Application of unsaturated fatty acid in resisting rice black-streaked dwarf virus

Abstract

The invention discloses application of unsaturated fatty acid in resisting rice black-streaked dwarf virus. Belongs to the technical field of agricultural scientific plant protection. According to the invention, 50 [mu] M unsaturated fatty acid C18: 3 is adopted to treat rice seedlings, and compared with a control group, the treatment of the unsaturated fatty acid C18: 3 can significantly inhibit RBSDV infection and reduce the virus accumulation level. The unsaturated fatty acid C18: 3 as a plant source substance has the advantages of safety, economy, no pollution and the like, and meets the requirements of agricultural sustainable development and green environmental protection. The invention provides a new thought for preventing and treating plant viruses.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural science plant protection, and more particularly to the application of unsaturated fatty acids in resistance to rice black-streaked dwarf virus. Background Art

[0002] Plant viral diseases are one of the most threatening diseases in agricultural production and are known as "plant cancer". Rice black-streaked dwarf virus (RBSDV) is a double-stranded RNA virus belonging to the Reoviridae family and the Fijivirus genus. It is transmitted by small brown planthoppers and poses a major threat to major food crops such as rice, wheat and corn, causing rice black-streaked dwarf disease, corn rough dwarf disease and wheat green dwarf disease, respectively. At present, there is no effective chemical agent to control this plant viral disease.

[0003] Fatty acids (FAs) are the main components of plant cell membranes. They not only maintain the integrity of cell structures and provide energy for plants, but also play an important role in plant resistance to biotic and abiotic stresses as signaling molecules and by modifying various proteins in plants. Unsaturated fatty acids are biosynthetic precursors of azelaic acid (AzA), which in turn induce AzA-mediated systemic acquired resistance. However, there are few reports on the effects of unsaturated fatty acids on plant virus resistance.

[0004] In summary, how to provide an unsaturated fatty acid that is resistant to rice black-streaked dwarf virus is a problem that those skilled in the art need to solve urgently. Summary of the invention

[0005] In view of this, the present invention provides the use of unsaturated fatty acids in resistance to rice black-streaked dwarf virus.

[0006] The present invention uses 50 μM unsaturated fatty acid C18:3 to treat rice seedlings, and finds that compared with the control group, unsaturated fatty acid C18:3 treatment can significantly inhibit RBSDV infection and reduce the level of virus accumulation. The present invention makes it possible to use unsaturated fatty acid C18:3 for the prevention and treatment of plant viruses, providing a new idea for the prevention and treatment of plant viruses.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] Application of unsaturated fatty acids in resistance to rice black-streaked dwarf virus.

[0009] Furthermore, the unsaturated fatty acid is unsaturated fatty acid C18:3.

[0010] Furthermore, the unsaturated fatty acid C18:3 is α-linolenic acid.

[0011] Furthermore, unsaturated fatty acids are added to rice culture medium to culture rice seedlings.

[0012] Furthermore, the concentration of the unsaturated fatty acid is 50 μM.

[0013] Furthermore, the rice is Zhonghua No. 11.

[0014] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:

[0015] Compared with traditional chemical agents, plant-derived substances have their own degradation pathways and are generally safe, economical, and pollution-free. Unsaturated fatty acids are the main components of plant cell membranes and are widely present in plants. The unsaturated fatty acid C18:3 screened by the present invention can significantly improve the resistance of plants to RBSDV, which is of great significance for the green prevention and control of plant viral diseases in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0017] Figure 1 The expression level of disease resistance-related genes in rice plants treated with unsaturated fatty acid C18:3 was detected by RT-qPCR in Example 2 of the present invention;

[0018] Figure 2 The rice seedlings were treated with 50 μM unsaturated fatty acid C18:3 in Example 3 of the present invention, and then inoculated with RBSDV for symptom observation;

[0019] Figure 3 The RT-qPCR in Example 3 of the present invention detects the accumulation of viruses in rice plants after treatment with unsaturated fatty acid C18:3. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] The drugs required for the present invention are conventional experimental drugs, which are purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0022] The rice variety used in the following examples is Zhonghua No. 11;

[0023] The unsaturated fatty acid C18:3 selected in the following examples is α-linolenic acid.

[0024] Example 1

[0025] Treatment of rice seedlings with unsaturated fatty acid C18:3

[0026] Take an appropriate amount of unsaturated fatty acid C18:3 powder, dissolve it in dimethyl sulfoxide, and then add it to the rice seedling culture medium to dilute it to a working concentration of 50 μM. Select rice seedlings grown for 10 days and place them in the rice seedling culture medium containing 50 μM unsaturated fatty acid C18:3 for 3 days.

[0027] Rice seedling culture medium composition: 0.25mM KH2PO4, 0.25mM MgSO4, 0.25mM (NH4)SO4, 0.38mM KNO3, 0.24mM Ca(NO3)2, 0.02mM FeSO4-EDTA, 0.5μM CuSO4, 1μM MnSO4, 1μM ZnSO4, 1μM (NH4)6Mo7O 24 , 3 μM H3BO3, adjust pH to 5.2.

[0028] Example 2

[0029] Detection of disease resistance-related gene expression levels

[0030] Normally grown rice seedlings and rice seedlings treated with 50 μM unsaturated fatty acid C18:3 were collected, total RNA was extracted, and reverse transcribed into cDNA; specific quantitative detection primers for OsPR1a and OsWRKY28 genes (marker genes related to plant defense) were designed:

[0031] qRT-OsPR1a-F:TCGTATGCTATGCTACGTGTTT, SEQ ID NO.1;

[0032] qRT-OsPR1a-R:CACTAAGCAAATACGGCTGACA, SEQ ID NO.2;

[0033] qRT-OsWRKY28-F:ATGGCTTTGATCGGAGTTAGGC, SEQ ID NO.3;

[0034] qRT-OsWRKY28-R:GCAACGAATTATCGTACGTTTTG, SEQ ID NO.4.

[0035] The RT-qPCR method was used for detection. The RT-qPCR reaction system was as follows:

[0036] 2×NovoStart SYBR qPCR SuperMix Plus 10μL, upstream primer 0.5μL, downstream primer 0.5μL, cDNA template 1μL, ddH2O to 20μL.

[0037] Place it in a 0.2mL sterile PCR tube and mix thoroughly. The RT-qPCR reaction procedure is as follows:

[0038] 95℃ for 5 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 20 s, 40 cycles; 72℃ for 5 min; 16℃ for 5 min.

[0039] The results are as follows Figure 1 As shown, compared with the control plants, 50 μM unsaturated fatty acid C18:3 treatment can significantly induce the expression of disease resistance-related genes.

[0040] Example 3

[0041] Artificial inoculation of RBSDV and detection of virus accumulation level

[0042] Use a brush to gently drive the non-toxic gray planthoppers onto the rice plants infected with RBS D V and feed them with the poison for 3 to 5 days. Then transfer the poisoned gray planthoppers to healthy rice seedlings and feed them for about 10 days. After the cycle period is over, transfer the infected gray planthoppers to the rice materials that need to be inoculated with the poison at the 2 to 3 leaf stage.

[0043] Total RNA was extracted from wild-type rice inoculated with RBSDV and rice plants treated with 50 μM unsaturated fatty acid C18:3, and reverse transcribed into cDNA using universal primers; specific quantitative detection primers for RBSDV P10 gene were designed:

[0044] qRT-P10-F:GCCCCACGTTGCATCTTC, SEQ ID NO.5;

[0045] qRT-P10-R:TGTTGGGCAAAGTGCTAGTTTC, SEQ ID NO. 6.

[0046] The RT-qPCR method was used to detect viral expression in wild-type rice and rice plants treated with 50 μM unsaturated fatty acid C18:3.

[0047] The RT-qPCR reaction system is as follows:

[0048] 2×NovoStart SYBR qPCR SuperMix Plus 10μL, upstream primer 0.5μL, downstream primer 0.5μL, DNA template 1μL, ddH2O to 20μL.

[0049] Place it in a 0.2 mL sterile PCR tube and mix thoroughly.

[0050] The RT-qPCR reaction procedure is as follows:

[0051] 95℃ for 5 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 20 s, 40 cycles; 72℃ for 5 min; 16℃ for 5 min.

[0052] After inoculation, the phenotype Figure 2 The results of virus accumulation test are shown in Figure 3 Compared with the control plants, 50 μM unsaturated fatty acid C18:3 treatment could significantly inhibit RBSDV infection.

[0053] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0054] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of unsaturated fatty acids in resistance to rice black-streaked dwarf virus.

2. The use according to claim 1, characterized in that The unsaturated fatty acid is unsaturated fatty acid C18:

3.

3. The use according to claim 2, characterized in that The unsaturated fatty acid C18:3 is α-linolenic acid.

4. The use according to claim 1, characterized in that Unsaturated fatty acids are added to rice culture medium to culture rice seedlings.

5. The use according to claim 4, characterized in that The concentration of the unsaturated fatty acid was 50 μM.

6. The use according to any one of claims 1 to 5, characterized in that: The rice is Zhonghua No. 11.

Images