chimeric antigen receptor binds to a ligand of NKG2D. In some embodiments, the chimeric antigen receptor binds to CD19. In some embodiments, the chimeric antigen receptor binds to CD70. In some embodiments, the chimeric antigen receptor binds to BCMA. In some embodiments, polynucleotides, polypeptides, and vectors are also provided herein, encoding a construct comprising an extracellular domain comprising two or more subdomains, for example, a first subdomain targeting CD19 comprising a CD19 binding portion disclosed herein, and a second subdomain comprising a C-type lectin-like receptor and a cytotoxic signaling complex. Also provided herein are engineered immune cells (e.g., T cells or NK cells) expressing such bispecific constructs. Also provided herein are methods for treating cancer and other uses of such cells in cancer immunotherapy.

[0177] Also provided herein are chimeric receptors comprising antigen binding domains and cytotoxic signaling complexes.For example, some embodiments include chimeric receptors for tumor antigens (such as CD19, BCMA or CD70).Also provided herein are genetically engineered immune cells (such as NK cells) expressing such CARs.In some embodiments, immune cells are subjected to gene editing (for example, at MED12 and / or CISH).

[0178] To promote cancer immunotherapy, polynucleotides (e.g., encoding chimeric receptors), polypeptides (e.g., chimeric receptors), and vectors encoding chimeric receptors are also provided herein, wherein the chimeric receptor comprises a target binding portion (e.g., an extracellular binder of a ligand expressed by a cancer cell) and a cytotoxic signaling complex. For example, some embodiments include a polynucleotide, polypeptide, or vector encoding, for example, an activating chimeric receptor comprising an extracellular domain of NKG2D, which targets tumor markers such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, to promote the targeting of immune cells to cancer and exert a cytotoxic effect on cancer cells. In some embodiments, the chimeric receptor comprises an extracellular domain of NKG2D.

[0179] Also provided herein are engineered immune cells (e.g., T cells or NK cells) expressing such chimeric receptors. In some embodiments, polynucleotides, polypeptides, and vectors are also provided herein, encoding a construct comprising an extracellular domain comprising two or more subdomains, e.g., a first and a second ligand binding receptor and a cytotoxic signaling complex. Also provided herein are engineered immune cells (e.g., T cells or NK cells, in some embodiments, the first and second ligand binding domains target the same ligand) expressing such bispecific constructs. Also provided herein are methods for treating cancer and other uses of such cells for cancer immunotherapy. Engineered cells for immunotherapy

[0180] In several embodiments, the cells of the immune system are engineered to have enhanced cytotoxic effects on target cells (such as tumor cells). For example, the cells of the immune system can be engineered to include chimeric receptors and / or tumor-oriented CARs as described herein. In several embodiments, leukocytes are used because their natural function is to protect the body from abnormal cell growth and infectious diseases. There are various types of leukocytes that play a specific role in the human immune system and are therefore preferred starting cells for the engineering of cells disclosed herein. Leukocytes include granulocytes and agranulocytes (referring to survival or lack of particles in the cytoplasm, respectively). Granulocytes include basophils, eosinophils, neutrophils and mast cells. Agranulocytes include lymphocytes and monocytes. Cells such as those described herein or in their manner can be engineered to include chimeric receptors (such as NKG2D chimeric receptors) and / or CARs (such as CD19-oriented CARs), or nucleic acids encoding the chimeric receptors or CARs. In several embodiments, the cells are optionally engineered to co-express a membrane-bound interleukin 15 (mbIL15) domain. In some embodiments, immune cells engineered to express a chimeric receptor are engineered to express the mbIL15 domain in a bicistronic format. As will be discussed in more detail below, in several embodiments, the cells (particularly T cells) are further genetically engineered to reduce and / or eliminate the alloreactivity of the cells. Monocytes for immunotherapy

[0181] In some embodiments, the immune cells comprise monocytes. Monocytes are a subtype of white blood cells. Monocytes can differentiate into macrophages and myeloid dendritic cells. Monocytes are associated with the adaptive immune system and perform primary functions of phagocytosis, antigen presentation, and cytokine production. Phagocytosis is the process of ingesting cellular material or entire cells, followed by digestion and destruction of the engulfed cellular material.

[0182] In some embodiments, the monocytes are positive for a cell surface marker selected from the group consisting of CCR2, CCR5, CD11c, CD14, CD16, CD62L, CD68+, CX3CR1, HLA-DR, or any combination thereof. In some embodiments, the monocytes are positive for cell surface expression of CD14. In some embodiments, the monocytes are positive for cell surface expression of CCR2. In some embodiments, the monocytes are positive for cell surface expression of CCR5. In some embodiments, the monocytes are positive for cell surface expression of CD62L.

[0183] In several embodiments, monocytes are used in combination with one or more additional engineered cells disclosed herein. Some embodiments of the methods and compositions described herein relate to monocytes comprising tumor-directed CAR or nucleic acid encoding tumor-directed CAR. In some embodiments, monocytes express CARs that bind to tumor antigens (such as CD19, CD123, CD70, Her2, mesothelin, Claudin6, BCMA, or EGFR).

[0184] In some embodiments, monocytes are engineered to express membrane-bound interleukin 15 (mbIL15) domains. In some embodiments, monocytes engineered to express chimeric receptors are also engineered to express (e.g., expressed in bicistronic form) membrane-bound interleukin 15 (mbIL15) domains. Therefore, in some embodiments, monocytes are engineered to express chimeric receptors and mbIL15 in bicistronic form. Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express CARs targeting tumor markers (e.g., CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc., as disclosed herein) and membrane-bound interleukin 15 (mbIL15) domains. Several embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express activating chimeric receptors that target ligands on tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others), and optionally express a membrane-bound interleukin 15 (mbIL15) domain.

[0185] In some embodiments, the monocytes are allogeneic cells. In some embodiments, the monocytes are obtained from a donor who does not have cancer. Lymphocytes for immunotherapy

[0186] In some embodiments, immune cell comprises lymphocyte.Lymphocyte (another initial subtype of leukocyte) includes T cell (cell-mediated cytotoxic adaptive immunity), natural killer cell (cell-mediated cytotoxic innate immunity) and B cell (humoral mediation, antibody-driven adaptive immunity). Although B cell has been engineered in several embodiments, several embodiments herein also relate to engineered T cell or engineered NK cell (in some embodiments, using a mixture of T cell and NK cell from the same donor or different donors). Therefore, in some embodiments, immune cell comprises T cell. In some embodiments, immune cell comprises NK cell. In some embodiments, immune cell comprises T cell and NK cell. In some embodiments, immune cell comprises B cell.

[0187] In several embodiments, lymphocytes are used in combination with one or more additional engineered cells disclosed herein. Some embodiments of the methods and compositions described herein relate to lymphocytes comprising tumor-directed CAR or tumor-directed CAR nucleic acid encoding. In some embodiments, lymphocytes express CARs that bind tumor antigens (such as CD19, CD123, CD70, Her2, mesothelin, Claudin6, BCMA, or EGFR).

[0188] In some embodiments, lymphocytes are engineered to express a membrane-bound interleukin 15 (mbIL15) domain. In some embodiments, lymphocytes engineered to express a chimeric receptor are also engineered to express (e.g., expressed in a bicistronic form) a membrane-bound interleukin 15 (mbIL15) domain. Thus, in some embodiments, lymphocytes are engineered to express a chimeric receptor and mbIL15 in a bicistronic form. Several embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express a CAR targeting a tumor marker (e.g., CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc., as disclosed herein) and a membrane-bound interleukin 15 (mbIL15) domain. Several embodiments of the methods and compositions disclosed herein relate to activating chimeric receptors engineered to express ligands targeting tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, among others), and to select for lymphocytes expressing the membrane-bound interleukin 15 (mbIL15) domain.

[0189] In some embodiments, the lymphocytes are allogeneic cells. In some embodiments, the lymphocytes are obtained from a donor who does not have cancer. T cells for immunotherapy

[0190] In some embodiments, the immune cells comprise T cells. T cells can be distinguished from other lymphocyte subtypes (such as B cells or NK cells) based on the presence of T cell receptors on the cell surface.

[0191] T cells can be divided into various subtypes, including effector T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, mucosal-associated constant T cells, and γδ T cells. In some embodiments, T cells of a specific subtype are engineered. In some embodiments, the T cells are positive for cell surface expression of a marker selected from CD3, CD4, and / or CD8. In some embodiments, the T cells are positive for cell surface expression of CD3. In some embodiments, the T cells are positive for cell surface expression of CD4. In some embodiments, the T cells are positive for cell surface expression of CD8.

[0192] In some embodiments, CD3+T cells are engineered. In some embodiments, CD4+T cells are engineered. In some embodiments, CD8+T cells are engineered. In some embodiments, regulatory T cells are engineered. In some embodiments, γδT cells are engineered. In some embodiments, a mixed T cell subtype population is engineered. For example, in some embodiments, CD4+ and CD8+T cells are engineered. In some embodiments, there is no specific selection for the type of T cells to be engineered to express the cytotoxic receptor complex disclosed herein. In several embodiments, specific techniques (such as cytokine stimulation) are used to enhance the expansion / collection of T cells with a specific marker profile. For example, in several embodiments, activation of certain human T cells (such as CD4+T cells, CD8+T cells) is achieved by using CD3 and / or CD28 as stimulatory molecules.

[0193] In several embodiments, a method for treating or preventing cancer or infectious diseases is provided, comprising administering a therapeutically effective amount of T cells expressing a cytotoxic receptor complex and / or a homing moiety as described herein. In several embodiments, a method for treating or preventing cancer or infectious diseases is provided, comprising administering T cells expressing a cytotoxic receptor complex as described herein. In several embodiments, the engineered T cells are autologous cells, and in some embodiments, the T cells are allogeneic cells. In some embodiments, the T cells are allogeneic cells. In some embodiments, the T cells are obtained from a donor who has never had cancer.

[0194] Several embodiments of the methods and compositions disclosed herein relate to chimeric antigen receptors (CARs) engineered to express targeting tumor markers (such as CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc. disclosed herein) and membrane-bound interleukin 15 (mbIL15) domains. In some embodiments, T cells express CARs that bind CD19. In some embodiments, T cells express CARs that bind CD70. In some embodiments, T cells express CARs that bind BCMA. Several embodiments of the methods and compositions disclosed herein relate to activating chimeric receptors engineered to express ligands on targeting tumor cells (such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, etc.), and optionally express membrane-bound interleukin 15 (mbIL15) domains. In some embodiments, T cells express chimeric receptors that bind NKG2D ligands. In some embodiments, the T cells express a chimeric receptor comprising the extracellular domain of NKG2D.

[0195] In some embodiments, T cells are engineered to express a membrane-bound interleukin 15 (mbIL15) domain. In some embodiments, T cells engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin 15 (mbIL15) domain. Thus, in some embodiments, T cells are engineered to express a chimeric receptor and mbIL15 in a bicistronic form.

[0196] In some embodiments, the immune cells comprise T cells and natural killer (NK) cells (from the same donor or different donors). NK cells for immunotherapy

[0197] In some embodiments, the immune cells comprise natural killer (NK) cells. In several embodiments, a method for treating or preventing cancer or an infectious disease is provided, comprising administering a therapeutically effective amount of natural killer (NK) cells expressing a cytotoxic receptor complex and / or a homing moiety as described herein. In several embodiments, a method for treating or preventing cancer is provided, comprising administering a natural killer (NK) cell expressing a cytotoxic receptor complex as described herein. In several embodiments, a method for treating or preventing an infectious disease is provided, comprising administering a natural killer (NK) cell expressing a cytotoxic receptor complex as described herein. In several embodiments, a method for treating or preventing an infectious disease is provided, comprising administering a natural killer (NK) cell expressing a cytotoxic receptor complex as described herein. In several embodiments, engineered NK cells are autologous cells, and in some embodiments, NK cells are allogeneic cells.

[0198] In several embodiments, NK cells are preferred because the natural cytotoxic potential of NK cells is relatively high. In several embodiments, surprisingly, the engineered cells disclosed herein can further upregulate the cytotoxic activity of NK cells, thereby producing more effective activity against target cells (such as tumor cells or other pathological cells).

[0199] In some embodiments, the NK cells are positive for cell surface expression of a marker selected from CCR7, CD16, CD56, CD57, CD11, CX3CR1, killer cell immunoglobulin-like receptor (KIR), NKp30, NKp44, NKp46, or any combination thereof. In some embodiments, the NK cells are positive for cell surface expression of CD16. In some embodiments, the NK cells are positive for cell surface expression of CD56. In some embodiments, the NK cells are positive for cell surface expression of killer Ig-like receptors.

[0200] Some embodiments of the methods and compositions described herein relate to CARs engineered to express targeting tumor markers (such as CD19, CD123, CD70, Her2, mesothelin, Claudin6, BCMA, EGFR, etc. disclosed herein), and optionally express membrane-bound interleukin 15 (mbIL15) domains of NK cells. In some embodiments, NK cells express CARs that bind CD19. In some embodiments, NK cells express CARs that bind CD70. In some embodiments, NK cells express CARs that bind BCMA. Several embodiments of the methods and compositions disclosed herein relate to activating chimeric receptors that are engineered to express ligands on targeting tumor cells (such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, etc.), and optionally express membrane-bound interleukin 15 (mbIL15) domains of NK cells. In some embodiments, NK cells express chimeric receptors that bind NKG2D ligands. In some embodiments, the NK cells express a chimeric receptor comprising the extracellular domain of NKG2D.

[0201] In some embodiments, NK cells are engineered to express a membrane-bound interleukin 15 (mbIL15) domain. In some embodiments, NK cells engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin 15 (mbIL15) domain. Thus, in some embodiments, NK cells are engineered to express a chimeric receptor and mbIL15 in a bicistronic form.

[0202] In some embodiments, NK cells are derived from the cell line NK-92. NK-92 cells are derived from NK cells, but lack the main inhibitory receptors displayed by normal NK cells, while retaining most of the activating receptors. Some embodiments of the NK-92 cells described herein relate to NK-92 cells being engineered to silence certain additional inhibitory receptors (e.g., SMAD3), thereby upregulating interferon-γ (IFNγ), granzyme B, and / or perforin production. Additional information about the NK-92 cell line is disclosed in WO1998 / 49268 and U.S. Patent Application Publication No. 2002-0068044, the contents of which are incorporated herein by reference in their entirety.

[0203] In some embodiments, NK cells are used in combination with T cells. Thus, in some embodiments, the immune cells comprise T cells and NK cells (from the same donor or different donors). In several embodiments, NK-92 cells are used in combination with one or more other cell types disclosed herein. For example, in one embodiment, NK-92 cells are used in combination with NK cells disclosed herein. In another embodiment, NK-92 cells are used in combination with T cells disclosed herein. Hematopoietic stem cells for cancer immunotherapy

[0204] In some embodiments, hematopoietic stem cells (HSC) are used in the methods of immunotherapy disclosed herein. In several embodiments, the cells are engineered to express a homing moiety and / or a cytotoxic receptor complex. In several embodiments, the cells are engineered to express a cytotoxic receptor complex. In several embodiments, hematopoietic stem cells (HSC) are utilized to utilize their ability to implant and produce blood cells for a long time, which can provide targeted anti-cancer effector cells for sustainable use, for example, to combat cancer recurrence. In several embodiments, this continued production helps to offset the unresponsiveness or exhaustion of other cell types due to factors such as the tumor microenvironment.

[0205] In some embodiments, the HSC is positive for cell surface expression of a marker selected from CD34, CD59, and CD90. In some embodiments, the HSC is positive for cell surface expression of CD34. In some embodiments, the HSC is positive for cell surface expression of CD59. In some embodiments, the HSC is positive for cell surface expression of CD90.

[0206] In several embodiments, allogeneic HSC is used, and in some embodiments, autologous HSC is used. In several embodiments, HSC is used in combination with one or more other engineered cell types disclosed herein. Some embodiments of the methods and compositions described herein relate to a stem cell, for example, engineered to express a CAR targeting a tumor marker (such as CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc. disclosed herein), and optionally expressing a hematopoietic stem cell of membrane-bound interleukin 15 (mbIL15) domain. Several embodiments of the methods and compositions disclosed herein relate to engineered to express an activating chimeric receptor targeting a ligand (such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, etc.) on a tumor cell, and optionally expressing a hematopoietic stem cell of membrane-bound interleukin 15 (mbIL15) domain. Induced Pluripotent Stem Cells

[0207] In some embodiments, immune cells are derived (differentiated) from pluripotent stem cells (PSC). In some embodiments, immune cells (such as NK cells and / or T cells) derived from induced pluripotent stem cells (iPSC) are used in the method for immunotherapy disclosed herein. For example, in some embodiments, NK cells are derived from induced pluripotent stem cells. In some embodiments, induced pluripotent stem cells (iPSC) are used in the method for immunotherapy disclosed herein. In several embodiments, the ability of induced pluripotent stem cells to differentiate into non-pluripotent cells is utilized, and these non-pluripotent cells include but are not limited to CD34 cells, hematopoietic endothelial cells, HSC (hematopoietic stem cells and progenitor cells), hematopoietic multipotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NKT cells, NK cells and B cells, which are differentiated by inducing pluripotent stem cells or cells with a lower degree of differentiation of the same genetic modification at the same selected site so that they include one or more genetic modifications at the selected site. In several embodiments, induced pluripotent stem cells are used to generate NK cells or T cells derived from iPSC. In several embodiments, iPSC is used to generate NK cells derived from iPSC. In several embodiments, iPSCs are used to generate iPSC-derived T cells.

[0208] In several embodiments, the cells are engineered to express a homing moiety and / or a cytotoxic receptor complex. In several embodiments, the cells are engineered to express a cytotoxic receptor complex. In several embodiments, iPSCs are used in combination with one or more other engineered cell types disclosed herein.

[0209] Several embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express activating chimeric receptors targeting ligands on tumor cells (such as CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA or EGFR). In some embodiments, iPSCs engineered to express chimeric receptors are also engineered to express (such as expressed in bicistronic form) membrane-bound interleukin 15 (mbIL15) domains. Some embodiments of the methods and compositions described herein relate to a stem cell, for example, an induced pluripotent stem cell engineered to express a CAR targeting a tumor marker (such as CD19, CD123, CD70, Her2, mesothelin, Claudin 6, BCMA, EGFR, etc., as disclosed herein), and optionally expressing a membrane-bound interleukin 15 (mbIL15) domain.

[0210] Several embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express an activating chimeric receptor targeting a ligand on tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, etc.). In some embodiments, the induced pluripotent stem cells engineered to express the chimeric receptor are also engineered to express (e.g., bicistronic expression) a membrane-bound interleukin 15 (mbIL15) domain. Several embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express an activating chimeric receptor targeting a ligand on tumor cells (e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, etc.), and optionally express a membrane-bound interleukin 15 (mbIL15) domain.

[0211] In several embodiments, engineered iPSCs are differentiated into NK cells, T cells, or other immune cells, for example, for use in the compositions or methods provided herein. In several embodiments, engineered iPSCs are differentiated into NK cells. In several embodiments, engineered iPSCs are differentiated into T cells. In several embodiments, engineered iPSCs are differentiated into NK cells and T cells. Gene editing of immune cells

[0212] As mentioned above, a variety of cell types can be used for cellular immunotherapy. In addition, as described in more detail below and shown in the examples, these cells can be genetically modified to enhance one or more aspects of their efficacy (such as cytotoxicity) and / or persistence (such as active lifespan). As discussed herein, in several embodiments, NK cells are used for immunotherapy. In several embodiments provided herein, gene editing of NK cells can advantageously give the edited NK cells the ability to resist and / or overcome the various inhibitory signals produced in the tumor microenvironment. It is well known that tumors produce a variety of signaling molecules, which are intended to reduce the anti-tumor effects of immune cells. As discussed in more detail below, in several embodiments, gene editing of NK cells limits the inhibitory effect of the tumor microenvironment on NK cells, T cells, a combination of NK cells and T cells, or any edited / engineered immune cells provided herein.

[0213] As discussed below, in several embodiments, gene editing is employed to reduce or knock out expression of a target protein, for example by disrupting the underlying gene encoding the protein.

[0214] In several embodiments, gene editing can reduce the transcription of the target gene by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of the target gene by at least about 30%. In several embodiments, gene editing reduces the transcription of the target gene by at least about 40%. In several embodiments, gene editing reduces the transcription of the target gene by at least about 50%. In several embodiments, gene editing reduces the transcription of the target gene by at least about 60%. In several embodiments, gene editing reduces the transcription of the target gene by at least about 70%. In several embodiments, gene editing reduces the transcription of the target gene by at least about 80%. In several embodiments, gene editing reduces the transcription of the target gene by at least about 90%. In several embodiments, the gene is completely knocked out so that the transcription of the target gene cannot be detected.

[0215] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of the target protein by at least about 30%. In several embodiments, gene editing reduces the expression of the target protein by at least about 40%. In several embodiments, gene editing reduces the expression of the target protein by at least about 50%. In several embodiments, gene editing reduces the expression of the target protein by at least about 60%. In several embodiments, gene editing reduces the expression of the target protein by at least about 70%. In several embodiments, gene editing reduces the expression of the target protein by at least about 80%. In several embodiments, gene editing reduces the expression of the target protein by at least about 90%. In several embodiments, the gene is completely knocked out so that the expression of the target protein is undetectable.

[0216] In several embodiments, gene editing is used to "knock in" or otherwise increase the transcription of a target gene. In several embodiments, the transcription of a target gene increases by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, the transcription of a target gene increases by at least about 30%. In several embodiments, the transcription of a target gene increases by at least about 40%. In several embodiments, the transcription of a target gene increases by at least about 50%. In several embodiments, the transcription of a target gene increases by at least about 60%. In several embodiments, the transcription of a target gene increases by at least about 70%. In several embodiments, the transcription of a target gene increases by at least about 80%. In several embodiments, the transcription of a target gene increases by at least about 90%. In several embodiments, the transcription of a target gene increases by at least about 100%.

[0217] In several embodiments, gene editing is used to "knock in" or otherwise enhance the expression of a target protein. In several embodiments, the expression of a target protein can be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, the expression of the target protein increases by at least about 30%. In several embodiments, the expression of the target protein increases by at least about 40%. In several embodiments, the expression of the target protein increases by at least about 50%. In several embodiments, the expression of the target protein increases by at least about 60%. In several embodiments, the expression of the target protein increases by at least about 70%. In several embodiments, the expression of the target protein increases by at least about 80%. In several embodiments, the expression of the target protein increases by at least about 90%. In several embodiments, the expression of the target protein increases by at least about 100%.

[0218] Unless otherwise indicated to the contrary, guide RNA (gRNA) sequences expressed using deoxyribonucleotides refer to target DNA sequences (which are complementary to the corresponding non-target DNA sequences to which the gRNA binds) and should be considered to refer to those guide sequences used in actual applications (e.g., using ribonucleotides, wherein the ribonucleotide uracil replaces the deoxyribonucleotide thymine, whereas when thymine is used instead of uracil, both are complementary to adenine when expressing RNA or DNA sequences). In other words, the specific gRNA sequences provided herein are identical to the gRNA sequences used in actual applications, except that uracil is used instead of thymine in the gRNA sequence. For example, a gRNA with the sequence ATGCTCAATGCGTC (SEQ ID NO: 977) also refers to the following sequence AUGCUCAAUGCGUC (SEQ ID NO: 978); or a gRNA with the sequence AUGCUCAAUGCGUC (SEQ ID NO: 978) also refers to the following sequence ATGCTCAATGCGTC (SEQ ID NO: 977). In addition, the non-target DNA sequence bound by a specific gRNA sequence is complementary to the sequence of the specific gRNA. For example, a gRNA with the sequence ATGCTCAATGCGTC (SEQ ID NO: 977) binds to the non-target DNA sequence TACGAGTTACGCAG (SEQ ID NO: 979). In this case, the corresponding target DNA sequence complementary to the non-target DNA sequence is ATGCTCAATGCGTC (SEQ ID NO: 977).

[0219] In several embodiments, the gene editing of immune cells also provides unexpected enhanced amplification capacity, persistence and / or cytotoxicity of edited immune cells. As disclosed herein, engineered cells (such as those expressing CAR) can also be edited, and the two are combined to provide powerful cells for immunotherapy. In several embodiments, the editing makes the amplification, persistence and / or cytotoxicity of NK cells unexpectedly improved. In several embodiments, knocking out gene expression in NK cells removes the potent negative regulator or other inhibitory factors for NK cell signaling and / or activity, thereby relieving the inhibition of NK cells, and enhancing one or more aspects of NK cell homing, NK cell migration, NK cell activation, amplification, cytotoxicity and / or persistence. In addition, in several embodiments, the editing can enhance the function of NK cells and / or T cells in an originally inhibitory tumor microenvironment.

[0220] In several embodiments, the gene editing of any target gene disclosed herein (whether knocking out or knocking in) is achieved by targeting the introduction of DNA breaks, which are subsequently achieved by means of DNA repair mechanisms. In several embodiments, the double-strand break of DNA is repaired by non-homologous end joining (NHEJ), wherein an enzyme is used to directly connect the DNA end to the other end to repair the break. NHEJ is an error-prone process. Typically, in the absence of a repair template, the NHEJ process reconnects the broken DNA chain ends, which often results in nucleotide deletions and insertions at the cut site. However, in several embodiments, double-strand breaks (DSBs) are repaired by homology-directed repair (HDR), which has the advantage of being more accurate, thereby achieving sequence-specific breakage and repair. HDR uses homologous sequences as templates for regenerating missing DNA sequences at breakpoints, such as within sequences homologous to the flanking sequences of the double-strand break, with a vector of desired genetic elements (e.g., insertion elements for destroying gene coding sequences). This will result in the desired change (e.g., insertion) being inserted at the site of the DSB. The HDR approach can occur by classical HDR approaches or alternative HDR approaches. Unless otherwise indicated, the terms "HDR" or "homologous directed repair" as used herein encompass both classical HDR and alternative HDR.

[0221] Classical HDR, "canonical homology-directed repair" or "cHDR" are used interchangeably and refer to the process of repairing DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences, such as sister chromatids; or exogenous nucleic acids, such as donor templates). Classical HDR typically works when significant resection occurs at the DSB, forming at least one segment of single-stranded DNA. In normal cells, classical homology-directed repair typically involves a series of steps, such as break recognition, break stabilization, resection, stabilization of single-stranded DNA, formation of DNA crossover intermediates, splitting and ligation of crossover intermediates. The classical HDR process requires RAD51 and BRCA2, and the homologous nucleic acid (e.g., repair template) is typically double-stranded. In classical HDR, a double-stranded polynucleotide (e.g., a double-stranded repair template) is introduced, which contains a sequence homologous to the target sequence, and this sequence will be directly integrated into the target sequence, or used as a template to insert the sequence or portion of the repair template into the target gene. After resection of the break, repair can proceed through different pathways, such as through the double Holliday junction model (also known as double-strand break repair, or DSBR pathway), or through the synthesis-dependent strand annealing (SDSA) pathway.

[0222] In the double Holliday ligation model, the overhangs of the two single strands of the target sequence invade the homologous sequence in the double-stranded polynucleotide (such as the double-stranded donor template), resulting in strand invasion, which leads to an intermediate with two Holliday junctions. As new DNA is synthesized from the ends of the invading strands to fill the gap created by the excision, the junction migrates. The ends of the newly synthesized DNA are connected to the ends of the excision, and the junction splits, resulting in an insertion at the target sequence or a portion of the target sequence containing the gene variant. When the junction splits, it can cross with a polynucleotide (such as a repair template).

[0223] In the SDSA approach, only one single-stranded overhang invades a polynucleotide (such as a donor template), and new DNA is synthesized from the end of the invading strand to fill the gap created by the excision. The newly synthesized DNA then anneals to the remaining single-stranded overhang, new DNA is synthesized to fill the gap, and the strands are ligated to produce a modified DNA duplex.

[0224] Alternative HDR, "alternative homology-directed repair" or "alternative HDR" are used interchangeably and, in some embodiments, refer to the process of repairing DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences, such as sister chromatids; or exogenous nucleic acids, such as repair templates). Alternative HDR differs from classical HDR in that the process uses a different pathway from classical HDR and can be inhibited by the classical HDR mediators RAD51 and BRCA2. In addition, alternative HDR is also characterized by involving single-stranded or nicked homologous nucleic acid templates (such as repair templates), while classical HDR often involves double-stranded homologous templates. In the alternative HDR approach, a single-stranded template polynucleotide (such as a repair template) is introduced. The nick, single-strand break or double-strand break at the cleavage site is used to change the desired target site (such as a gene variant in a target gene), which is mediated by a nuclease molecule, and resection occurs at the break to expose a single-stranded overhang. As described herein, the sequence of a template polynucleotide (such as a repair template) is typically integrated into DNA via the SDSA approach to change the target site. In some embodiments, HDR is performed by introducing one or more agents capable of inducing DSBs and a repair template (such as a single-stranded oligonucleotide) into a cell. The introduction operation can be performed by any suitable delivery method. The conditions that allow HDR to occur can be any conditions suitable for performing homology-directed repair (HDR) in a cell.

[0225] In several embodiments, gene editing is accomplished by one or more engineered nucleases. In several embodiments, restriction endonucleases are used, particularly when double-strand breaks need to be generated in multiple regions. In several embodiments, bioengineered nucleases are used. According to various embodiments, one or more of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and / or clustered regularly interspaced short palindromic repeats (CRISPR / Cas9) systems are used to specifically edit genes encoding one or more TCR subunits.

[0226] The characteristic of a meganuclease is that it can recognize and cut long DNA sequences (14 to 40 base pairs). In several embodiments, a meganuclease from the LAGLIDADG family is used, and mutagenesis and screening are performed to generate a meganuclease variant capable of recognizing unique sequences (such as specific sites in TCR subunits (such as TRAC), CISH or any other target gene disclosed herein). The target site in the TCR subunit can be easily identified. More information about target sites in the region of TCR can be found in U.S. Patent Publication No. 2018 / 0325955 and U.S. Patent Publication No. 2015 / 0017136, the contents of which are incorporated herein by reference in their entirety. In several embodiments, two or more meganucleases or their functional fragments are fused to create a hybrid enzyme that recognizes the target sequence required in a target gene (such as CISH).

[0227] Unlike large-scale nucleases, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) work based on non-specific DNA cutting catalytic domains, which are connected to specific DNA sequence recognition peptides such as zinc fingers or transcription activator-like effectors (TALEs). Advantageously, zinc finger nucleases and transcription activator-like effector nucleases can therefore achieve sequence-independent DNA cutting while having high sequence specificity in target recognition. Zinc finger motifs naturally play a role in transcription factors, identifying specific DNA sequences for transcription. The C-terminal portion of each zinc finger is responsible for the specific recognition of the DNA sequence. Although the sequence recognized by zinc finger nucleases is relatively short (such as about 3 base pairs), in several embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more zinc finger combinations whose recognition sites have been characterized are used to target specific sequences, such as part of the TCR (or immune checkpoint). The combined zinc finger nuclease is then fused to the catalytic domain of an endonuclease (such as FokI, optionally a FokI heterodimer) to induce targeted DNA breakage. More information about using zinc finger nucleases to edit TCR subunits and / or immune checkpoints can be found in U.S. Patent No. 9,597,357, the contents of which are incorporated herein by reference.

[0228] Transcription activator-like effector nucleases (TALENs) are specific DNA binding proteins characterized by having a series of 33 or 34 amino acid repeats. Like zinc finger nucleases, TALENs are fusions of the DNA cleavage domain of a nuclease with a TALE domain, which enables the introduction of sequence-independent double-stranded DNA breaks while enabling highly accurate recognition of target sites. TALENs can create double-strand breaks at the target site, which can be repaired by error-prone non-homologous end joining (NHEJ), which results in gene disruption by introducing small insertions or deletions. Advantageously, TALENs are used in several embodiments, at least in part because they have higher specificity in DNA binding, reduced off-target effects, and easier construction of DNA binding domains.

[0229] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a genetic element that bacteria use to resist viruses. The repetitive sequence is a short sequence derived from the viral genome and integrated into the bacterial genome. Cas (CRISPR-associated protein) processes these sequences and cuts matching viral DNA sequences. By introducing a plasmid containing the Cas gene and a specifically constructed CRISPR into eukaryotic cells, the eukaryotic genome can be cut at any desired position. More information about CRISPR can be found in U.S. Patent Publication No. 2014 / 0068797, the contents of which are incorporated herein by reference. In several embodiments, CRISPR is used to manipulate genes encoding target genes to be knocked out or knocked in (such as CISH, TGFBR2, TCR, B2M, CIITA, CD47, HLA-E, etc.). In several embodiments, CRISPR is used to edit one or more TCRs of T cells and / or genes encoding one or more immune checkpoints. In several embodiments, immune checkpoints are selected from one or more of CTLA4 and PD1. In several embodiments, CRISPR is used to truncate one or more of TCRα, TCRβ, TCRγ, and TCRδ. In several embodiments, the TCR is truncated without affecting the function of the CD3ζ signaling domain of the TCR.

[0230] Depending on the embodiment and the target gene to be edited, Class 1 or Class 2 Cas proteins are used. In several embodiments, Class 1 Cas proteins are used, and the Cas protein types are selected from the following types: I, IA, IB, IC, ID, IE, IF, IU, III, IIIA, IIIB, IIIC, IIID, IV, IVA, IVB, and combinations thereof. In several embodiments, the Cas protein is selected from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, and combinations thereof. In several embodiments, Class 2 Cas proteins are used, and the Cas protein types are selected from the following types: II, IIA, IIB, IIC, V, VI, and combinations thereof. In several embodiments, the Cas protein is selected from Cas9, Csn2, Cas4, Cas12a (formerly known as Cpf1), C2c1, C2c3, Cas13a (formerly known as C2c2), Cas13b, Cas13c, CasX, CasY, and combinations thereof. In some embodiments, the Cas protein is Cas9. In some embodiments, two types of CasX are used, wherein CasX is capable of forming a complex with a guide nucleic acid, and wherein the complex can bind to a target DNA, and wherein the target DNA comprises a non-target strand and a target strand. In some embodiments, two types of CasY are used, wherein CasY is capable of binding to and modifying a target nucleic acid and / or a polypeptide associated with a target nucleic acid. Targets for gene editing

[0231] As described above, gene editing can be used to destroy one or more target genes to enhance the function (such as amplification ability, cytotoxicity) or persistence (lifespan or anti-hypoxia ability) of immune cells (such as NK cells). In some embodiments, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof are used to edit immune cells. In some embodiments, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, CBLB, CISH, ID3, SOX4, or any combination thereof are used to edit immune cells.

[0232] As a non-limiting example, in several embodiments, a member of the disintegrin metalloproteinase domain (ADAM) family (specifically ADAM17) is a target for gene editing. ADAM17 (located on chromosome 2) is associated with antibody-dependent cell-mediated cytotoxicity (ADCC), a key mechanism of action in anti-tumor responses. CD16A is a membrane-bound protein expressed by NK cells and a receptor for the Fc portion of IgG. Although engagement of CD16A (e.g., by antibody-coated target cells) triggers NK cell-mediated ADCC, upon NK cell activation, CD16A is cleaved from the NK cell surface and rapidly downregulated (either in vivo or in vitro, e.g., by PMA). ADAM17 is considered to be the main protease responsible for cleaving CD16A from the surface of NK cells; inhibition of ADAM17 (e.g., by disrupting ADAM17 expression) reduces, improves, or otherwise inhibits the cleavage of CD16A, thereby allowing ADCC to continue as an effective anti-tumor pathway (Wu et al., J Leukoc Biol (2019) 105(6):1297-1303). In addition, CD62 ligand (CD62L) is a substrate of ADAM17, and in several embodiments, disrupting the expression function of ADAM17 can stabilize the expression of CD62L. CD62L (L-selectin molecule) mediates homing of leukocytes to lymphoid organs. CD56dimCD62L+ cells represent a unique subset of mature, multifunctional NK cells that influence the intensity of local NK cell responses, particularly through the ability to produce IFN-γ after cytokine stimulation, the ability to proliferate in vivo during viral infection, and the ability to kill target cells after activating receptor engagement. Therefore, in several embodiments, stabilizing CD62L can further enhance the function of NK cells.

[0233] In several embodiments, gene editing reduces the transcription of ADAM17 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of ADAM17 by at least about 30%, in several embodiments, gene editing reduces the transcription of ADAM17 by at least about 40%, in several embodiments, gene editing reduces the transcription of ADAM17 by at least about 50%, in several embodiments, gene editing reduces the transcription of ADAM17 by at least about 60%, in several embodiments, gene editing reduces the transcription of ADAM17 by at least about 70%, in several embodiments, gene editing reduces the transcription of ADAM17 by at least about 80%, and in several embodiments, gene editing reduces the transcription of ADAM17 by at least about 90%.

[0234] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of ADAM17 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of ADAM17 by at least about 30%, in several embodiments, gene editing reduces the expression of ADAM17 by at least about 40%, in several embodiments, gene editing reduces the expression of ADAM17 by at least about 50%, in several embodiments, gene editing reduces the expression of ADAM17 by at least about 60%, in several embodiments, gene editing reduces the expression of ADAM17 by at least about 70%, in several embodiments, gene editing reduces the expression of ADAM17 by at least about 80%, and in several embodiments, gene editing reduces the expression of ADAM17 by at least about 90%.

[0235] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 682-687 is used to disrupt (eg, reduce expression of) the ADAM17 gene.

[0236] In several embodiments, hypoxia-inducible factor 1α (HIF1α) is a target for gene editing. HIF1α (which is located on chromosome 15) is a transcriptional activator of CD274 (also known as PDL1). When hypoxic conditions exist, HIF1α interacts with the hypoxia response element in the promoter of PDL1, thereby promoting increased expression of PDL1. PDL1 expression is upregulated on a variety of cells, including tumor cells, immune cells (including MDSCs, macrophages, DCs, and bone marrow-derived macrophages (BMDMs)), and other cells in the tumor microenvironment (TME). Through the binding of PD1 to PDL1, it is used to inhibit the ability of T cells and / or NK cells to kill tumors. Studies using single-cell RNA sequencing of tumor-infiltrating NK cells have shown that inhibition of HIF1α promotes the activity of tumor-infiltrating NK cells (Ni et al., Immunity (2020) 52(6):1075-87). In some embodiments, loss of HIF1α in NK cells inhibits tumor growth by, for example, stimulating ineffective angiogenesis (eg, starving tumor cells of a blood supply).

[0237] In several embodiments, gene editing reduces the transcription of HIF1α by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of HIF1α by at least about 30%, in several embodiments, gene editing reduces the transcription of HIF1α by at least about 40%, in several embodiments, gene editing reduces the transcription of HIF1α by at least about 50%, in several embodiments, gene editing reduces the transcription of HIF1α by at least about 60%, in several embodiments, gene editing reduces the transcription of HIF1α by at least about 70%, in several embodiments, gene editing reduces the transcription of HIF1α by at least about 80%, and in several embodiments, gene editing reduces the transcription of HIF1α by at least about 90%.

[0238] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of HIF1α by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of HIF1α by at least about 30%, in several embodiments, gene editing reduces the expression of HIF1α by at least about 40%, in several embodiments, gene editing reduces the expression of HIF1α by at least about 50%, in several embodiments, gene editing reduces the expression of HIF1α by at least about 60%, in several embodiments, gene editing reduces the expression of HIF1α by at least about 70%, in several embodiments, gene editing reduces the expression of HIF1α by at least about 80%, and in several embodiments, gene editing reduces the expression of HIF1α by at least about 90%.

[0239] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 750-760 is used to disrupt (eg, reduce expression of) the HIF1α gene.

[0240] As a non-limiting example, diacylglycerol kinase ζ (DGKζ) is a target for gene editing to reduce or knock out expression. DGKζ is located on chromosome 11 and is a negative regulator of diacylglycerol kinase-mediated signaling. Studies have shown that mice lacking DGKζ increase cytokine production and degranulation, which in some cases occurs in an ERK (also known as Ras-Raf-MEK-ERK pathway)-dependent manner. In addition, CRISPR / Cas9-mediated DGK knockout can improve T cell function (such as anti-tumor activity). However, in NK cells, destroying DGKζ is considered to be particularly beneficial because, according to some embodiments, destroying DGKζ does not negatively affect the expression or function of inhibitory NK cell receptors, thereby maintaining the natural balance of NK cell activation and inhibitory signals that regulate NK cell activity in many aspects (SingH and Kambayashi, Front Cell Dev Bio (2016) 4: 96). Thus, in several embodiments, enhancement of NK cell function is achieved by enhancing NK cell activity and signaling by disinhibiting the negative regulatory aspects of activation pathways rather than by disrupting the "brakes" on NK cell function (expression or function of inhibitory NK cell receptors, which can lead to uncontrolled NK cell activity and potential off-target cytotoxicity).

[0241] In several embodiments, gene editing reduces the transcription of DGKζ by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the recited values). In several embodiments, gene editing reduces the transcription of DGKζ by at least about 30%, in several embodiments, gene editing reduces the transcription of DGKζ by at least about 40%, in several embodiments, gene editing reduces the transcription of DGKζ by at least about 50%, in several embodiments, gene editing reduces the transcription of DGKζ by at least about 60%, in several embodiments, gene editing reduces the transcription of DGKζ by at least about 70%, in several embodiments, gene editing reduces the transcription of DGKζ by at least about 80%, and in several embodiments, gene editing reduces the transcription of DGKζ by at least about 90%.

[0242] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of DGKζ by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of DGKζ by at least about 30%, in several embodiments, gene editing reduces the expression of DGKζ by at least about 40%, in several embodiments, gene editing reduces the expression of DGKζ by at least about 50%, in several embodiments, gene editing reduces the expression of DGKζ by at least about 60%, in several embodiments, gene editing reduces the expression of DGKζ by at least about 70%, in several embodiments, gene editing reduces the expression of DGKζ by at least about 80%, and in several embodiments, gene editing reduces the expression of DGKZ by at least about 90%.

[0243] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 688-723 is used to disrupt (e.g., reduce expression of) the DGKze gene.

[0244] In several embodiments, glycogen synthase kinase-3β (GSK3β) is a target for gene editing. GSK3β is located on chromosome 11 and is a ubiquitously expressed serine / threonine kinase that is involved in a variety of cellular functions, including differentiation, survival, glycogen metabolism, protein synthesis, immune response, and cell death. In patients with AML, inhibition of GSK3β is thought to restore the cytotoxicity of NK cells. In addition, GSK3β inhibition (e.g., by small molecule inhibitors) can drive NK cell maturation and, in some embodiments, enhance anti-tumor activity (Cichocki et al., Cancer Res (2017) 77(20): 5664-75). Normal levels of GSK3β are thought to have a negative regulatory effect on multiple aspects of NK cell function, including those functions triggered by one or more (e.g., combinations) of activating NK cell receptors. Returning to the role of small molecules, small molecule inhibitors of GSK3β can specifically inhibit the transcription of the inhibitory co-receptor LAG-3 (Rudd et al., Cell Rep (2020) 30(7):2075-82; discussed in more detail below).

[0245] In several embodiments, gene editing reduces the transcription of GSK3β by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of GSK3β by at least about 30%, in several embodiments, gene editing reduces the transcription of GSK3β by at least about 40%, in several embodiments, gene editing reduces the transcription of GSK3β by at least about 50%, in several embodiments, gene editing reduces the transcription of GSK3β by at least about 60%, in several embodiments, gene editing reduces the transcription of GSK3β by at least about 70%, in several embodiments, gene editing reduces the transcription of GSK3β by at least about 80%, and in several embodiments, gene editing reduces the transcription of GSK3β by at least about 90%.

[0246] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of GSK3β by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of GSK3β by at least about 30%, in several embodiments, gene editing reduces the expression of GSK3β by at least about 40%, in several embodiments, gene editing reduces the expression of GSK3β by at least about 50%, in several embodiments, gene editing reduces the expression of GSK3β by at least about 60%, in several embodiments, gene editing reduces the expression of GSK3β by at least about 70%, in several embodiments, gene editing reduces the expression of GSK3β by at least about 80%, and in several embodiments, gene editing reduces the expression of GSK3β by at least about 90%.

[0247] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 724-749 is used to disrupt (eg, reduce expression of) the GSK3β gene.

[0248] In several embodiments, lymphocyte activation gene 3 (LAG3) is a target for gene editing. LAG3 (located on chromosome 12) acts as an immune checkpoint and inhibits the activation of its host cells (such as NK cells and / or T cells), and generally promotes a more suppressive immune response. For example, on T cells, LAG3 reduces cytokine and granzyme production and cell proliferation, while promoting T cell differentiation into regulatory T cells rather than cytotoxic T cells. LAG3 acts as a checkpoint in NK cells, reducing cytokine production by CD56+Dim cytotoxic cells.

[0249] In several embodiments, gene editing reduces LAG3 transcription by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between). In several embodiments, gene editing reduces LAG3 transcription by at least about 30%; in several embodiments, gene editing reduces LAG3 transcription by at least about 40%; in several embodiments, gene editing reduces LAG3 transcription by at least about 50%; in several embodiments, gene editing reduces LAG3 transcription by at least about 60%; in several embodiments, gene editing reduces LAG3 transcription by at least about 70%; in several embodiments, gene editing reduces LAG3 transcription by at least about 80%; in several embodiments, gene editing reduces LAG3 transcription by at least about 90%.

[0250] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of LAG3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of LAG3 by at least about 30%; in several embodiments, gene editing reduces the expression of LAG3 by at least about 40%; in several embodiments, gene editing reduces the expression of LAG3 by at least about 50%; in several embodiments, gene editing reduces the expression of LAG3 by at least about 60%; in several embodiments, gene editing reduces the expression of LAG3 by at least about 70%; in several embodiments, gene editing reduces the expression of LAG3 by at least about 80%; and in several embodiments, gene editing reduces the expression of LAG3 by at least about 90%.

[0251] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 761-789 is used to disrupt (e.g., reduce expression of) the LAG3 gene.

[0252] In several embodiments, T-cell immunoglobulin and mucin domain 3 (TIM3) is a target for gene editing. TIM3 is a receptor expressed on NK cells and is considered a marker of dysfunctional NK cells. TIM3 is an immune checkpoint and belongs to the TIM protein family. TIM3 has multiple ligands, including CEACAM1, high-mobility group protein B1 (HMGB1), phosphatidylserine (PtdSer), and galectin-9 (Gal-9), which interact with TIM3 to reduce cell signaling. Like LAG3 mentioned above, TIM3 is induced by hypoxia, for example in certain regions of the tumor microenvironment (along with other genes, including CTLA4, PD1, PDL1, CD47, and other immune checkpoints). In several embodiments, genetic disruption of TIM3 reduces the negative effects of a hypoxic tumor microenvironment and can enhance NK cell anti-tumor activity.

[0253] In several embodiments, gene editing reduces the transcription of TIM3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of TIM3 by at least about 30%; in several embodiments, gene editing reduces the transcription of TIM3 by at least about 40%; in several embodiments, gene editing reduces the transcription of TIM3 by at least about 50%; in several embodiments, gene editing reduces the transcription of TIM3 by at least about 60%; in several embodiments, gene editing reduces the transcription of TIM3 by at least about 70%; in several embodiments, gene editing reduces the transcription of TIM3 by at least about 80%; in several embodiments, gene editing reduces the transcription of TIM3 by at least about 90%.

[0254] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TIM3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TIM3 by at least about 30%; in several embodiments, gene editing reduces the expression of TIM3 by at least about 40%; in several embodiments, gene editing reduces the expression of TIM3 by at least about 50%; in several embodiments, gene editing reduces the expression of TIM3 by at least about 60%; in several embodiments, gene editing reduces the expression of TIM3 by at least about 70%; in several embodiments, gene editing reduces the expression of TIM3 by at least about 80%; and in several embodiments, gene editing reduces the expression of TIM3 by at least about 90%.

[0255] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 790-825 is used to disrupt (eg, reduce expression of) the TIM3 gene.

[0256] In several embodiments, tripartite motif-containing protein 29 (TRIM29) is a target of gene editing. TRIM29 (located on chromosome 11) is a member of a protein family involved in many biological processes, including cell development, differentiation, apoptosis, and tumorigenesis. TRIM29 is induced by IL-12 and IL-18 in NK cells, and because it has E3 ubiquitin ligase function, it promotes the proteasome-mediated degradation of various target genes (such as TAB2 (TGF-β activated kinase binding protein 2)), which leads to the inhibition of IFN-γ production of activated NK cells, thereby limiting their cytotoxicity (Dou et al., J Immunol (2019) 203 (4): 873-80). In several embodiments, for example, by gene editing, the deletion of TRIM29 in NK cells can lead to significantly enhanced NK cell function even after IL-12 and IL-18 stimulation.

[0257] In several embodiments, gene editing reduces the transcription of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 30%; in several embodiments, gene editing reduces the transcription of TRIM29 by at least about 40%; in several embodiments, gene editing reduces the transcription of TRIM29 by at least about 50%; in several embodiments, gene editing reduces the transcription of TRIM29 by at least about 60%; in several embodiments, gene editing reduces the transcription of TRIM29 by at least about 70%; in several embodiments, gene editing reduces the transcription of TRIM29 by at least about 80%; in several embodiments, gene editing reduces the transcription of TRIM29 by at least about 90%.

[0258] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TRIM29 by at least about 30%; in several embodiments, gene editing reduces the expression of TRIM29 by at least about 40%; in several embodiments, gene editing reduces the expression of TRIM29 by at least about 50%; in several embodiments, gene editing reduces the expression of TRIM29 by at least about 60%; in several embodiments, gene editing reduces the expression of TRIM29 by at least about 70%; in several embodiments, gene editing reduces the expression of TRIM29 by at least about 80%; and in several embodiments, gene editing reduces the expression of TRIM29 by at least about 90%.

[0259] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 826-835 is used to disrupt (eg, reduce expression of) the TRIM29 gene.

[0260] In several embodiments, interleukin-1 receptor 8 (IL-1R8) is a target for gene editing. IL-1R8 (located on chromosome 11) is a member of the interleukin-1 receptor (ILR) family and acts as a negative regulator of signaling pathways downstream of ILRs and Toll-like receptors (TLRs), as well as inflammation. IL-1R8 is a co-receptor for IL-37 with IL-1R5 / IL-18Rα. IL-1R8 is a checkpoint in NK cells that negatively regulates anti-tumor and antiviral activity.

[0261] In several embodiments, gene editing reduces the transcription of IL-1R8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 30%; in several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 40%; in several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 50%; in several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 60%; in several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 70%; in several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 80%; in several embodiments, gene editing reduces the transcription of IL-1R8 by at least about 90%.

[0262] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of IL-1R8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of IL-1R8 by at least about 30%; in several embodiments, gene editing reduces the expression of IL-1R8 by at least about 40%; in several embodiments, gene editing reduces the expression of IL-1R8 by at least about 50%; in several embodiments, gene editing reduces the expression of IL-1R8 by at least about 60%; in several embodiments, gene editing reduces the expression of IL-1R8 by at least about 70%; in several embodiments, gene editing reduces the expression of IL-1R8 by at least about 80%; and in several embodiments, gene editing reduces the expression of IL-1R8 by at least about 90%.

[0263] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 836-865 is used to disrupt (eg, reduce expression of) the IL-1R8 gene.

[0264] In several embodiments, CD38 is a target for gene editing. CD38 (located on chromosome 4) is an extracellular enzyme with nicotinamide adenine dinucleotide-positive (NAD+) glycohydrolase and ADP-ribosyl cyclase activities. CD38 is also expressed on a variety of tumor cells, such as multiple myeloma cells and acute myeloid leukemia cells. The function of CD38 and these glycohydrolase and cyclase activities produce the immunosuppressive molecule adenosine in certain cases, which: (i) inhibits the lysis of tumor cells by T cells and NK cells; (ii) induces the production of M2 macrophages and tolerogenic dendritic cells (DC); and / or (iii) induces Treg expansion. In addition, the endogenous expression of CD38 can cause problems for the persistence of therapeutic cells, for example, if a CAR targeting CD38 is used, it can lead to fratricide.

[0265] In several embodiments, gene editing reduces CD38 transcription by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between). In several embodiments, gene editing reduces CD38 transcription by at least about 30%; in several embodiments, gene editing reduces CD38 transcription by at least about 40%; in several embodiments, gene editing reduces CD38 transcription by at least about 50%; in several embodiments, gene editing reduces CD38 transcription by at least about 60%; in several embodiments, gene editing reduces CD38 transcription by at least about 70%; in several embodiments, gene editing reduces CD38 transcription by at least about 80%; in several embodiments, gene editing reduces CD38 transcription by at least about 90%.

[0266] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CD38 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CD38 by at least about 30%; in several embodiments, gene editing reduces the expression of CD38 by at least about 40%; in several embodiments, gene editing reduces the expression of CD38 by at least about 50%; in several embodiments, gene editing reduces the expression of CD38 by at least about 60%; in several embodiments, gene editing reduces the expression of CD38 by at least about 70%; in several embodiments, gene editing reduces the expression of CD38 by at least about 80%; and in several embodiments, gene editing reduces the expression of CD38 by at least about 90%.

[0267] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 866-874 is used to disrupt (eg, reduce expression of) the CD38 gene.

[0268] In several embodiments, fructose-1,6-bisphosphatase (FBP1) is a target for gene editing. FBP1 (located on chromosome 9) is a rate-limiting enzyme involved in gluconeogenesis. It primarily promotes gluconeogenesis while inhibiting glycolysis. FBP1-related impairment of NK cell glycolysis leads to NK cell dysfunction (Cong et al., Cell Metab (2018) 28(2):243-55). However, according to several embodiments, disrupting FBP1 expression restores NK cell function.

[0269] In several embodiments, gene editing reduces the transcription of FBP1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount in between). In several embodiments, gene editing reduces the transcription of FBP1 by at least about 30%; in several embodiments, gene editing reduces the transcription of FBP1 by at least about 40%; in several embodiments, gene editing reduces the transcription of FBP1 by at least about 50%; in several embodiments, gene editing reduces the transcription of FBP1 by at least about 60%; in several embodiments, gene editing reduces the transcription of FBP1 by at least about 70%; in several embodiments, gene editing reduces the transcription of FBP1 by at least about 80%; in several embodiments, gene editing reduces the transcription of FBP1 by at least about 90%.

[0270] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of FBP1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of FBP1 by at least about 30%; in several embodiments, gene editing reduces the expression of FBP1 by at least about 40%; in several embodiments, gene editing reduces the expression of FBP1 by at least about 50%; in several embodiments, gene editing reduces the expression of FBP1 by at least about 60%; in several embodiments, gene editing reduces the expression of FBP1 by at least about 70%; in several embodiments, gene editing reduces the expression of FBP1 by at least about 80%; and in several embodiments, gene editing reduces the expression of FBP1 by at least about 90%.

[0271] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 875-889 is used to disrupt (eg, reduce expression of) the FBP1 gene.

[0272] In some embodiments, insulin-induced gene 1 (INSIG1) is a target for gene editing. INSIG1 (located on chromosome 7) is a negative regulator of sterol regulatory element binding protein (SRBP) transcription. SRBP (after transcription and expression) is a protein involved in key aspects of glucose metabolism in NK cells, particularly related to NK cell functional responses (such as cytotoxicity) (Assmann et al., Nat Immunol (2017) 18(11): 1197-1206). According to some embodiments, disruption of INSIG1 expression relieves inhibition, thereby restoring NK cell function.

[0273] In several embodiments, gene editing reduces transcription of INSIG1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between). In several embodiments, gene editing reduces transcription of INSIG1 by at least about 30%; in several embodiments, gene editing reduces transcription of INSIG1 by at least about 40%; in several embodiments, gene editing reduces transcription of INSIG1 by at least about 50%; in several embodiments, gene editing reduces transcription of INSIG1 by at least about 60%; in several embodiments, gene editing reduces transcription of INSIG1 by at least about 70%; in several embodiments, gene editing reduces transcription of INSIG1 by at least about 80%; in several embodiments, gene editing reduces transcription of INSIG1 by at least about 90%.

[0274] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of INSIG1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of INSIG1 by at least about 30%; in several embodiments, gene editing reduces the expression of INSIG1 by at least about 40%; in several embodiments, gene editing reduces the expression of INSIG1 by at least about 50%; in several embodiments, gene editing reduces the expression of INSIG1 by at least about 60%; in several embodiments, gene editing reduces the expression of INSIG1 by at least about 70%; in several embodiments, gene editing reduces the expression of INSIG1 by at least about 80%; and in several embodiments, gene editing reduces the expression of INSIG1 by at least about 90%.

[0275] In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 890-934 is used to disrupt (eg, reduce expression of) the INSIG1 gene.

[0276] Cells require a variety of different types of molecular complexes to carry out the cellular processes of transcription and translation. These complexes, composed of multiple (sometimes different) subunits, can confer specific functions on cells, depending on their assembly and activity. One such molecular complex is the Mediator complex, which is expressed and essential in cells where genes are actively expressed (e.g., immune cells like NK cells). It primarily acts as a "molecular bridge," connecting two otherwise unconnected regions of DNA within the cell. For example, it can connect promoters and enhancers, thereby physically positioning the various elements and associated transcription factors required for RNA polymerase to transcribe gene expression. Mediator complex subunit 12 (MED12) is part of the four-part cyclin-dependent kinase (CDK) module of Mediator, which also includes MED13, cyclin-dependent kinase 8 (CDK8), and cyclin C (CCNC). Mutations in MED12 have been associated with lymphoproliferative disorders (Kampjarvi et al., Oncotarget (2015) 6(3):1884-88). Recently, it has been observed that targeted deletion of MED12, CCNC or CDK8 in human CAR-T cells can increase cell proliferation, cytokine production and anti-tumor activity. In particular, MED12-deficient T cells show changes in genes that regulate effector T cell differentiation. See Freitas et al., Cancer Res (2022) 82 (12_suppl): 2822; and Freitas et al., Science (2022) 378 (6620): eabn5647. It is expected that reducing the level of MED12, MED13, CDK8 and / or CCNC can provide enhanced persistence for edited cells (such as NK cells), so that (when engineered according to the embodiments provided herein) the cytotoxicity to target tumor cells is enhanced.

[0277] In several embodiments, gene editing reduces the transcription of MED12 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount in between the recited values). In several embodiments, gene editing reduces the transcription of MED12 by at least about 30%; in several embodiments, gene editing reduces the transcription of MED12 by at least about 40%; in several embodiments, gene editing reduces the transcription of MED12 by at least about 50%; in several embodiments, gene editing reduces the transcription of MED12 by at least about 60%; in several embodiments, gene editing reduces the transcription of MED12 by at least about 70%; in several embodiments, gene editing reduces the transcription of MED12 by at least about 80%; in several embodiments, gene editing reduces the transcription of MED12 by at least about 90%.

[0278] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of MED12 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of MED12 by at least about 30%; in several embodiments, gene editing reduces the expression of MED12 by at least about 40%; in several embodiments, gene editing reduces the expression of MED12 by at least about 50%; in several embodiments, gene editing reduces the expression of MED12 by at least about 60%; in several embodiments, gene editing reduces the expression of MED12 by at least about 70%; in several embodiments, gene editing reduces the expression of MED12 by at least about 80%; and in several embodiments, gene editing reduces the expression of MED12 by at least about 90%.

[0279] In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to disrupt and / or knock out the expression of MED12 using one or more of the following MED12-specific guide RNAs: SEQ ID NOs: 938-948 (e.g., see Table E2). In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 938-948 is used to disrupt (e.g., reduce expression of) the MED12 gene. Non-limiting examples of guide RNAs that reduce and / or eliminate MED12 expression are shown in Table 1 below. Table 1: MED12 guide RNA SEQ ID NO: name sequence Target 938 MED12 gRNA1 TGCAATAATGCTGCTGAAGT Exon 3 939 MED12 gRNA2 AGTTATCCTTCTGGTTCACT Exon 3 940 MED12 gRNA3 GTCAGTGAACCAAGTGTTAA Exon 3 996 MED12 gRNA4 AGGATTGAAGCTGACGTTCT Exon 2 997 MED12 gRNA5 TAACTGCTCCCATAAGTACT Exon 5 998 MED12 gRNA6 GTGGGATTACACCGAGAAGC Exon 5

[0280] In several embodiments, gene editing reduces the transcription of MED13 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the recited values). In several embodiments, gene editing reduces the transcription of MED13 by at least about 30%; in several embodiments, gene editing reduces the transcription of MED13 by at least about 40%; in several embodiments, gene editing reduces the transcription of MED13 by at least about 50%; in several embodiments, gene editing reduces the transcription of MED13 by at least about 60%; in several embodiments, gene editing reduces the transcription of MED13 by at least about 70%; in several embodiments, gene editing reduces the transcription of MED13 by at least about 80%; in several embodiments, gene editing reduces the transcription of MED13 by at least about 90%.

[0281] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of MED13 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of MED13 by at least about 30%; in several embodiments, gene editing reduces the expression of MED13 by at least about 40%; in several embodiments, gene editing reduces the expression of MED13 by at least about 50%; in several embodiments, gene editing reduces the expression of MED13 by at least about 60%; in several embodiments, gene editing reduces the expression of MED13 by at least about 70%; in several embodiments, gene editing reduces the expression of MED13 by at least about 80%; and in several embodiments, gene editing reduces the expression of MED13 by at least about 90%.

[0282] In several embodiments, gene editing reduces the transcription of CDK8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of CDK8 by at least about 30%; in several embodiments, gene editing reduces the transcription of CDK8 by at least about 40%; in several embodiments, gene editing reduces the transcription of CDK8 by at least about 50%; in several embodiments, gene editing reduces the transcription of CDK8 by at least about 60%; in several embodiments, gene editing reduces the transcription of CDK8 by at least about 70%; in several embodiments, gene editing reduces the transcription of CDK8 by at least about 80%; in several embodiments, gene editing reduces the transcription of CDK8 by at least about 90%.

[0283] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CDK8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CDK8 by at least about 30%; in several embodiments, gene editing reduces the expression of CDK8 by at least about 40%; in several embodiments, gene editing reduces the expression of CDK8 by at least about 50%; in several embodiments, gene editing reduces the expression of CDK8 by at least about 60%; in several embodiments, gene editing reduces the expression of CDK8 by at least about 70%; in several embodiments, gene editing reduces the expression of CDK8 by at least about 80%; and in several embodiments, gene editing reduces the expression of CDK8 by at least about 90%.

[0284] In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to disrupt and / or knock out the expression of CDK8 using one or more of the following CDK8-specific guide RNAs: SEQ ID NOs: 949-955 (e.g., see Table E2). In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 949-955 is used to disrupt (e.g., reduce expression of) the CDK8 gene. Non-limiting examples of guide RNAs that reduce and / or eliminate CDK8 expression are shown in Table 2 below. Table 2: CDK8 guide RNA SEQ ID NO: name sequence Target 949 CDK8 gRNA1 AAGTGAAGCTGAGCAGCGAG Exon 1 950 CDK8 gRNA2 AGACGTGACCATAAGTGCCT Exon 1 951 CDK8 gRNA3 GCGCCGCCCAGCGCGGACAC Intron 1

[0285] In several embodiments, gene editing reduces the transcription of cyclin C (CCNC) by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount in between). In several embodiments, gene editing reduces the transcription of CCNC by at least about 30%; in several embodiments, gene editing reduces the transcription of CCNC by at least about 40%; in several embodiments, gene editing reduces the transcription of CCNC by at least about 50%; in several embodiments, gene editing reduces the transcription of CCNC by at least about 60%; in several embodiments, gene editing reduces the transcription of CCNC by at least about 70%; in several embodiments, gene editing reduces the transcription of CCNC by at least about 80%; in several embodiments, gene editing reduces the transcription of CCNC by at least about 90%.

[0286] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CCNC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CCNC by at least about 30%; in several embodiments, gene editing reduces the expression of CCNC by at least about 40%; in several embodiments, gene editing reduces the expression of CCNC by at least about 50%; in several embodiments, gene editing reduces the expression of CCNC by at least about 60%; in several embodiments, gene editing reduces the expression of CCNC by at least about 70%; in several embodiments, gene editing reduces the expression of CCNC by at least about 80%; and in several embodiments, gene editing reduces the expression of CCNC by at least about 90%.

[0287] In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to disrupt and / or knock out CCNC expression using one or more CCNC-specific guide RNAs: SEQ ID NOs: 956-962 (e.g., see Table E2). In several embodiments, a guide RNA (gRNA) comprising any of SEQ ID NOs: 956-962 is used to disrupt (e.g., reduce expression of) the CCNC gene. Non-limiting examples of guide RNAs that reduce and / or eliminate CCNC expression are shown in Table 3 below. Table 3: CCNC guide RNA SEQ ID NO: name sequence Target 956 CCNC gRNA1 ATTGGTTCAAATTGTATAGT Intron 2 957 CCNC gRNA2 AGAGAAACTTTAAATCCTTT Exon 2 958 CCNC gRNA3 TTCTAGTTTGCAATGGATTT Exon 2 999 CCNC gRNA4 TAGGCAAAGATCCGTTCTGT Exon 9 961 CCNC gRNA5 TCTGTTGAAGGAGCGCCAAA Exon 2 1000 CCNC gRNA6 ACCTTTGCTCCAGTATGTGC Exon 8 1001 CCNC gRNA7 ATACCTAAAGCTATCATGAA Exon 9

[0288] Two other transcription factors (which are known key regulatory factors for T cell exhaustion) are also expected to become ideal targets in NK cells to destroy or otherwise reduce NK cell exhaustion. DNA binding inhibitor 3 (ID3) is known to be highly expressed in progenitor NK cells, but expression is reduced in mature cells (Boos et al., J Exp Med (2007) 204 (5): 1119-30). Therefore, in several embodiments, knocking out ID3 causes NK cells to present a more mature phenotype and activity, and / or reduce exhaustion. Similarly, in several embodiments, reducing the expression of SOX4 by gene editing reduces NK cell exhaustion (Good et al., Cell 184 (25): P6081-6100).

[0289] In several embodiments, gene editing reduces the transcription of ID3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount in between the listed values). In several embodiments, gene editing reduces the transcription of ID3 by at least about 30%; in several embodiments, gene editing reduces the transcription of ID3 by at least about 40%; in several embodiments, gene editing reduces the transcription of ID3 by at least about 50%; in several embodiments, gene editing reduces the transcription of ID3 by at least about 60%; in several embodiments, gene editing reduces the transcription of ID3 by at least about 70%; in several embodiments, gene editing reduces the transcription of ID3 by at least about 80%; in several embodiments, gene editing reduces the transcription of ID3 by at least about 90%.

[0290] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of ID3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of ID3 by at least about 30%; in several embodiments, gene editing reduces the expression of ID3 by at least about 40%; in several embodiments, gene editing reduces the expression of ID3 by at least about 50%; in several embodiments, gene editing reduces the expression of ID3 by at least about 60%; in several embodiments, gene editing reduces the expression of ID3 by at least about 70%; in several embodiments, gene editing reduces the expression of ID3 by at least about 80%; and in several embodiments, gene editing reduces the expression of ID3 by at least about 90%.

[0291] In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to disrupt and / or knock out the expression of ID3 using one or more of the following ID3-specific guide RNAs: SEQ ID NOs: 963-969 (e.g., see Table E2). In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 963-969 is used to disrupt (e.g., reduce expression of) the ID3 gene. Non-limiting examples of guide RNAs that reduce and / or eliminate ID3 expression are shown in Table 4 below. Table 4: ID3 guide RNA SEQ ID NO: name sequence target 963 ID3 gRNA1 CTCCGGGTACCAGTTCCCGC Exon 1 964 ID3 gRNA2 CTCAGCGGCTCCTCAGCTGC Exon 1 965 ID3 gRNA3 CAGCATGAAGGCGCTGAGCC Exon 1 969 ID3 gRNA7 TGGCCAGACTGCGTTCCGAC Exon 1

[0292] In several embodiments, gene editing reduces the transcription of SOX4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between). In several embodiments, gene editing reduces the transcription of SOX4 by at least about 30%; in several embodiments, gene editing reduces the transcription of SOX4 by at least about 40%; in several embodiments, gene editing reduces the transcription of SOX4 by at least about 50%; in several embodiments, gene editing reduces the transcription of SOX4 by at least about 60%; in several embodiments, gene editing reduces the transcription of SOX4 by at least about 70%; in several embodiments, gene editing reduces the transcription of SOX4 by at least about 80%; in several embodiments, gene editing reduces the transcription of SOX4 by at least about 90%.

[0293] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of SOX4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of SOX4 by at least about 30%; in several embodiments, gene editing reduces the expression of SOX4 by at least about 40%; in several embodiments, gene editing reduces the expression of SOX4 by at least about 50%; in several embodiments, gene editing reduces the expression of SOX4 by at least about 60%; in several embodiments, gene editing reduces the expression of SOX4 by at least about 70%; in several embodiments, gene editing reduces the expression of SOX4 by at least about 80%; and in several embodiments, gene editing reduces the expression of SOX4 by at least about 90%.

[0294] In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to disrupt and / or knock out the expression of SOX4 using one or more of the following SOX4-specific guide RNAs: SEQ ID NOs: 970-976 (e.g., see Table E2). In several embodiments, a guide RNA (gRNA) comprising any one of SEQ ID NOs: 970-976 is used to disrupt (e.g., reduce expression of) the SOX4 gene. Non-limiting examples of guide RNAs that reduce and / or eliminate SOX4 expression are shown in Table 5 below. Table 5: SOX4 guide RNA SEQ ID NO: name sequence target 970 SOX4 gRNA1 TTCCGTGTTCTCGGCATTGT Exon 1 971 SOX4 gRNA2 GGCGATTCCCAGCTCGAGGC Exon 1 972 SOX4 gRNA4 GCTGGTGCAAGACCCCGAGT Exon 1

[0295] According to other embodiments, other regulatory factors of one or more aspects of NK cell (or T cell) function are regulated by gene editing. A variety of cytokines transmit negative (such as TGF-β mentioned above) or positive signals to immune cells. As a non-limiting example, IL-15 is a positive regulatory factor for NK cells, as disclosed herein, it can enhance one or more of NK cell homing, NK cell migration, NK cell expansion / proliferation, NK cell cytotoxicity and / or NK cell persistence. Under normal physiological conditions, in order to control NK cells, cytokine-induced SH2 domain-containing protein (CIS, encoded by CISH gene) acts as a key negative regulatory factor of IL-15 signal transduction in NK cells. As discussed herein, due to the multiple aspects of IL-15 biological characteristics affecting NK cell function, including but not limited to proliferation / amplification, activation, cytotoxicity, persistence, homing, migration, etc. Therefore, according to several embodiments, CISH is edited to enhance the function of NK cells in multiple functional aspects, thereby producing a more effective and lasting NK cell therapy. In several embodiments, CIS inhibitors are used in combination with the administration of engineered NK cells. In several embodiments, CIS expression is knocked down or eliminated by gene editing of the CISH gene (e.g., using CRISPR-Cas editing technology). In other embodiments, small interfering RNA, antisense RNA, TALEN, or zinc finger proteins are used. In some embodiments, CIS expression is knocked down in T cells by gene editing.

[0296] In several embodiments, as discussed above, the editing of CISH advantageously gives the edited cells (particularly edited NK cells) enhanced expansion capacity, cytotoxicity and / or persistence. In addition, in several embodiments, the modification of TCR includes modification of TCR α, but does not affect the signal transduction by the CD3 complex, thereby allowing T cell proliferation. In one embodiment, TCR α is inactivated by expressing pre-T α (pre-T α) in the cell, thereby restoring the functional CD3 complex in the absence of functional α / β TCR. As disclosed herein, non-allogeneic modified T cells are also engineered to express CAR to redirect the specificity of non-allogeneic reactive T cells to tumor markers, but are independent of MHC. In several embodiments, a combination of multiple editors is used, for example, as a non-limiting example, a combination of TCR and CISH knockout, or a combination of CISH knockout and CD47 knock-in. In some embodiments, a combination of CISH knockout and CDK8 knockout is used in combination. In some embodiments, a combination of CISH knockout and CCNC knockout is used in combination. In some embodiments, a combination of CISH knockout and MED12 knockout is used in combination. In some embodiments, a combination of CISH knockout and MED13 knockout is used in combination.

[0297] In several embodiments, CISH gene editing gives NK cells enhanced ability to home to target sites. In several embodiments, CISH gene editing gives NK cells enhanced migration ability, for example, in response to chemical attractants or away from repellents within the tissue for migration. In several embodiments, CISH gene editing gives NK cells enhanced ability to be activated, thereby exerting, for example, anti-tumor effects. In several embodiments, CISH gene editing gives NK cells enhanced proliferation ability, which, in several embodiments, makes it possible to generate a stable number of NK cells from a donor blood sample. In addition, in such embodiments, CISH is edited and engineered to express CAR NK cells in culture more easily, more firmly and more consistently amplified. In several embodiments, CISH gene editing gives NK cells enhanced cytotoxicity. In several embodiments, the editing of CISH synergistically enhances the cytotoxic effects of engineered NK cells and / or engineered T cells expressing CAR.

[0298] In several embodiments, CISH gene editing activates or inhibits multiple pathways. CIS protein is a negative regulator of IL-15 signaling, for example by inhibiting the JAK-STAT signaling pathway. These pathways typically result in the transcription of IL-15 response genes (including CISH). In several embodiments, knocking down CISH relieves the inhibition of JAK-STAT (such as JAK1-STAT5) signaling, thereby enhancing the transcription of IL-15 response genes. In several embodiments, knocking out CISH leads to enhanced signaling through the mammalian target of rapamycin (mTOR), while the expression of genes related to cell metabolism and respiration increases accordingly. In several embodiments, knocking out CISH leads to increased expression of IL-2Rα (CD25) induced by IL-15, but does not affect IL-15Rα or IL-2 / 15Rβ, enhances the binding of NK cell membranes to IL-15 and / or IL-2, increases the phosphorylation of STAT-3 and / or STAT-5, and increases the expression of anti-apoptotic proteins (such as Bcl-2). In several embodiments, knocking out CISH results in IL-15 induction of upregulation of selected genes associated with mitochondrial function (such as the electron transport chain and cellular respiration) and the cell cycle. Thus, in several embodiments, knocking out CISH by gene editing enhances the cytotoxicity and / or persistence of NK cells at least in part by metabolic reprogramming. In several embodiments, negative regulators of cellular metabolism (such as TXNIP) are downregulated due to CISH knockout. In several embodiments, after CISH knockout, promoters for cell survival and proliferation (including BIRC5 (survival protein), TOP2A, CKS2, and RACGAP1) are upregulated, while anti-proliferative or pro-apoptotic proteins (such as TGFB1, ATM, and PTCH1) are downregulated. In several embodiments, CISH knockout alters the signaling state (e.g., activates or inactivates signaling) by or through one or more of CXCL-10, IL-2, TNF, IFNγ, IL-13, IL-4, Jnk, PRF1, STAT5, PRKCQ, IL-2 receptor beta, SOCS2, MYD88, STAT3, STAT1, TBX21, LCK, JAK3, IL-8 receptor, ABL1, IL-9, STAT5A, STAT5B, Tcf7, PRDM1, and / or EOMES.

[0299] As a non-limiting example, TGF-β is a cytokine released by tumor cells that leads to immunosuppression within the tumor microenvironment. This immunosuppression reduces the ability of immune cells (or even engineered CAR immune cells in some cases) to destroy tumor cells, thereby allowing the tumor to progress. In several embodiments, as discussed in detail below, immune checkpoints are destroyed by gene editing. In several embodiments, blockers of immunosuppressive cytokines in the tumor microenvironment are used, including blocking their release or using competitive inhibitors to reduce the ability of signal molecules to bind and suppress immune cells. Such signal molecules include but are not limited to TGF-β, IL-10, arginase, inducible NOS, reactive-NOS, Arg1, indoleamine 2,3-dioxygenase (IDO) and PGE2. However, in other embodiments, immune cells (such as NK cells) are provided, wherein the responsiveness of NK cells (or other cells) to given immunosuppressive signal molecules is destroyed and / or eliminated. For example, in several embodiments, NK cells or T cells are gene edited to reduce their sensitivity to TGF-β. TGF-β is an inhibitor of NK cell function at least at the level of proliferation and cytotoxicity. Therefore, according to some embodiments, the expression of TGF-β receptor is knocked down or knocked out by gene editing, so that the edited NK cells are resistant to the immunosuppressive effects of TGF-β in the tumor microenvironment. In several embodiments, the TGFβ2 receptor is knocked down or knocked out by gene editing (for example, using CRISPR-Cas editing technology). In other embodiments, small interfering RNA, antisense RNA, TALEN or zinc finger protein are used. In some embodiments, other isoforms of TGF-β receptor (such as TGF-β1 and / or TGF-β3) are edited. In some embodiments, the TGF-β receptor in T cells is knocked down by gene editing.

[0300] Other cell engineering strategies are also provided herein to further enhance the persistence of allogeneic cell therapy products (such as allogeneic CAR-T cells and / or allogeneic CAR-NK cells). In several embodiments, provided herein are genetically engineered immune cell populations for cancer immunotherapy, wherein genetically engineered immune cells are genetically modified (such as gene editing) at one, two, three or more loci to enhance the cytotoxic activity, persistence or other properties of cells (such as NK cells and / or T cells).

[0301] As discussed herein, there are various strategies that can be used to reduce the propensity of allogeneic cell therapy products to induce host cell-mediated graft rejection. For example, in several embodiments, to reduce host-mediated graft rejection, the expression of B2M is reduced and / or eliminated. In several embodiments, one or more of the following B2M-specific guide RNAs are used to disrupt and / or knock out the expression of B2M using a CRISPR-Cas mediated approach (such as Cas9) or other guide nucleases disclosed elsewhere herein: SEQ ID 199-CGCGAGCACAGCTAAGGCCA; SEQ ID 200-GAGTAGCGCGAGCACAGCTA; SEQ ID 201-GCTACTCTCTCTTTCTGGCC; SEQ ID 202-GGCCGAGATGTCTCGCTCCG; SEQ ID 203-GGCCACGGAGCGAGACATCT; SEQ ID 204-CACAGCCCAAGATAGTTAAG; SEQ ID 205-AGTCACATGGTTCACACGGC; SEQ ID 206-AAGTCAACTTCAATGTCGGA; SEQ ID 207-ACTTGTCTTTCAGCAAGGAC; and SEQ ID 208-TGGGCTGTGACAAAGTCACA.

[0302] In several embodiments, gene editing reduces the transcription of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of B2M by at least about 30%; in several embodiments, gene editing reduces the transcription of B2M by at least about 40%; in several embodiments, gene editing reduces the transcription of B2M by at least about 50%; in several embodiments, gene editing reduces the transcription of B2M by at least about 60%; in several embodiments, gene editing reduces the transcription of B2M by at least about 70%; in several embodiments, gene editing reduces the transcription of B2M by at least about 80%; in several embodiments, gene editing reduces the transcription of B2M by at least about 90%.

[0303] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of B2M by at least about 30%; in several embodiments, gene editing reduces the expression of B2M by at least about 40%; in several embodiments, gene editing reduces the expression of B2M by at least about 50%; in several embodiments, gene editing reduces the expression of B2M by at least about 60%; in several embodiments, gene editing reduces the expression of B2M by at least about 70%; in several embodiments, gene editing reduces the expression of B2M by at least about 80%; and in several embodiments, gene editing reduces the expression of B2M by at least about 90%.

[0304] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types described herein, the expression of ADORA2A (adenosine 2a receptor) is reduced and / or eliminated. In several embodiments, ADORA2A is destroyed and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to guide nucleases using one or more of the following ADORA2A-specific guide RNAs (SEQ ID NO: 404-407) to destroy and / or knock out ADORA2A. In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). Loss of ADORA2A expression induces decreased sensitivity to adenosine, a recognized immunosuppressant for T cells and NK cells (Young et al., Cancer Res. (2018) 78(4):1003-16; Cekic and Linden, Cancer Res. (2014) 74(24):7239-49). In NK cells, loss of ADORA2A leads to loss of maturation, proliferation, and effector function (as shown in constitutive knockout mice). In T cells, loss of ADORA2A leads to loss of CD8 downstream activation and function, increase in Treg and TH2, and loss of TH1. Therefore, according to various embodiments, gene editing of ADORA2A can increase the cytotoxicity, persistence, immune evasion ability, or otherwise enhance the efficacy of engineered NK cells, T cells, or other cells as disclosed herein.

[0305] In several embodiments, gene editing reduces the transcription of ADORA2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the recited values). In several embodiments, gene editing reduces the transcription of ADORA2A by at least about 30%; in several embodiments, gene editing reduces the transcription of ADORA2A by at least about 40%; in several embodiments, gene editing reduces the transcription of ADORA2A by at least about 50%; in several embodiments, gene editing reduces the transcription of ADORA2A by at least about 60%; in several embodiments, gene editing reduces the transcription of ADORA2A by at least about 70%; in several embodiments, gene editing reduces the transcription of ADORA2A by at least about 80%; in several embodiments, gene editing reduces the transcription of ADORA2A by at least about 90%.

[0306] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of ADORA2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of ADORA2A by at least about 30%; in several embodiments, gene editing reduces the expression of ADORA2A by at least about 40%; in several embodiments, gene editing reduces the expression of ADORA2A by at least about 50%; in several embodiments, gene editing reduces the expression of ADORA2A by at least about 60%; in several embodiments, gene editing reduces the expression of ADORA2A by at least about 70%; in several embodiments, gene editing reduces the expression of ADORA2A by at least about 80%; and in several embodiments, gene editing reduces the expression of ADORA2A by at least about 90%.

[0307] As its name implies, the tumor microenvironment (TME) is the environment surrounding the tumor, including the surrounding blood vessels and capillaries, immune cells circulating or resident in the area, fibroblasts, tumor cells, various signaling molecules released by immune cells or other cells in the area, and the surrounding extracellular matrix. Tumors use various mechanisms to evade detection and / or destruction by host immune cells, including changes to the tumor microenvironment. Tumors can modify the tumor microenvironment by releasing extracellular signals, promoting tumor angiogenesis, and even inducing immune tolerance, in part by restricting the entry of immune cells into the tumor microenvironment and / or restricting the proliferation / expansion of immune cells in the tumor microenvironment. Tumors can also modify the extracellular matrix (ECM), which can create pathways for tumor extravasation to new sites. Transforming growth factor-β (TGF-β) has beneficial effects in reducing inflammation and preventing autoimmunity. However, it can also inhibit antitumor immune responses, and therefore, upregulated expression of TGFb has been associated with tumor progression and metastasis (Pickup et al., Nat. Rev. Cancer (2013) 13(11):788-99). For example, TGF-β signaling can inhibit the cytotoxic function of NK cells by interacting with TGF-β receptors expressed by NK cells, such as TGF-β receptor isoform II (TGFBR2). According to multiple embodiments disclosed herein, reducing or eliminating the expression of TGFBR2 by gene editing (e.g., CRISPR / Cas9 guided by TGFBR2 guide RNA) blocks the inhibitory effect of TGF-β on NK cells.

[0308] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types disclosed herein, the expression of TGFBR2 is reduced and / or eliminated. In several embodiments, one or more gene editing methods disclosed herein are used to destroy and / or knock out TGFBR2. Table 6 below provides non-limiting examples of guide RNAs for reducing and / or eliminating TGFBR2 expression. Table 6: TGFβ receptor type 2 isoform guide RNAs SEQ ID NO: name sequence target 147 TGFBR2-1 CCCCTACCATGACTTTATTC Exon 4 148 TGFBR2-2 ATTGCACTCATCAGAGCTAC Exon 4 149 TGFBR2-3 AGTCATGGTAGGGGAGCTTG Exon 4 150 TGFBR2-4 TGCTGGCGATACGCGTCCAC Exon 1 151 TGFBR2-5 GTGAGCAATCCCCCGGGCGA Exon 4 152 TGFBR2-6 AACGTGCGGTGGGATCGTGC Exon 1

[0309] In several embodiments, TGFBR2 is disrupted and / or knocked out using a CRISPR-Cas mediated approach (such as Cas9) or other guide nucleases disclosed elsewhere herein, using one or more of the following TGFBR2-specific guide RNA-guided nucleases: sequences of SEQ ID NOs: 445-448.

[0310] In several embodiments, gene editing reduces transcription of TGFBR2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between the recited values). In several embodiments, gene editing reduces transcription of TGFBR2 by at least about 30%; in several embodiments, gene editing reduces transcription of TGFBR2 by at least about 40%; in several embodiments, gene editing reduces transcription of TGFBR2 by at least about 50%; in several embodiments, gene editing reduces transcription of TGFBR2 by at least about 60%; in several embodiments, gene editing reduces transcription of TGFBR2 by at least about 70%; in several embodiments, gene editing reduces transcription of TGFBR2 by at least about 80%; in several embodiments, gene editing reduces transcription of TGFBR2 by at least about 90%.

[0311] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TGFBR2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TGFBR2 by at least about 30%; in several embodiments, gene editing reduces the expression of TGFBR2 by at least about 40%; in several embodiments, gene editing reduces the expression of TGFBR2 by at least about 50%; in several embodiments, gene editing reduces the expression of TGFBR2 by at least about 60%; in several embodiments, gene editing reduces the expression of TGFBR2 by at least about 70%; in several embodiments, gene editing reduces the expression of TGFBR2 by at least about 80%; and in several embodiments, gene editing reduces the expression of TGFBR2 by at least about 90%.

[0312] In NK cells, TGFBR2 is a key checkpoint in NK cell-mediated tumor immunity, and for T cells, knocking out TGFBR2 can rescue CAR-T cell exhaustion induced by TGF-β1 (Tang et al., JCI Insight (2020) 5(4):e133977). Therefore, according to various embodiments, gene editing of TGFBR2 increases the cytotoxicity, persistence, or otherwise enhances the efficacy of engineered NK cells, T cells, or other cells disclosed herein.

[0313] According to additional embodiments, the expression of receptors, signaling pathways or proteins on immune cells is destroyed or eliminated, which can lead to enhanced activity of immune cells against target cancer cells (such as cytotoxicity, persistence, etc.). In several embodiments, this is because the inhibitory effect of immune cells is lifted. Natural killer cells express a variety of receptors, especially those in the natural killer cell family 2 receptor. According to multiple embodiments disclosed herein, one such receptor (NKG2D receptor) is used to generate a cytotoxic signaling construct expressed by NK cells, thereby enhancing the anti-cancer activity of such NK cells. In addition, NK cells express NKG2A receptors, which are inhibitory receptors. One mechanism by which tumors become resistant to immune cells is through the expression of class I histocompatibility complex molecules (HLA-E) loaded with peptides, which inhibit the activity of NK cells through the connection of HLA-E to NKG2A receptors. Therefore, although one method may be to block the interaction of HLA-E with the NKG2A receptor expressed on NK cells, according to multiple embodiments disclosed herein, the expression of NKG2A is destroyed, which short-circuits this inhibitory pathway, thereby enhancing the cytotoxicity of NK cells.

[0314] Table 7 below provides non-limiting examples of guide RNAs for reducing and / or eliminating NKG2A expression. Table 7: NKG2A guide RNA SEQ ID NO: name sequence target 158 NKG2A-1 GGAGCTGATGGTAAATCTGC Exon 4 159 NKG2A-2 TTGAAGGTTTAATTCCGCAT Exon 3 160 NKG2A-3 AACAACTATCGTTACCACAG Exon 4

[0315] In several embodiments, NKG2A is disrupted and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein using one or more of the following NKG2A-specific guide RNA-guided nucleases: sequences of SEQ ID NOs: 450-452.

[0316] In several embodiments, gene editing reduces the transcription of NKG2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of NKG2A by at least about 30%. In several embodiments, gene editing reduces the transcription of NKG2A by at least about 40%. In several embodiments, gene editing reduces the transcription of NKG2A by at least about 50%. In several embodiments, gene editing reduces the transcription of NKG2A by at least about 60%. In several embodiments, gene editing reduces the transcription of NKG2A by at least about 70%. In several embodiments, gene editing reduces the transcription of NKG2A by at least about 80%. In several embodiments, gene editing reduces the transcription of NKG2A by at least about 90%.

[0317] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of NKG2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of NKG2A by at least about 30%. In several embodiments, gene editing reduces the expression of NKG2A by at least about 40%. In several embodiments, gene editing reduces the expression of NKG2A by at least about 50%. In several embodiments, gene editing reduces NKG2A expression by at least about 60%. In several embodiments, gene editing reduces NKG2A expression by at least about 70%. In several embodiments, gene editing reduces NKG2A expression by at least about 80%. In several embodiments, gene editing reduces NKG2A expression by at least about 90%.

[0318] NKG2A binds to HLA-E and is considered a receptor that recognizes MHC. Since NKG2A is an inhibitory receptor, the loss of NKG2A expression induces increased activation of constitutive cells. In NK cells and T cells, the loss of NKG2A leads to increased activation and cytotoxicity against tumor cells expressing HLA-E (Kamiya et al., J. Clin. Invest. (2019) 129 (5): 2094-2106). Therefore, according to various embodiments, gene editing of NKG2A increases the cytotoxicity and persistence of engineered NK cells, T cells, or other cells disclosed herein, or otherwise enhances their efficacy.

[0319] Interleukins, especially interleukin-15, are important in the function and survival of NK cells. Suppressor of cytokine signaling (SOCS) is a negative regulator of NK cell cytokine release. Protein tyrosine phosphatase CD45 is an important regulator of NK cell activity through Src family kinase activity. CD45 expression is involved in immunoreceptor tyrosine activation motif (ITAM)-specific NK cell function and degranulation, cytokine production and amplification processes (Hesslein et al., Blood (2011) 117 (11): 3087-95). Therefore, knocking out the expression of CD45 should lead to weakened NK cell function. As described above, CRISPR / Cas9 is used to destroy the expression of CD45 (encoded by PTPRC) and SOCS2, but in other embodiments, other gene editing methods may also be used. Non-limiting examples of guide RNAs targeting CD45 and SOCS2 are shown in Table 8 below. Table 8: CD45 and SOCS2 guide RNAs SEQ ID NO: name sequence target 170 PTPRC-1 AGTGCTGGTGTTGGGCGCAC Exon 25 171 SOCS2-1 GTGAACAGTGCCGTTCCGGGGGG Exon 3 1002 SOCS2-4 GTGAACAGTGCCGTTCCGGG Exon 3 172 SOCS2-2 GGCACCGGTACATTTGTTAATGG Exon 3 1003 SOCS2-5 GGCACCGGTACATTTGTTAA Exon 3 173 SOCS2-3 TTCGCCAGACGCGCCGCCTGCGG Exon 2 1004 SOCS2-6 TTCGCCAGACGCGCCGCCTG Exon 2

[0320] In several embodiments, gene editing reduces the transcription of PTPRC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of PTPRC by at least about 30%. In several embodiments, gene editing reduces the transcription of PTPRC by at least about 40%. In several embodiments, gene editing reduces the transcription of PTPRC by at least about 50%. In several embodiments, gene editing reduces the transcription of PTPRC by at least about 60%. In several embodiments, gene editing reduces the transcription of PTPRC by at least about 70%. In several embodiments, gene editing reduces the transcription of PTPRC by at least about 80%. In several embodiments, gene editing reduces the transcription of PTPRC by at least about 90%.

[0321] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CD45 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CD45 by at least about 30%. In several embodiments, gene editing reduces the expression of CD45 by at least about 40%. In several embodiments, gene editing reduces the expression of CD45 by at least about 50%. In several embodiments, gene editing reduces CD45 expression by at least about 60%. In several embodiments, gene editing reduces CD45 expression by at least about 70%. In several embodiments, gene editing reduces CD45 expression by at least about 80%. In several embodiments, gene editing reduces CD45 expression by at least about 90%.

[0322] In several embodiments, SOCS2 is disrupted and / or knocked out using a CRISPR-Cas mediated approach (such as Cas9) or other guide nucleases disclosed elsewhere herein, using one or more of the following SOCS2-specific guide RNA-guided nucleases: sequences of SEQ ID NOs: 457-462.

[0323] In several embodiments, gene editing reduces the transcription of SOCS2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 30%. In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 40%. In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 50%. In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 60%. In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 70%. In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 80%. In several embodiments, gene editing reduces the transcription of SOCS2 by at least about 90%.

[0324] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of SOCS2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of SOCS2 by at least about 30%. In several embodiments, gene editing reduces the expression of SOCS2 by at least about 40%. In several embodiments, gene editing reduces the expression of SOCS2 by at least about 50%. In several embodiments, gene editing reduces SOCS2 expression by at least about 60%. In several embodiments, gene editing reduces SOCS2 expression by at least about 70%. In several embodiments, gene editing reduces SOCS2 expression by at least about 80%. In several embodiments, gene editing reduces SOCS2 expression by at least about 90%.

[0325] SOCS proteins are negative regulators of cytokine responses, and SOCS2 specifically negatively regulates the development of NK cells by inhibiting JAK2 activity. Loss of SOCS2 expression in NK cells induces increased NK cell development and enhanced overall cytotoxicity (Kim et al., Scientific Reports (2017) 7: 461-53). Therefore, according to various embodiments, gene editing of SOCS2 can increase the cytotoxicity and persistence of engineered NK cells, T cells, or other cells described herein, or otherwise enhance their efficacy.

[0326] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types disclosed herein, the expression of Casitas B lineage lymphoma-b (Cbl-b) is reduced and / or eliminated. In several embodiments, one or more gene editing methods disclosed herein are used to destroy and / or knock out Cbl-b. In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to destroy and / or knock out Cbl-b. Non-limiting examples of guide RNAs targeting CBLB for reducing and / or eliminating CBLB expression are shown in Table 9 below. Table 9: CBLB guide RNA SEQ ID NO: name sequence target 164 CBLB-1 TAATCTGGTGGACCTCATGAAGG Exon 5 1005 CBLB-8 TAATCTGGTGGACCTCATGA Exon 5 165 CBLB-2 TCGGTTGGCAAACGTCCGAAAGG Exon 10 1006 CBLB-9 TCGGTTGGCAAACGTCCGAA Exon 10 166 CBLB-3 AGCAAGCTGCCGCAGATCGCAGG Exon 2 1007 CBLB-10 AGCAAGCTGCCGCAGATCGC Exon 2 935 CBLB-4 AAGACTCTTTAAAGAAGGCA Exon 3 936 CBLB-5 AGTACTCATTCTCACTGAGT Exon 3 937 CBLB-6 CGTAAATGCTGATATGTATC Exon 3 1008 CBLB-7 TAATCTGGTGGACCTCATGA Exon 5

[0327] In several embodiments, Cbl-b is disrupted and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein using one or more of the following CBLB-specific guide RNAs: SEQ ID NOs: 453-456.

[0328] In several embodiments, gene editing reduces the transcription of CBLB by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of CBLB by at least about 30%. In several embodiments, gene editing reduces the transcription of CBLB by at least about 40%. In several embodiments, gene editing reduces the transcription of CBLB by at least about 50%. In several embodiments, gene editing reduces the transcription of CBLB by at least about 60%. In several embodiments, gene editing reduces the transcription of CBLB by at least about 70%. In several embodiments, gene editing reduces the transcription of CBLB by at least about 80%. In several embodiments, gene editing reduces the transcription of CBLB by at least about 90%.

[0329] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of Cbl-b by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of Cbl-b by at least about 30%. In several embodiments, gene editing reduces the expression of Cbl-b by at least about 40%. In several embodiments, gene editing reduces the expression of Cbl-b by at least about 50%. In several embodiments, gene editing reduces the expression of Cbl-b by at least about 60%. In several embodiments, gene editing reduces the expression of Cbl-b by at least about 70%. In several embodiments, gene editing reduces the expression of Cbl-b by at least about 80%. In several embodiments, gene editing reduces the expression of Cbl-b by at least about 90%.

[0330] Cbl-b is an E3 ubiquitin ligase that negatively regulates T cell activation. Loss of Cbl-b expression in NK cells and T cells has been shown to enhance anti-tumor immunity. In addition, Cbl-b-deficient T cells and NK cells are resistant to PD-L1 / PD-1-mediated inhibition (Fujiwara et al., Front. Immunol. (2017) 8:42). Therefore, according to various embodiments, Cbl-b is genetically edited to increase the cytotoxicity and persistence of engineered NK cells, T cells, or other cells as disclosed herein, or to otherwise enhance their efficacy.

[0331] Another E3 ubiquitin ligase (triplet motif-containing protein 29 (TRIM29)) is a negative regulator of NK cell function (Dou et al., J. Immunol. (2019) 203 (4): 873-80). Resting NK cells do not usually express TRIM29, but are easily upregulated after activation (especially by IL-12 / IL-18 stimulation). Non-limiting examples of guide RNAs targeting TRIM29 for reducing and / or eliminating TRIM29 expression are shown in Table 10 below. Table 10: TRIM29 guide RNA SEQ ID NO: name sequence Target 167 TRIM29-1 GAACGGTAGGTCCCCTCTCGTGG Exon 4 1009 TRIM29-4 GAACGGTAGGTCCCCTCTCG Exon 4 168 TRIM29-2 AGCTGCCTTGGACGACGGGCAGG Exon 7 1010 TRIM29-5 AGCTGCCTTGGACGACGGGC Exon 7 169 TRIM29-3 TGAGCCGTAACTTCATTGAGAGG Exon 4 1011 TRIM29-6 TGAGCCGTAACTTCATTGAG Exon 4

[0332] In several embodiments, gene editing reduces the transcription of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 30%. In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 40%. In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 50%. In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 60%. In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 70%. In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 80%. In several embodiments, gene editing reduces the transcription of TRIM29 by at least about 90%.

[0333] In several embodiments, gene editing can reduce the expression of a target protein (e.g., TRIM29) by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TRIM29 by at least about 30%. In several embodiments, gene editing reduces the expression of TRIM29 by at least about 40%. In several embodiments, gene editing reduces the expression of TRIM29 by at least about 50%. In several embodiments, gene editing reduces the expression of TRIM29 by at least about 60%. In several embodiments, gene editing reduces the expression of TRIM29 by at least about 70%. In several embodiments, gene editing reduces the expression of TRIM29 by at least about 80%. In several embodiments, gene editing reduces the expression of TRIM29 by at least about 90%.

[0334] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types described herein, the expression of beta-2 microglobulin (B2-microglobulin) is reduced and / or eliminated. In several embodiments, one or more gene editing methods disclosed herein are used to disrupt and / or knock out B2-microglobulin. In several embodiments, Crispr-Cas mediated methods (e.g., Cas9) or other guide nucleases disclosed elsewhere herein are used to disrupt and / or knock out B2-microglobulin by utilizing one or more of the following B2-microglobulin-specific guide RNA-guided nucleases: SEQ ID NOs: 199-208.

[0335] In several embodiments, gene editing reduces the transcription of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of B2M by at least about 30%. In several embodiments, gene editing reduces the transcription of B2M by at least about 40%. In several embodiments, gene editing reduces the transcription of B2M by at least about 50%. In several embodiments, gene editing reduces the transcription of B2M by at least about 60%. In several embodiments, gene editing reduces the transcription of B2M by at least about 70%. In several embodiments, gene editing reduces the transcription of B2M by at least about 80%. In several embodiments, gene editing reduces the transcription of B2M by at least about 90%.

[0336] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of B2M by at least about 30%. In several embodiments, gene editing reduces the expression of B2M by at least about 40%. In several embodiments, gene editing reduces the expression of B2M by at least about 50%. In several embodiments, gene editing reduces B2M expression by at least about 60%. In several embodiments, gene editing reduces B2M expression by at least about 70%. In several embodiments, gene editing reduces B2M expression by at least about 80%. In several embodiments, gene editing reduces B2M expression by at least about 90%.

[0337] Loss of B2-microglobulin expression leads to a substantial reduction in the levels of MHC class I molecules, and in NK cells and T cells, the reduction of B2-microglobulin can modulate overall cellular recognition of autologous and allogeneic cells. Thus, according to several embodiments, genetic editing of B2-microglobulin enhances the cytotoxicity, persistence, and / or otherwise enhances the efficacy of the engineered NK cells, T cells, or other cells disclosed herein.

[0338] In several embodiments, in order to enhance the overall activation of the resulting T cells and / or NK cells or other cell types described herein, the expression of T cell immune receptor (TIGIT) with Ig and ITIM domains is reduced and / or eliminated. In several embodiments, one or more gene editing methods disclosed herein are used to destroy and / or knock out TIGIT. In several embodiments, Crispr-Cas mediated methods (e.g., Cas9) or other guide nucleases disclosed elsewhere herein are used to destroy and / or knock out TIGIT by utilizing one or more of the following TIGIT-specific guide RNA-guided nucleases: SEQ ID NO: 408-411.

[0339] In several embodiments, gene editing reduces the transcription of TIGIT by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of TIGIT by at least about 30%. In several embodiments, gene editing reduces the transcription of TIGIT by at least about 40%. In several embodiments, gene editing reduces the transcription of TIGIT by at least about 50%. In several embodiments, gene editing reduces the transcription of TIGIT by at least about 60%. In several embodiments, gene editing reduces the transcription of TIGIT by at least about 70%. In several embodiments, gene editing reduces the transcription of TIGIT by at least about 80%. In several embodiments, gene editing reduces the transcription of TIGIT by at least about 90%.

[0340] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TIGIT by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TIGIT by at least about 30%. In several embodiments, gene editing reduces the expression of TIGIT by at least about 40%. In several embodiments, gene editing reduces the expression of TIGIT by at least about 50%. In several embodiments, gene editing reduces the expression of TIGIT by at least about 60%. In several embodiments, gene editing reduces the expression of TIGIT by at least about 70%. In several embodiments, gene editing reduces the expression of TIGIT by at least about 80%. In several embodiments, gene editing reduces the expression of TIGIT by at least about 90%.

[0341] TIGIT is a checkpoint receptor associated with T cell and NK cell exhaustion. Loss of TIGIT expression in NK cells prevents NK cell exhaustion and promotes NK cell-dependent tumor immunity (Zhang et al., Nat. Immunol. (2018) 19(7): 723-32). Loss of TIGIT expression in T cells similarly leads to downstream activation of the resulting T cells. Therefore, according to multiple embodiments, gene editing of TIGIT increases the cytotoxicity, persistence, or otherwise enhances the efficacy of engineered NK cells, T cells, or other cells described herein.

[0342] In several embodiments, to enhance the overall activation of obtained T cells and / or NK cells or other cell types disclosed herein, the expression of programmed cell death protein -1 (PD-1, encoded by PDCD1) is reduced and / or eliminated. In several embodiments, PD-1 is destroyed and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, PD-1 is destroyed and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein, by utilizing the following one or more PD-1 specific guide RNA-guided nucleases to destroy and / or knock out PD-1: SEQ ID NO: 412-415.

[0343] In several embodiments, gene editing reduces the transcription of PDCD1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 30%. In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 40%. In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 50%. In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 60%. In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 70%. In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 80%. In several embodiments, gene editing reduces the transcription of PDCD1 by at least about 90%.

[0344] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of PD-1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of PD-1 by at least about 30%. In several embodiments, gene editing reduces the expression of PD-1 by at least about 40%. In several embodiments, gene editing reduces the expression of PD-1 by at least about 50%. In several embodiments, gene editing reduces PD-1 expression by at least about 60%. In several embodiments, gene editing reduces PD-1 expression by at least about 70%. In several embodiments, gene editing reduces PD-1 expression by at least about 80%. In several embodiments, gene editing reduces PD-1 expression by at least about 90%.

[0345] PD-1 plays an inhibitory role in immune regulation and downregulates overall function by suppressing immune cell activity. The loss of PD-1 expression in NK cells increases overall cytotoxicity due to increased secretion of interferon-γ, granzyme B, and perforin (Niu et al., Int. J. Med. Sci. (2020) 17 (13): 1964-73). Similarly, T cells with lost PD-1 expression show increased cytotoxicity and increased overall activation of caspase (caspase) (Zhao et al., Ocotarget (2018) 9 (4): 5208-15). Therefore, according to multiple embodiments, PD-1 is genetically edited to increase the cytotoxicity, persistence, or otherwise enhance the efficacy of engineered NK cells, T cells, or other cells disclosed herein.

[0346] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types disclosed herein, the expression of T cell immunoglobulin and mucin domain-3 (TIM-3, also known as HAVCR2) is reduced and / or eliminated. In several embodiments, TIM-3 is destroyed and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, TIM-3 is destroyed and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein by utilizing one or more TIM-3 specific guide RNA-guided nucleases: SEQ ID NOs: 416-419.

[0347] In several embodiments, gene editing reduces the transcription of TIM3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of TIM3 by at least about 30%. In several embodiments, gene editing reduces the transcription of TIM3 by at least about 40%. In several embodiments, gene editing reduces the transcription of TIM3 by at least about 50%. In several embodiments, gene editing reduces the transcription of TIM3 by at least about 60%. In several embodiments, gene editing reduces the transcription of TIM3 by at least about 70%. In several embodiments, gene editing reduces the transcription of TIM3 by at least about 80%. In several embodiments, gene editing reduces the transcription of TIM3 by at least about 90%.

[0348] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TIM-3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TIM-3 by at least about 30%. In several embodiments, gene editing reduces the expression of TIM-3 by at least about 40%. In several embodiments, gene editing reduces the expression of TIM-3 by at least about 50%. In several embodiments, gene editing reduces TIM-3 expression by at least about 60%. In several embodiments, gene editing reduces TIM-3 expression by at least about 70%. In several embodiments, gene editing reduces TIM-3 expression by at least about 80%. In several embodiments, gene editing reduces TIM-3 expression by at least about 90%.

[0349] TIM-3 is an inhibitory receptor involved in immune checkpoint function. Loss of TIM-3 expression increases the overall cytotoxicity of engineered NK cells and T cells and reduces the exhaustion of NK cells and T cells, thereby improving the effector function of component cells lacking TIM-3 expression (Pires de Silva et al., Cancer Imunol. Res. (2014) 2 (5): 410-22). Therefore, according to multiple embodiments, TIM-3 is genetically edited to increase the cytotoxicity, persistence, immune evasion ability of engineered NK cells, T cells, or other cells disclosed herein, or to otherwise enhance their efficacy.

[0350] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types disclosed herein, the expression of CD38 is reduced and / or eliminated. In several embodiments, CD38 is destroyed and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, CD38 is destroyed and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein by utilizing one or more of the following CD38-specific guide RNAs to guide nucleases: SEQ ID NOs: 420-423.

[0351] In several embodiments, gene editing reduces the transcription of CD38 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of CD38 by at least about 30%. In several embodiments, gene editing reduces the transcription of CD38 by at least about 40%. In several embodiments, gene editing reduces the transcription of CD38 by at least about 50%. In several embodiments, gene editing reduces the transcription of CD38 by at least about 60%. In several embodiments, gene editing reduces the transcription of CD38 by at least about 70%. In several embodiments, gene editing reduces the transcription of CD38 by at least about 80%. In several embodiments, gene editing reduces the transcription of CD38 by at least about 90%.

[0352] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CD38 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CD38 by at least about 30%. In several embodiments, gene editing reduces the expression of CD38 by at least about 40%. In several embodiments, gene editing reduces the expression of CD38 by at least about 50%. In several embodiments, gene editing reduces CD38 expression by at least about 60%. In several embodiments, gene editing reduces CD38 expression by at least about 70%. In several embodiments, gene editing reduces CD38 expression by at least about 80%. In several embodiments, gene editing reduces CD38 expression by at least about 90%.

[0353] CD38 plays a role in the maturation cycle of immune cells, and blood cancers often show upregulation of CD38. The loss of CD38 expression on constitutive NK cells can achieve stronger cytotoxicity due to reduced fratricide (Nagai et al., Blood (2019) 134 (suppl. 1): 870). Wild-type NK cells themselves express CD38, which leads to downstream self-targeting effects in wild-type NK cells. For T cells, the loss of constitutive T cell CD38 expression leads to increased cytotoxicity. Therefore, according to multiple embodiments, gene editing of CD38 increases the cytotoxicity, persistence, or otherwise enhances the efficacy of the engineered NK cells, T cells, or other cells disclosed herein.

[0354] In several embodiments, to enhance the overall activation of the obtained T cells and / or NK cells or other cell types provided herein, the expression of T cell receptor alpha (TCR alpha) is reduced and / or eliminated. In several embodiments, one or more gene editing methods disclosed herein are used to destroy and / or knock out TCR alpha. In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to destroy and / or knock out TCR alpha by utilizing the following one or more TCR alpha specific guide RNA-guided nucleases: SEQ ID NO: 467-470.

[0355] In several embodiments, gene editing reduces the transcription of TRAC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of TRAC by at least about 30%. In several embodiments, gene editing reduces the transcription of TRAC by at least about 40%. In several embodiments, gene editing reduces the transcription of TRAC by at least about 50%. In several embodiments, gene editing reduces the transcription of TRAC by at least about 60%. In several embodiments, gene editing reduces the transcription of TRAC by at least about 70%. In several embodiments, gene editing reduces the transcription of TRAC by at least about 80%. In several embodiments, gene editing reduces the transcription of TRAC by at least about 90%.

[0356] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TRAC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of TRAC by at least about 30%. In several embodiments, gene editing reduces the expression of TRAC by at least about 40%. In several embodiments, gene editing reduces the expression of TRAC by at least about 50%. In several embodiments, gene editing reduces the expression of TRAC by at least about 60%. In several embodiments, gene editing reduces the expression of TRAC by at least about 70%. In several embodiments, gene editing reduces the expression of TRAC by at least about 80%. In several embodiments, gene editing reduces the expression of TRAC by at least about 90%.

[0357] The T cell receptor (TCR) is a protein complex on T cells that is responsible for recognizing major histocompatibility complex (MHC) molecules. The loss of certain TCRs and the preferential expression of other TCRs can lead to increased cytotoxicity of engineered cells due to enhanced selective targeting and recognition of the constituent cells. Therefore, according to various embodiments, gene editing of TCRs can increase the cytotoxicity, persistence, or otherwise enhance the efficacy of engineered NK cells, T cells, or other cells as disclosed herein.

[0358] Cytokine-induced SH2 domain protein (CIS) is a negative regulator of the IL-15 signaling pathway in natural killer (NK) cells and is encoded by the CISH gene in humans. The IL-15 signaling pathway has a positive effect on the amplification, survival, cytotoxicity and cytokine production of NK cells. Therefore, the destruction of CISH can make NK cells more sensitive to IL-15, thereby enhancing their anti-tumor effects. In several embodiments, to enhance the overall activation of the obtained T cells and / or NK cells or other cell types provided herein, the expression of CISH is reduced and / or eliminated. In the experiments described herein, it was observed that although the destruction (such as knocking out) MED12 can increase the cytotoxicity of NK cells, it also tends to reduce the proliferation capacity of such cells. However, it was surprisingly found that the effect of MED12 destruction on proliferation can be rescued by destroying (such as knocking out) CISH. Therefore, in some aspects, it is encompassed that MED12 and CISH are knocked out simultaneously in immune cells (such as NK cells). In some embodiments, gene editing is performed on a target sequence in the MED12 gene and a target sequence in the CISH gene of an immune cell, wherein the editing results in reduced expression and / or function of CIS and MED12 proteins encoded by the CISH and MED12 genes, respectively, compared to immune cells in which the target sequences have not been edited.

[0359] In several embodiments, one or more gene editing methods disclosed herein are used to disrupt and / or knock out CISH. Non-limiting examples of guide RNAs targeting CISH for reducing and / or eliminating expression of CIS (a protein encoded by CISH) are shown in Table 11 below. Table 11: CISH guide RNA SEQ ID NO: name sequence Target 153 CISH-1 CTCACCAGATTCCCGAAGGT Exon 2 154 CISH-2 CCGCCTTGTCATCAACCGTC Exon 3 155 CISH-3 TCTGCGTTCAGGGGTAAGCG Exon 1 156 CISH-4 GCGCTTACCCCTGAACGCAG Exon 1 157 CISH-5 CGCAGAGGACCATGTCCCCG Exon 1 1012 CISH-9 GCAGGCACCAGGATGCCTGG Exon 3 1013 CISH-10 GCATAGAGCTGGTCTCACTG Exon 3

[0360] In several embodiments, CISH is disrupted and / or knocked out using a CRISPR-Cas mediated approach (such as Cas9) or other guide nucleases disclosed elsewhere herein by utilizing one or more of the following CISH-specific guide RNA-guided nucleases: sequences of SEQ ID NOs: 463-466, or other guide sequences disclosed herein: SEQ ID NO: 463: GCACCTACAGAAGATGCCGG; SEQ ID NO: 464: GACAGCGTGAACAGGTAGCT; SEQ ID NO: 465: GACAGCGTGAACAGGTAGCT; SEQ ID NO: 466: ACTCAATGCGTACATTGGTG.

[0361] In several embodiments, gene editing reduces the transcription of CISH by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of CISH by at least about 30%. In several embodiments, gene editing reduces the transcription of CISH by at least about 40%. In several embodiments, gene editing reduces the transcription of CISH by at least about 50%. In several embodiments, gene editing reduces the transcription of CISH by at least about 60%. In several embodiments, gene editing reduces the transcription of CISH by at least about 70%. In several embodiments, gene editing reduces the transcription of CISH by at least about 80%. In several embodiments, gene editing reduces the transcription of CISH by at least about 90%.

[0362] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CISH by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of CISH by at least about 30%. In several embodiments, gene editing reduces the expression of CISH by at least about 40%. In several embodiments, gene editing reduces the expression of CISH by at least about 50%. In several embodiments, gene editing reduces the expression of CISH by at least about 60%. In several embodiments, gene editing reduces the expression of CISH by at least about 70%. In several embodiments, gene editing reduces the expression of CISH by at least about 80%. In several embodiments, gene editing reduces the expression of CISH by at least about 90%.

[0363] In CD8+ T cells, CISH actively inhibits T cell receptor (TCR) signaling to maintain tumor tolerance, and CISH has been shown to be a downstream negative regulator of IL-15 receptor signaling (Palmer et al., J. Exp. Med. (2015) 212 (12): 2095-2113). In NK cells and T cells, CISH plays a role in checkpoint maturation and proliferation (Delconte et al., Nature Immunol (2016) 17: 816-24). Therefore, according to various embodiments, CISH is gene-edited to increase the cytotoxicity, persistence, or otherwise enhance the efficacy of engineered NK cells, T cells, or other cells described herein.

[0364] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types disclosed herein, the expression of CEACAM1 is reduced and / or eliminated. In several embodiments, CEACAM1 is disrupted and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, CEACAM1 is disrupted and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein by utilizing one or more CEACAM1-specific guide RNA-guided nucleases as follows: SEQ ID NOs: 398-400.

[0365] In several embodiments, gene editing reduces transcription of CEACAM1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between). In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 30%. In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 40%. In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 50%. In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 60%. In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 70%. In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 80%. In several embodiments, gene editing reduces transcription of CEACAM1 by at least about 90%.

[0366] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount in between). In several embodiments, gene editing reduces the expression of CEACAM1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount in between). In several embodiments, gene editing reduces the expression of CEACAM1 by at least about 30%. In several embodiments, gene editing reduces the expression of CEACAM1 by at least about 40%. In several embodiments, gene editing reduces the expression of CEACAM1 by at least about 50%. In several embodiments, gene editing reduces CEACAM1 expression by at least about 60%. In several embodiments, gene editing reduces CEACAM1 expression by at least about 70%. In several embodiments, gene editing reduces CEACAM1 expression by at least about 80%. In several embodiments, gene editing reduces CEACAM1 expression by at least about 90%.

[0367] CEACAM1 is an immune checkpoint in NK cells and T cells that inhibits lysis of tumor cell lines expressing CEACAM1. Loss of CEACAM1 expression can increase the overall cytotoxicity of NK and T cells (Markel et al., J. Clin. Oncol. (2016) 34(suppl. 15):3044). Therefore, according to various embodiments, gene editing of CEACAM1 can increase the cytotoxicity, persistence, or otherwise enhance the efficacy of engineered NK cells, T cells, or other cells described herein.

[0368] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types provided herein, the expression of DDIT4 is reduced and / or eliminated. In several embodiments, DDIT4 is destroyed and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, DDIT4 is destroyed and / or knocked out using CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein by utilizing one or more of the following DDIT4-specific guide RNA-guided nucleases: SEQ ID NOs: 401-403.

[0369] In several embodiments, gene editing reduces the transcription of DDIT4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 30%. In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 40%. In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 50%. In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 60%. In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 70%. In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 80%. In several embodiments, gene editing reduces the transcription of DDIT4 by at least about 90%.

[0370] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of DDIT4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the expression of DDIT4 by at least about 30%. In several embodiments, gene editing reduces the expression of DDIT4 by at least about 40%. In several embodiments, gene editing reduces the expression of DDIT4 by at least about 50%. In several embodiments, gene editing reduces DDIT4 expression by at least about 60%. In several embodiments, gene editing reduces DDIT4 expression by at least about 70%. In several embodiments, gene editing reduces DDIT4 expression by at least about 80%. In several embodiments, gene editing reduces DDIT4 expression by at least about 90%.

[0371] In natural killer (NK) cells and T cells, DDIT4 is a negative regulator of mTORC1, which itself enhances IL-15-mediated NK cell survival and proliferation. In addition, DDIT4 is upregulated under oxidative stress conditions common in the tumor microenvironment. Loss of DDIT4 function in engineered cells may increase overall glucose metabolism, leading to enhanced proliferation and increasing the overall cytotoxicity of NK cells or T cells. Therefore, according to multiple embodiments, gene editing of DDIT4 increases the cytotoxicity, persistence, or otherwise enhances the efficacy of engineered NK cells, T cells, or other cells as disclosed herein.

[0372] In several embodiments, to enhance the overall activation of the resulting T cells and / or NK cells or other cell types provided herein, the expression of MAPKAP kinase 3 (MAPKAPK3) is reduced and / or eliminated. In several embodiments, MAPKAPK3 is destroyed and / or knocked out using one or more gene editing methods disclosed herein. In several embodiments, CRISPR-Cas mediated methods (such as Cas9) or other guide nucleases disclosed elsewhere herein are used to destroy and / or knock out MAPKAPK3 by utilizing one or more of the following MAPKAPK3-specific guide RNA-guided nucleases: SEQ ID NO: 395-397.

[0373] In several embodiments, gene editing reduces the transcription of MAPKAPK3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 30%. In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 40%. In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 50%. In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 60%. In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 70%. In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 80%. In several embodiments, gene editing reduces the transcription of MAPKAPK3 by at least about 90%.

[0374] In several embodiments, gene editing reduces the expression of MAPKAPK3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between). In several embodiments, gene editing reduces the expression of MAPKAPK3 by at least about 30%. In several embodiments, gene editing reduces the expression of MAPKAPK3 by at least about 40%. In several embodiments, gene editing reduces the expression of MAPKAPK3 by at least about 50%. In several embodiments, gene editing reduces the expression of MAPKAPK3 by at least about 60%. In several embodiments, gene editing reduces the expression of MAPKAPK3 by at least about 70%. In several embodiments, gene editing reduces the expression of MAPKAPK3 by at least about 80%. In several embodiments, gene editing reduces the expression of DDIT4 by at least about 90%.

[0375] In several embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99% or more (including any amount between the listed values). MAPKAP kinase 3 is expressed in both NK cells and T cells. It is expected that the loss of MA...

Claims

1. A genetically engineered and gene-edited immune cell population comprising: A genetically engineered immune cell expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The immune cell performs gene editing within a target sequence in the MED12 gene and within a target sequence in the CISH gene; and The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene.

2. The genetically engineered and gene-edited immune cell population according to claim 1, wherein: The target sequence within the MED12 gene comprises any one of SEQ ID NO:997, 938-944, 996 or 998.

3. The genetically engineered and gene-edited immune cell population according to claim 1, wherein the target sequence within the CISH gene comprises any one of SEQ ID NO: 1013, 153-157, 463-466 or 1012.

4. The genetically engineered and gene-edited immune cell population of claim 1, wherein the extracellular ligand binding domain targets an antigen selected from BCMA, NKG2D ligand, CD19 and CD70.

5. The genetically engineered and gene-edited immune cell population of claim 1, wherein the extracellular ligand-binding domain targets BCMA.

6. The genetically engineered and gene-edited immune cell population of claim 1, wherein the transmembrane domain comprises CD8, CD28 or a portion thereof, optionally wherein the transmembrane domain comprises CD8α or a portion thereof.

7. The genetically engineered and gene-edited immune cell population according to claim 1, wherein: The cytotoxic signaling complex comprises a CD3ζ domain; and / or The cytotoxic signaling complex comprises OX40, 4-1BB, the intracellular signaling domain of CD28 or a signaling portion thereof, optionally comprising the intracellular signaling domain of OX40 or a signaling portion thereof.

8. The genetically engineered and gene-edited immune cell population of claim 1, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15).

9. The genetically engineered and gene-edited immune cell population according to claim 8, wherein the cytotoxic receptor and the mbIL15 are encoded by the same nucleic acid molecule, optionally wherein the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

10. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the CBLB gene, wherein the target sequence within the CBLB gene comprises any one of SEQ ID NOs: 164, 165-166, 453-456, or 1005-1008.

11. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the ADAM17 gene, the target sequence comprising any one of SEQ ID NOs: 682-687.

12. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the hypoxia-inducible factor 1-α (HIF1-α) gene, the target sequence comprising any one of SEQ ID NOs: 750-760.

13. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the DGKζ gene, and the target sequence comprises any one of SEQ ID NOs: 688-723.

14. The genetically engineered and gene-edited immune cell population according to claim 1, wherein the cells are further gene-edited within a target sequence in the GSK-3β gene, and the target sequence comprises any one of SEQ ID NOs: 724-749.

15. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the LAG3 gene, and the target sequence comprises any one of SEQ ID NOs: 761-789.

16. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the TIM3 gene, and the target sequence comprises any one of SEQ ID NOs: 790-825.

17. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the TRIM29 gene, and the target sequence comprises any one of SEQ ID NOs: 826-835 or 1009-1011.

18. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the IL-1R8 gene, and the target sequence comprises any one of SEQ ID NOs: 836-865.

19. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the CD38 gene, and the target sequence comprises any one of SEQ ID NOs: 866-874.

20. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the FBP-1 gene, and the target sequence comprises any one of SEQ ID NOs: 875-889.

21. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the INSIG1 gene, and the target sequence comprises any one of SEQ ID NOs: 890-934.

22. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the CDK8 gene, and the target sequence comprises any one of SEQ ID NOs: 949-955.

23. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the CCNC gene, and the target sequence comprises any one of SEQ ID NOs: 956-961 or 999-1001.

24. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the ID3 gene, and the target sequence comprises any one of SEQ ID NOs: 963-969.

25. The genetically engineered and gene-edited immune cell population of claim 1, wherein the cells are further gene-edited within a target sequence in the SOX4 gene, and the target sequence comprises any one of SEQ ID NOs: 970-976.

26. The genetically engineered and gene-edited immune cell population of any one of claims 1 to 25, wherein editing of one or more target sequences is performed using an RNA-guided endonuclease.

27. The genetically engineered and gene-edited immune cell population of claim 26, wherein editing of one or more target sequences is performed using the Crispr / Cas9 system.

28. A population of genetically engineered and gene-edited immune cells according to any one of claims 1 to 27, wherein the immune cells comprise natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSC), iPSC-derived NK cells, iPSC-derived T cells, NK-92 cells, or any combination thereof.

29. The genetically engineered and gene-edited immune cell population of claim 28, wherein the immune cells are natural killer (NK) cells.

30. A composition comprising a population of genetically engineered and gene-edited immune cells according to any one of claims 1 to 29.

31. A method of treating a subject having a disease or condition, comprising administering to the subject a population of genetically engineered and gene-edited immune cells according to any one of claims 1 to 29 or a composition according to claim 30.

32. Use of the genetically engineered and gene-edited immune cell population according to any one of claims 1 to 29 or the composition according to claim 30 for treating a subject suffering from a disease or disorder.

33. The method of claim 31 or the use of claim 32, wherein the disease or disorder is an infectious disease, an autoimmune disease, a cancer or a tumor.

34. A genetically engineered and gene-edited immune cell population comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The immune cell is gene-edited within a target sequence in the ADAM17 gene, wherein the target sequence comprises any one of SEQ ID NOs: 682-687; The editing results in reduced expression and / or function of the ADAM17 protein encoded by the ADAM17 gene compared to immune cells that have not been edited within the target sequence in the ADAM17 gene; and Editing of the ADAM17 gene was performed using an RNA-guided endonuclease.

35. A genetically engineered and gene-edited immune cell population comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The immune cell is gene-edited within a target sequence in the hypoxia-inducible factor 1-α (HIF1-α) gene, wherein the target sequence comprises any one of SEQ ID NOs: 750-760; The editing results in reduced expression and / or function of the HIF1-α protein encoded by the HIF1-α gene compared to immune cells that have not been edited within the target sequence in the HIF1-α gene; and Editing of the HIF1-α gene was performed using an RNA-guided endonuclease.

36. A genetically engineered and gene-edited immune cell population comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The immune cell is gene-edited within a target sequence in a target gene selected from the group consisting of MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; The editing results in reduced expression and / or function of a protein encoded by the target gene compared to immune cells that have not undergone editing within the target sequence of the target gene; The immune cell is edited at an additional target sequence within the target gene to result in a reduction in the expression level of a protein encoded by the target gene compared to an immune cell that is not edited at the additional target sequence; and Editing of the one or more target genes is performed using an RNA-guided endonuclease.

37. A genetically engineered and gene-edited immune cell population comprising: A genetically engineered immune cell expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain and a cytotoxic signaling complex, The extracellular ligand-binding domain targets a tumor marker expressed by target tumor cells. wherein the immune cell is gene-edited at one or more positions in a target gene selected from ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein each of said genes encodes a corresponding protein; The editing results in reduced expression and / or function of the corresponding protein compared to an immune cell that has not been edited at the one or more positions of the corresponding gene; wherein the immune cell is edited at one or more additional target sites in the genome of the immune cell to result in reduced expression levels of a protein encoded by a gene comprising the edited target site compared to an unedited immune cell, wherein editing of one or more target genes is performed using the CRISPR / Cas9 system, and Compared with immune cells that do not contain the one or more gene-edited target sites, the genetically engineered and gene-edited immune cells exhibit one or more of enhanced proliferation capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence.

38. The genetically engineered and gene-edited immune cell population of any one of claims 34-37, wherein the immune cells are gene-edited within a target sequence in one or more of the following genes: DGKζ gene, and the target sequence comprises any one of SEQ ID NOs: 688-723; GSK-3β gene, and the target sequence comprises any one of SEQ ID NOs: 724-749; LAG3 gene, and the target sequence comprises any one of SEQ ID NOs: 761-789; TIM3 gene, and the target sequence comprises any one of SEQ ID NOs: 790-825; TRIM29 gene, and the target sequence comprises any one of SEQ ID NO: 826-835 or 1009-1011; IL-1R8 gene, and the target sequence comprises any one of SEQ ID NOs: 836-865; CD38 gene, and the target sequence comprises any one of SEQ ID NOs: 866-874; FBP-1 gene, and the target sequence comprises any one of SEQ ID NOs: 875-889; INSIG1 gene, and the target sequence comprises any one of SEQ ID NOs: 890-934; CDK8 gene, and the target sequence comprises any one of SEQ ID NOs: 949-955; CCNC gene, and the target sequence comprises any one of SEQ ID NO: 956-961 or 999-1001; ID3 gene, and the target sequence comprises any one of SEQ ID NOs: 963-969; and The target sequence comprises any one of SEQ ID NOs: 970-976.

39. The genetically engineered and gene-edited immune cell population of claim 38, wherein the cells are gene-edited within a target sequence in the CD70 gene.

40. A population of genetically engineered and gene-edited immune cells according to any one of claims 34 to 39, wherein the cells are gene-edited within a target sequence in the TGFBR2 gene, the TIGIT gene, the adenosine A2a receptor (ADORA2A) gene, the SMAD3 gene, the MAPKAPK3 gene, the CEACAM1 gene, the DDIT4 gene, the NKG2A gene, the SOCS2 gene, the B2M gene, the PDCD1 gene and / or the TRAC gene.

41. A population of genetically engineered and gene-edited immune cells according to any one of claims 34 to 40, wherein the immune cells comprise NK cells.

42. A composition comprising a population of genetically engineered and gene-edited immune cells according to any one of claims 34 to 41.

43. A method for making a gene-edited immune cell population, comprising contacting the immune cell population with a targeted endonuclease that edits within a target sequence in a target gene selected from the group consisting of MED12, CISH, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, CBLB, and any combination thereof, Wherein, compared with immune cells that have not been edited within the target sequence in the target gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof.

44. A method for making a gene-edited immune cell population, comprising contacting the immune cell population with an RNA-guided endonuclease that edits within a target sequence in a target gene selected from the group consisting of MED12, CISH, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof, Wherein, compared with immune cells that have not been edited within the target sequence in the target gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof.

45. A method of making a gene-edited immune cell population, comprising contacting an immune cell population with a Cas-gRNA ribonucleoprotein complex (RNP), wherein: The RNP edits within a target sequence in a target gene selected from the group consisting of MED12, CISH, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; The Cas of the RNP comprises Cas9, CasX, CasY or a combination thereof; and Compared to immune cells that have not been edited within the target sequence in the target gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof.

46. ​​A method for producing a gene-edited immune cell population, comprising: (a) contacting a population of immune cells with a first RNA-guided endonuclease, wherein the RNA-guided endonuclease edits within a target sequence in a target gene selected from the group consisting of MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; and (b) contacting the immune cell population with a second RNA-guided endonuclease, wherein the second RNA-guided endonuclease performs editing within the target sequence in the CISH gene resulting in a reduction in the expression level of the CIS protein encoded by the CISH gene compared to immune cells that have not performed editing within the target sequence in the CISH gene; and Compared with immune cells that have not been edited within the target sequence in the target gene and the CISH gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof.

47. A method for producing a gene-edited immune cell population, comprising: (a) contacting an immune cell population with a first Cas-gRNA ribonucleoprotein (RNP) complex, wherein the RNP complex is edited within a target sequence in a target gene selected from MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the first RNP complex comprises Cas9, CasX, CasY or a combination thereof; as well as (b) contacting an immune cell population with a second Cas-gRNA RNP complex, wherein the second RNP complex is edited within the target sequence in the CISH gene to result in a decrease in the expression level of the CIS protein encoded by the CISH gene compared to immune cells that are not edited within the target sequence in the CISH gene, and wherein the Cas of the second RNP complex comprises Cas9, CasX, CasY or a combination thereof; and Compared with immune cells that have not been edited within the target sequence in the target gene and the CISH gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof.

48. A method for producing a gene-edited immune cell population, comprising: (a) contacting an immune cell population with a first Cas-gRNA ribonucleoprotein (RNP) complex, wherein the RNP is edited within a target sequence in a target gene selected from MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the first RNP complex comprises Cas9, CasX, CasY or a combination thereof; as well as (b) contacting the immune cell population with a second Cas-gRNA RNP complex, wherein editing of the second RNP complex within the target sequence in the CBLB gene results in a reduction in the expression level of a CBLB protein encoded by the CBLB gene compared to immune cells that have not been edited within the target sequence in the CBLB gene, and wherein the Cas of the second RNP complex comprises Cas9, CasX, CasY or a combination thereof; and Compared with immune cells that have not been edited within the target sequences in the target gene and CBLB gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence, or any combination thereof.

49. A method for producing a gene-edited immune cell population, comprising: (a) contacting a population of immune cells with a first RNA-guided endonuclease, wherein the first RNA-guided endonuclease edits within a target sequence in a target gene selected from MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; (b) contacting the population of immune cells with a second RNA-guided endonuclease, wherein the second RNA-guided endonuclease edits within a target sequence in a CISH gene resulting in a reduction in the expression level of a CIS protein encoded by the CISH gene compared to immune cells that have not edited within the target sequence in the CISH gene; as well as (c) contacting the population of immune cells with a third RNA-guided endonuclease, wherein the third RNA-guided endonuclease edits within a target sequence in a CBLB gene to result in a decrease in the expression level of a CBLB protein encoded by the CBLB gene compared to immune cells that have not edited within the target sequence in the CBLB gene; and Compared with immune cells that have not been edited within the target sequences in the target gene, CISH gene and CBLB gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence or any combination thereof.

50. A method for producing a gene-edited immune cell population, comprising: (a) contacting an immune cell population with a first Cas-gRNA ribonucleoprotein (RNP) complex, wherein the first RNP complex edits within a target sequence in a target gene selected from MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; (b) contacting the immune cell population with a second RNP complex, wherein the second RNP complex performs editing within the target sequence in the CISH gene, resulting in a reduction in the expression level of the CIS protein encoded by the CISH gene compared to immune cells that are not edited within the target sequence in the CISH gene; as well as (c) contacting the immune cell population with a third RNP complex, wherein the third RNP complex is edited within the target sequence in the CBLB gene to cause the expression level of the CBLB protein encoded by the CBLB gene to be reduced compared to immune cells that have not been edited within the target sequence in the CBLB gene; wherein the Cas of each of the first, second and third RNP complexes comprises Cas9, CasX, CasY or a combination thereof, and Compared with immune cells that have not been edited within the target sequences in the target gene, CISH gene and CBLB gene, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence or any combination thereof.

51. A method for producing a population of gene-edited immune cells, comprising contacting an immune cell population with a plurality of Cas-gRNA ribonucleoprotein (RNP) complexes, wherein: The plurality of RNP complexes are edited within a target sequence in a CISH gene to result in a reduction in the expression level of a CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence of the CISH gene; The plurality of RNP complexes are edited within a target sequence in a CBLB gene to result in reduced expression levels of a CBLB protein encoded by the CBLB gene compared to immune cells that have not been edited within the target sequence in the CBLB gene; The plurality of RNP complexes are edited within a target sequence in a target gene selected from MED12, ADAM17, HIF-1α, DGKζ, GSK-3β, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; The Cas of each of the plurality of RNP complexes comprises Cas9, CasX, CasY or a combination thereof; and Compared with immune cells that have not been edited within the target sequences in the CISH, CBLB and target genes, the gene-edited immune cells exhibit: enhanced proliferation ability, enhanced cytotoxicity to target tumor cells, enhanced persistence or any combination thereof.

52. The method of claim 51, wherein the immune cell is gene-edited within a target sequence in the MED12 gene, and the target sequence comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998, and wherein the immune cell is gene-edited within a target sequence in the CISH gene, and the target sequence comprises any one of SEQ ID NOs: 1013, 153-157, 463-466, or 1012.

53. The method of claim 51 or 52, wherein the immune cell is gene-edited within a target sequence in the CBLB gene, and the target sequence comprises any one of SEQ ID NOs: 164 to 166, 453-456, or 1005-1008.

54. The method of claim 51, 52 or 53, wherein the immune cells are gene edited within a target sequence in one or more of the following genes: ADAM17 gene, and the target sequence comprises any one of SEQ ID NOs: 682-687; HIF-1α gene, and the target sequence comprises any one of SEQ ID NOs: 750-760; DGKζ gene, and the target sequence comprises any one of SEQ ID NOs: 688-723; GSK-3β gene, and the target sequence comprises any one of SEQ ID NOs: 724-749; LAG3 gene, and the target sequence comprises any one of SEQ ID NOs: 761-789; TIM3 gene, and the target sequence comprises any one of SEQ ID NOs: 790-825; TRIM29 gene, and the target sequence comprises any one of SEQ ID NO: 826-835 or 1009-1011; IL-1R8 gene, and the target sequence comprises any one of SEQ ID NOs: 836-865; CD38 gene, and the target sequence comprises any one of SEQ ID NOs: 866-874; FBP-1 gene, and the target sequence comprises any one of SEQ ID NOs: 875-889; INSIG1 gene, and the target sequence comprises any one of SEQ ID NOs: 890-934; MED13 gene, and the target sequence comprises any one of SEQ ID NOs: 945-948; CDK8 gene, and the target sequence comprises any one of SEQ ID NOs: 949-955; CCNC gene, and the target sequence comprises any one of SEQ ID NO: 956-962 or 999-1001; ID3 gene, and the target sequence comprises any one of SEQ ID NOs: 963-969; and The target sequence comprises any one of SEQ ID NOs: 970-976.

55. The method of any one of claims 51 to 54, wherein the cell is gene edited within a target sequence in the CD70 gene.

56. The method of any one of claims 51 to 54, wherein the method does not comprise editing the CD70 gene.

57. The method of any one of claims 51 to 56, wherein the cell is gene-edited within a target sequence in the TGFBR2 gene, the TIGIT gene, the adenosine A2a receptor (ADORA2A) gene, the SMAD3 gene, the MAPKAPK3 gene, the CEACAM1 gene, the DDIT4 gene, the NKG2A gene, the SOCS2 gene, the B2M gene, the PDCD1 gene and / or the TRAC gene.

58. The method of any one of claims 51 to 57, wherein the method further comprises contacting the immune cell population with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.

59. The method of claim 58, wherein the extracellular ligand binding domain targets BCMA, CD19, CD70 or NKG2D ligand.

60. The method of claim 58, wherein the cytotoxic receptor does not target CD19 or NKG2D ligands.

61. A method for treating a subject having a disease or condition, comprising administering to the subject a genetically engineered and gene-edited immune cell population according to any one of claims 34 to 41, a composition according to claim 42, or a gene-edited immune cell population manufactured by the method according to any one of claims 43 to 60.

62. Use of the genetically engineered and edited immune cell population according to any one of claims 34 to 41, the composition according to claim 42, or the genetically edited immune cell population manufactured by the method according to any one of claims 43 to 60 for treating a subject suffering from a disease or disorder.

63. A method for preparing a medicament for treating a subject suffering from a disease or disorder using a genetically engineered and edited immune cell population according to any one of claims 34 to 41, a composition according to claim 42, or a genetically edited immune cell population manufactured by a method according to any one of claims 43 to 60.

64. The method of claim 61 or the use of claim 62 or 63, wherein the disease or disorder is an infectious disease, an autoimmune disease, a cancer or a tumor.

65. A method for treating a subject having a disease or condition, comprising administering to the subject a population of genetically engineered and gene-edited immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The immune cells undergo gene editing within a target sequence in the MED12 gene, wherein the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996 or 998; and The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene.

66. The method of claim 65, wherein the genetically engineered and gene-edited immune cells are further edited within a target sequence in a CISH gene, wherein the target sequence within the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, 463-466 or 1012; and The editing results in reduced expression and / or function of the CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence in the CISH gene.

67. The method of claim 65 or 66, wherein the extracellular ligand binding domain targets BCMA.

68. The method of any one of claims 65 to 67, wherein the genetically engineered and gene-edited immune cells are NK cells.

69. A genetically engineered and gene-edited immune cell population comprising: A genetically engineered immune cell expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer, wherein the antigen is B cell maturation antigen (BCMA); The immune cell undergoes gene editing within a target sequence in the MED12 gene; and The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene.

70. The genetically engineered and gene-edited immune cell population of claim 69, wherein the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996 or 998.

71. The genetically engineered and gene-edited immune cell population of claim 69 or 70, wherein the genetically engineered and gene-edited immune cells are further edited within a target sequence in a CISH gene, wherein the target sequence within the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, 463-466 or 1012; and The editing results in reduced expression and / or function of the CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence in the CISH gene.

72. A genetically engineered and gene-edited immune cell population comprising: Genetically engineered immune cells, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15); and The immune cell undergoes gene editing within a target sequence in the MED12 gene; The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the MED12 gene target sequence.

73. The genetically engineered and gene-edited immune cell population of claim 72, wherein the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, optionally wherein the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

74. A genetically engineered and gene-edited immune cell population comprising: A genetically engineered and gene-edited immune cell expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The cytotoxic signaling complex comprises a CD3 zeta domain and an intracellular signaling domain of OX40, 4-1BB, CD28, or a signaling portion thereof, optionally an intracellular signaling domain of OX40 or a signaling portion thereof; The immune cells undergo gene editing within a target sequence in the MED12 gene, wherein the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996 or 998; and The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene.

75. The genetically engineered and gene-edited immune cell population of claim 74, wherein the genetically engineered and gene-edited immune cells are further edited within a target sequence in a CISH gene, optionally: wherein the target sequence within the CISH gene comprises any one of SEQ ID NO: 1013, 153-157, 463-466 or 1012; and / or wherein the editing results in reduced expression and / or function of a CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence in the CISH gene.

76. A population of genetically engineered and gene-edited immune cells according to claim 74 or 75, wherein the transmembrane domain comprises CD8, CD28 or a portion thereof, optionally wherein the transmembrane domain comprises CD8α or a portion thereof.

77. The genetically engineered and gene-edited immune cell population of any one of claims 74 to 76, wherein the extracellular ligand binding domain targets BCMA.

78. The population of genetically engineered and gene-edited immune cells of any one of claims 74 to 77, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15).

79. A population of genetically edited immune cells, wherein: The immune cell performs gene editing within a target sequence in the MED12 gene and within a target sequence in the CISH gene; and The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene.

80. The gene-edited immune cell population of claim 79, wherein: The gene-edited immune cell is a genetically engineered immune cell that expresses a cytotoxic receptor, wherein the cytotoxic receptor comprises an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex; and The extracellular ligand binding domain targets an antigen expressed by cells of the target tumor or cancer.

81. A population of genetically engineered and gene-edited immune cells expressing a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein: The extracellular ligand binding domain targets an antigen expressed by cells of a target tumor or cancer; The immune cells undergo gene editing within a target sequence in the MED12 gene, wherein the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996 or 998; and The editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene.

82. A population of genetically engineered and / or gene-edited immune cells according to any one of claims 69 to 81, wherein the immune cells are NK cells.

Images