Application of small molecule compound NX-1607 in preparation of products for treating hepatic fibrosis

Abstract

The invention relates to the technical field of biological medicines, in particular to application of a small molecule compound NX-1607 in preparation of a product for treating hepatic fibrosis. The invention finds that the NX-1607 has an efficient anti-hepatic fibrosis effect, shows an obvious anti-hepatic fibrosis effect in a plurality of hepatic fibrosis mouse models, and has wide adaptability. The invention also finds that NX-1607 can up-regulate the expression of a key inhibitory factor SMAD7 of a TGF-beta signal channel and reduce the activation of hepatic stellate cells so as to effectively relieve hepatic fibrosis, the mechanism is different from the existing anti-hepatic fibrosis drugs, and a new technical support is provided for the treatment of hepatic fibrosis. And the NX-1607 has no obvious toxic and side effects in an effective dose range (3-8 mg / kg / d), and has better safety. Therefore, the NX-1607 is a safe and effective anti-hepatic fibrosis medicine, and the problems of limited curative effect and large side effect at present can be solved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of a small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. Background Art

[0002] Currently, liver fibrosis is a widespread pathological process caused by chronic liver damage, which may eventually develop into cirrhosis or even liver cancer. Although studies have shown that the TGF-β signaling pathway promotes the occurrence and development of liver fibrosis, there is still a lack of effective anti-fibrotic drugs targeting the TGF-β signaling pathway in clinical practice.

[0003] The existing anti-liver fibrosis treatments mainly include: (1) Anti-inflammatory treatment: such as glucocorticoids, but long-term use may cause side effects, such as immunosuppression. (2) Anti-oxidative stress: such as S-adenosylmethionine, but the efficacy is limited. (3) Anti-fibrosis drugs: including some experimental TGF-β pathway inhibitors, but most of them have not yet entered clinical application, and some drugs have problems such as poor pharmacokinetic properties and large side effects.

[0004] Therefore, there is an urgent need for a safe and effective anti-liver fibrosis drug to improve the deficiencies of current treatment methods. Summary of the invention

[0005] In order to solve the above problems, the present invention provides the use of a small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. The present invention finds that NX-1607 can upregulate the expression of SMAD7, a key inhibitor of the TGF-β signaling pathway, and reduce the activation of hepatic stellate cells (HSC), thereby effectively alleviating liver fibrosis. It is a safe and effective anti-liver fibrosis drug that can improve the current problems of limited efficacy and large side effects.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides application of a small molecule compound NX-1607 in preparing a product for treating liver fibrosis.

[0008] Preferably, the product comprises a medicine.

[0009] The present invention provides a medicine for treating liver fibrosis, wherein the effective component comprises a small molecule compound NX-1607; based on the body weight of mice, the unit dosage of the medicine is 3-8 mg / kg body weight.

[0010] Preferably, based on the body weight of the mouse, the unit dose of the drug is 5 mg / kg body weight.

[0011] Preferably, the medicine further comprises an excipient; the excipient comprises 5 g / L sodium carboxymethyl cellulose solution.

[0012] Beneficial effects:

[0013] The present invention provides the use of a small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. The present invention found that NX-1607 has a highly effective anti-liver fibrosis effect, and exhibits significant anti-fibrosis effects in multiple liver fibrosis mouse models (MCD diet model and CCL4 induced model), has wide adaptability, and is expected to become a new anti-liver fibrosis candidate drug. The present invention also found that NX-1607 can upregulate the expression of SMAD7, a key inhibitor of the TGF-β signaling pathway, and reduce the activation of hepatic stellate cells (HSC), thereby effectively alleviating liver fibrosis. This mechanism is different from existing anti-liver fibrosis drugs, and provides new technical support for the treatment of liver fibrosis. Moreover, NX-1607 is a commercially available drug that has entered the clinical stage. No obvious toxic and side effects were found within the effective dose range (3 to 8 mg / kg / d), and it has good safety. In summary, the present invention found that NX-1607 is a safe and effective anti-liver fibrosis drug that can improve the current problems of limited efficacy and large side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0015] Figure 1 Masson staining results of the MCD model after NX-1607 treatment;

[0016] Figure 2 The results of Sirius red staining after NX-1607 treatment in the MCD model;

[0017] Figure 3 The results of serum liver damage markers ALT and AST in the MCD model after NX-1607 treatment;

[0018] Figure 4 The results of RT-qPCR in the MCD model after NX-1607 treatment;

[0019] Figure 5 This is the Masson staining result of the CCL4 model after NX-1607 treatment;

[0020] Figure 6 This is the Sirius red staining result after NX-1607 treatment in the CCL4 model;

[0021] Figure 7The results of serum liver damage markers ALT and AST in the CCL4 model after NX-1607 treatment;

[0022] Figure 8 The results of RT-qPCR in CCL4 model after NX-1607 treatment;

[0023] Fig. 9 The results of Western Blot analysis of human hepatic stellate cell line LX2 stimulated by NX-1607;

[0024] in, Figure 3 , Figure 4 , Figure 7 and Figure 8 NX1607 in the assay refers to the NX-1607 treatment group. DETAILED DESCRIPTION

[0025] The present invention provides the use of a small molecule compound NX-1607 in the preparation of a product for treating liver fibrosis. The small molecule compound NX-1607 of the present invention is a commercially available small molecule compound that has entered the clinical stage. No obvious toxic side effects are found within the effective dose range (3 to 8 mg / kg / d), and it has good safety. As an embodiment, the small molecule compound NX-1607 of the present invention is purchased from Sellck Company, and the item number is E1957.

[0026] As an embodiment, the product may be a medicine.

[0027] The present invention found that NX-1607 has a highly effective anti-fibrotic effect on liver, and has shown significant anti-fibrotic effects in multiple liver fibrosis mouse models (MCD diet model and CCL4-induced model), which can inhibit αSMA gene expression and Col1a1 gene expression, and reduce serum alanine aminotransferase and aspartate aminotransferase levels. MCD diet is a liver fibrosis model associated with non-alcoholic fatty hepatitis; CCL4 (carbon tetrachloride) is a classic chemical liver injury inducer that can simulate liver fibrosis caused by drug damage, alcoholic and viral liver damage. It can be seen that NX-1607 has a wide range of adaptability and is expected to become a new anti-fibrotic candidate drug.

[0028] The present invention also found that NX-1607 can upregulate the expression of SMAD7, a key inhibitor of the TGF-β signaling pathway, and reduce the activation of hepatic stellate cells (HSC), thereby effectively alleviating liver fibrosis. This mechanism is different from existing anti-liver fibrosis drugs and provides new technical support for the treatment of liver fibrosis.

[0029] Based on the above advantages, the present invention provides a drug for treating liver fibrosis, the active ingredient of which includes a small molecule compound NX-1607; the unit dose of the drug is 3 to 8 mg / kg body weight based on the body weight of mice. The unit dose of the present invention refers to the effective unit dose of the drug to exert an anti-liver fibrosis effect, and if it acts on the human body, it can be converted to an equivalent amount according to common knowledge in the art.

[0030] As one embodiment, based on the body weight of the mouse, the unit dose of the drug is 5 mg / kg body weight.

[0031] As an embodiment, the drug further includes an excipient; the excipient includes 5 g / L sodium carboxymethyl cellulose solution.

[0032] To further illustrate the present invention, the application of the small molecule compound NX-1607 provided by the present invention in the preparation of products for treating liver fibrosis is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1

[0034] The method described in the literature [Rao J, Wang H, Ni M, Wang Z, Wang Z, Wei S, Liu M, Wang P, Qiu J, Zhang L, Wu C, Shen H, Wang X, Cheng F, Lu L. FSTL1 promotes liver fibrosis by reprogramming macrophage function through modulating the intracellular function of PKM2. Gut. 2022 Dec; 71(12): 2539-2550. doi: 10.1136 / gutjnl-2021-325150. Epub 2022 Feb 9. PMID: 35140065; PMCID: PMC9664121.] was used to model liver fibrosis in C57BL / 6J mice, and two mouse liver fibrosis models (MCD diet model and CCL4-induced model) were obtained.

[0035] Example 2

[0036] NX-1607 (or NX1607, purchased from Sellck) was dissolved in 5 g / L sodium carboxymethyl cellulose solution to obtain NX-1607 solution.

[0037] The MCD diet model mice constructed in Example 1 were divided into two groups, a control group (denoted as Vehicle) and a NX-1607 treatment group, with 6 mice in each group. The two groups of mice were treated as follows:

[0038] The mice in the NX-1607 treatment group were gavaged with NX-1607 solution daily at a daily dose of 5 mg / kg body weight based on the mass of NX-1607; the mice in the control group were gavaged with an equal volume of solvent (i.e., 5 g / L sodium carboxymethyl cellulose solution).

[0039] After 6 weeks of treatment, liver paraffin sections of the two groups of mice were stained with Masson and Sirius red. Figure 1 and Figure 2 The results showed that the degree of liver fibrosis in MCD diet model mice was reduced after NX-1607 treatment.

[0040] After 6 weeks of treatment, the levels of liver injury markers alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum of the two groups of mice were detected. Figure 3 , where ** indicates P < 0.01, and *** indicates P < 0.001. The results showed that NX-1607 treatment could reduce the levels of liver injury markers (ALT and AST) in the serum of MCD diet model mice.

[0041] After 6 weeks of treatment, RT-qPCR was used to detect the relative expression levels of liver fibrosis molecular markers αSMA gene and Col1a1 gene, with actin as the internal reference gene. The primer sequences used are shown in Table 1. Figure 4 , where ** indicates P < 0.01.

[0042] Table 1 RT-qPCR primers

[0043] Primer name Primer sequence (5'-3') mus-actin-F GGCTGTATTCCCCTCCATCG(SEQ ID NO.1) mus-actin-R CCAGTTGGTAACAATGCCATGT(SEQ ID NO.2) mus-αSMA-F CCCAGACATCAGGGGAGTAATGGG(SEQ ID NO.3) mus-αSMA-R TCTATCGGATACTTCAGCGTCA(SEQ ID NO.4) mus-Col1a1-F TGCTAACGTGGTTCGTGACCGT(SEQ ID NO.5) mus-Col1a1-R ACATCTTGAGGTCGCGGCATGT(SEQ ID NO.6)

[0044] The results showed that the relative expression levels of αSMA and Col1a1 genes, molecular markers of liver fibrosis in MCD diet model mice, decreased after NX-1607 treatment.

[0045] Example 3

[0046] A similar method to Example 2 was used, except that the MCD diet model mice constructed in Example 1 were replaced with the CCL4-induced model mice constructed in Example 1. The results are shown in Figures 5 to 8 , where ** indicates P < 0.01 and *** indicates P < 0.001.

[0047] The results showed that after NX-1607 treatment, the degree of liver fibrosis in CCL4-induced model mice was reduced, the levels of serum liver injury markers (ALT and AST) were reduced, and the relative expression levels of liver fibrosis molecular markers αSMA gene and Col1a1 gene were decreased.

[0048] Example 4

[0049] After stimulating the human hepatic stellate cell line LX2 with transforming growth factor-β (TGF-β, stimulating concentration of 10 ng / ml) and NX-1607 (stimulating concentration of 100 nM, solvent is 5 g / L sodium carboxymethyl cellulose solution) for 24 hours, the cells were collected and the total protein was extracted for Western Blot detection. The specific Western Blot detection method is as follows:

[0050] 1. Cell lysis and protein extraction

[0051] Wash the cells twice with pre-cooled PBS (phosphate buffer) to remove the residual culture medium. Add an appropriate amount of RIPA lysis buffer (containing protease inhibitors and phosphatase inhibitors), place on ice for 30 minutes, and mix once every 10 minutes. Centrifuge at 12,000×g, 4℃ for 15 minutes, and collect the supernatant, which is the total protein. Determine the protein concentration using the BCA protein quantification kit. Take 15μg of protein sample, add 5× protein loading buffer (SDS-PAGE Loading Buffer), and denature at 100℃ for 5 minutes.

[0052] 2. SDS-PAGE electrophoresis

[0053] Prepare 10% SDS-PAGE gel and polymerize the gel. Load the sample into the gel wells, add protein molecular weight marker, and perform electrophoresis (80V 30min, 120V 60min) until the protein is separated to the appropriate position.

[0054] 3. Protein transfer

[0055] The gel proteins were transferred to a PVDF membrane (0.22 μm) and wet-transferred (400 mA, 60 min).

[0056] 4. Blocking and Antibody Incubation

[0057] Block the membrane with 5% skim milk powder (room temperature, 2h). Add SMAD7 and GAPDH primary antibodies (antibody dilution ratio 1:1000) and incubate at 4°C overnight. Wash with TBST 3 times, 10 min each time. Add HRP-labeled secondary antibody (1:5000) and incubate at room temperature for 1h. Wash the membrane 3 times with TBST, 10 min each time.

[0058] 5. ECL color development and signal detection

[0059] Add ECL luminescent substrate to the membrane and incubate for 1 min in the dark. Use a chemiluminescent imaging system or X-ray film to detect protein bands. Perform normalization analysis of the target protein based on the band intensity of GAPDH.

[0060] Results Fig. 9 The results showed that NX-1607 promoted the expression of SMAD7 in hepatic stellate cells (0.91) compared with TGF-β stimulation (0.47).

[0061] In summary, the present invention provides a safe and effective small molecule anti-liver fibrosis drug NX-1607. NX-1607 can effectively alleviate liver fibrosis by promoting the expression of SMAD7, a key inhibitor of the TGF-β signaling pathway, and reducing the activation of hepatic stellate cells (HSC), thereby improving the deficiencies of current treatment methods.

[0062] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of the small molecule compound NX-1607 in the preparation of products for the treatment of liver fibrosis.

2. The use according to claim 1, characterized in that: The products include pharmaceuticals.

3. A drug for treating liver fibrosis, characterized in that: The active ingredients include the small molecule compound NX-1607; based on the body weight of mice, the unit dosage of the drug is 3 to 8 mg / kg body weight.

4. The drug according to claim 3, characterized in that Based on the body weight of mice, the unit dose of the drug is 5 mg / kg body weight.

5. The drug according to claim 3 or 4, characterized in that The medicine also includes auxiliary materials; the auxiliary materials include 5g / L sodium carboxymethyl cellulose solution.

Images