Preparation method of dairy cow placenta extract CP1 and application of dairy cow placenta extract CP1 as antioxidant substance

Abstract

The invention discloses a preparation method of a dairy cow placenta extract CP1 and application of the dairy cow placenta extract CP1 as an antioxidant substance. The preparation method comprises the following steps: taking normal delivery healthy Chinese Holstein dairy cow placenta homogenate as a substrate, shearing the dairy cow placenta into pieces, homogenizing by adopting a tissue homogenizer, adding papain, and acting for 4.7 hours under the conditions that the pH is 6.5 and the temperature is 55 DEG C; the antioxidative peptide has the advantages that the antioxidative peptide with five potential types is screened by the aid of virtual screening processes after the antioxidative peptide is inactivated in boiling water bath for 10 minutes, affinity of the antioxidative peptide with Keap1 after molecular docking is higher than that of TX6, the affinity of ANNGKQWAEVF with Keap1 is the strongest, accordingly, the antioxidative peptide is marked as CP1, the CP1 is excellent in free radical scavenging capacity, lipid peroxidation inhibition capacity, transition metal chelating capacity and reducing power, and the antioxidative peptide with the antioxidative peptide can be used for preparing antioxidative peptide products. In addition, a Keap1 / Nrf2 pathway in oxidative stress cells can be activated, so that the oxidative stress of the cells is relieved, and the compound can be applied as an antioxidant substance.

Description

Technical Field

[0001] The invention relates to the technical field of drug extraction, and in particular to a preparation method of a cow placenta extract CP1 and application of the cow placenta extract CP1 as an antioxidant. Background Art

[0002] Placental tissue contains a large number of biologically active substances, which have the effects of anti-oxidation, anti-fatigue, promoting metabolism, enhancing physiological functions and improving immunity. The traditional clinical utilization method of traditional Chinese medicine is to collect fresh placenta, steam and dry it, and grind it into medicine. In recent years, researchers have effectively improved the biological activity and total substance content of placental products by changing the steaming conditions and adding processing materials, but placental preparations with relatively single ingredients have not yet been prepared. Shen Liuhong et al. and Zhang Yue et al. used different proteases to hydrolyze cow placenta and predicted the antioxidant activity of the hydrolyzed products. They found that the peptides obtained after the hydrolysis of cow placenta have strong transition metal chelating ability, reducing power and scavenging ABTS free radicals. They can inhibit the oxidative stress of aging model mice by increasing the activity of antioxidant enzymes, delay skin aging and liver aging, and have good antioxidant function. However, these cow placenta extracts (CPE) are currently a mixture of polypeptides, and the cow placenta antioxidant peptide (CPAP) component that exerts antioxidant activity in CPE is still unclear. Therefore, the present invention uses virtual screening method to determine the potential CPAP in CPE through network analysis technology, and docks it and TX6 (positive control) with kelch-like ECH-associated protein 1 (Keap1) molecules, and selects the CPAP with the strongest affinity as CP1. It is also confirmed that CP1 extracted from cow placenta can be used as an antioxidant. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a preparation method of cow placenta extract CP1 and application of cow placenta extract CP1 as an antioxidant.

[0004] To achieve the above object, the technical solution of the present invention is as follows:

[0005] The first technical solution adopted by the present invention is a method for preparing cow placenta extract CP1, comprising the following steps:

[0006] Step 1, the cow placenta is cut into pieces and homogenized by a tissue homogenizer, papain is added, and the mixture is inactivated at pH 6.5 and 55°C for 4.7 hours, inactivated in a boiling water bath for 10 minutes, and then centrifuged, the supernatant is collected, and the mixture is freeze-dried and freeze-dried for later use, which is recorded as CPE; the proteins and peptides in CPE are identified by LC-MS / MS technology: the sample is separated by using the HPLC liquid phase system Easy-nLC with a nanoliter flow rate, and then the amino acid sequence of the polypeptide in CPE is analyzed by mass spectrometry using a Q Exactive mass spectrometer;

[0007] Step 2: The amino acid sequences of the CPE polypeptides obtained in step 1 were used to predict their antioxidant activity, stability, water solubility, toxicity and sensitization using AnOxPP (http: / / www.cqudfbp.net / AnOxPP / index.jsp), ProtParam (http: / / we-b.expasy.org / protparam / ), Innovagen (http: / / www.innovagen.com / proteomics-tools / ), ToxinPred (http: / / crdd.osdd.net / raghava / toxinpred / ) and AllerTOP (v.2.0) (https: / / www.ddgpharmfac.net / AllerTOP / ), and the top five polypeptides were screened as potential CPAPs.

[0008] Step 3. Further use the molecular docking method to screen CPAP. First, use ChemDraw19.0 software to draw the 3D structure of the potential CPAP, import it into the Discovery Studio 2019 client software, remove the hydrogen atoms as a ligand, and select TX6 (Pub Chem ID: 121488089) as a positive control. Secondly, download the Keap1 protein crystal structure (PDB ID: 2FLU) from the RCSB protein database (https: / / www.rcsb.org), import it into the Discovery Studio2019 client software, remove the ligand and water, add hydrogen and clean the protein, and use it as a receptor. After that, select the active center (x: 5, y: 9, z: 1, radius: ), and the "-CDOCKER" protocol was used for docking. Finally, CPAP was screened according to the -CDOCKER_INTE-RACTION_ENERGY (-CIE) score after docking, and was recorded as CP1;

[0009] Step 4, synthesizing CP1 by solid phase method according to the CP1 amino acid sequence, with a purity greater than 95%;

[0010] The cow placenta extract CP1 of the present invention is ANNGKQWAEVF (H-Ala-Asn-Asn-Gly-Lys-Gln-Trp-Ala-Glu-Val-Phe-OH), and its molecular formula is C 57 H 82 N 16 O 17 , with a molecular weight of 1263.38Da, and can be used as an antioxidant.

[0011] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0012] The following is a further detailed description of the above contents of the present invention through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies implemented based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the CPE LC-MS / MS detection result.

[0014] Figure 2 This is the interaction between peptide ANNGKQWAEVF and Keap1 (PDB ID: 2FLU).

[0015] Figure 3 CP1 liquid chromatography and secondary mass spectrometry.

[0016] Figure 4 The antioxidant activity of CP1 was detected by chemical method.

[0017] Figure 5 The effect of different concentrations of H2O2 on the activity of RAW264.7 cells.

[0018] Figure 6 Effects of CP1 on the viability of normal and oxidatively stressed RAW264.7 cells.

[0019] Figure 7 Effects of CP1 on antioxidant enzymes and MDA in RAW264.7 cells induced by oxidative stress.

[0020] Figure 8 The effect of CP1 on the antioxidant pathway of oxidative stress cells.

[0021] Fig. 9 is the DPPH free radical scavenging rate of CP1 under different conditions. DETAILED DESCRIPTION

[0022] Example 1 Preparation of Cow Placenta Extract CP1

[0023] 1 Materials and methods

[0024] 1.1 Materials and Instruments

[0025] 1.1.1 Materials and reagents

[0026] Cow placenta was collected from healthy cows that gave birth naturally in a large-scale ranch in Sichuan; 30DEAE cellulose ion exchange resin filler (L10W08KB), Nanovita Technology Co., Ltd.; Sephadex G25 gel filler (RH314160), Shanghai Roen Chemical Technology Co., Ltd.; sodium bicarbonate (144-55-8), sodium hydroxide (1310-73-2), sodium chloride (7647-14-5), Chengdu Cologne Chemical Co., Ltd.; hydrochloric acid (7647-01-0), Xilong Chemical Co., Ltd.; phosphate buffer (ST448), Shanghai Biyuntian Biotechnology Co., Ltd.; papain (G8430), Solarbio, USA; DPPH micro kit (R27137), Shanghai Yuanye Biotechnology Co., Ltd.; formic acid (695076) and acetonitrile (34851), Sigma, USA.

[0027] 1.1.2 Test instruments and equipment

[0028] Pen pH meter (PH828), Dongguan Wanchuang Electronic Products Co., Ltd.; tissue homogenizer (FSH-2A), Changzhou Yuexin Instrument Manufacturing Co., Ltd.; electronic balance (JM-A30002), Zhuji Chaoze Weighing Equipment Co., Ltd.; constant temperature water bath (HH-S4A), Beijing Kewei Yongxing Instrument Co., Ltd.; vacuum freeze dryer (SCIENTZ-10N-A), Ningbo Xinzhi Freeze Drying Equipment Co., Ltd.; desktop high-speed refrigerated centrifuge (TGL-16.5M), Shanghai Lu Xiangyi Centrifuge Instrument Co., Ltd.; high performance liquid chromatograph (Waters2695), Waters Company, USA; ultra-micro spectrophotometer (Nano Drop OneC), high performance liquid chromatograph (Easy-nLC 1200), mass spectrometer (Q Exactive combined quadrupole Orbitrap), multi-function fluorescence chemiluminescence analyzer (Varioskan Flash), Thermo Fisher Scientific, USA.

[0029] 1.2 Test methods

[0030] 1.2.1 Preparation of bovine placenta extract

[0031] The cow placenta was cut into pieces and homogenized with a tissue homogenizer, and papain was added. It was inactivated for 4.7 hours at pH 6.5 and 55°C, and then centrifuged after being inactivated in a boiling water bath for 10 minutes. The supernatant was collected and freeze-dried, which was recorded as CPE and freeze-dried for later use. The proteins and peptides in CPE were identified using LC-MS / MS technology: the sample was separated using the HPLC liquid phase system Easy-nLC with a nanoliter flow rate, and then mass spectrometry analysis was performed using a Q Exactive mass spectrometer, which was repeated three times.

[0032] 1.2.2 Isolation of antioxidant peptides using virtual screening and chromatography

[0033] (1) Virtual screening method to separate CPAP

[0034] The amino acid sequences of the peptides in CPE were used to predict their antioxidant activity, stability, water solubility, toxicity and sensitization using AnOxPP (http: / / www.cqudfbp.net / AnOxPP / index.jsp), ProtParam (http: / / we-b.expasy.org / protparam / ), Innovagen (http: / / www.innovagen.com / proteomics-tools / ), ToxinPred (http: / / crdd.osdd.net / raghava / toxinpred / ) and AllerTOP (v.2.0) (https: / / www.ddgpharmfac.net / AllerTOP / ), and the top five peptides were screened as potential CPAPs.

[0035] CPAP was further screened using molecular docking. First, the 3D structure of the potential CPAP was drawn using ChemDraw19.0 software, imported into Discovery Studio 2019 client software, and used as a ligand after removing hydrogen atoms, and TX6 (Pub Chem ID: 121488089) was selected as a positive control. Secondly, the Keap1 protein crystal structure (PDB ID: 2FLU) was downloaded from the RCSB protein database (https: / / www.rcsb.org), imported into Discovery Studio2019 client software, and used as a receptor after removing ligands and water, adding hydrogen, and cleaning the protein. After that, the active center (x: 5, y: 9, z: 1, radius: ), and the “-CDOCKER” protocol was used for docking. Finally, CPAP was screened according to the -CDOCKER_INTE-RACTION_ENERGY (-CIE) score after docking and recorded as CP1.

[0036] 1.2.3 Synthetic cow placenta antioxidant peptides

[0037] According to the CP1 amino acid sequence, CP1 was synthesized by solid phase method with a purity greater than 95%.

[0038] 1.3 Data Analysis

[0039] SPSS26.0 software was used for statistical analysis, and the mean ± standard deviation of each index was calculated. Dunnett's T3 method was used for significance analysis. P>0.05 indicated no significant difference, P<0.05 indicated significant difference, and P<0.01 indicated extremely significant difference. GraphPad Prism 9.0.0 software was used for drawing.

[0040] 2 Results and analysis

[0041] 2.1 CPE component test results

[0042] CPE LC-MS / MS test results are as follows Figure 1 As shown, the peaks of the three CPE samples all appeared below 400 m / z, and the waveforms were similar, indicating that the CPE preparation method used had good repeatability. After removing duplicates, a total of 128 peptides were determined, with relative molecular weights below 3000u, peptide lengths concentrated in 7-25, and derived from 85 proteins.

[0043] 2.1 Isolation of CP1 by virtual screening

[0044] There are 128 peptides in CPE. After the prediction of antioxidant activity, water solubility, stability, sensitization and toxicity, it was found that 68.75% of the peptides had antioxidant activity, 43.75% of the peptides had good stability, 68.75% of the peptides had good water solubility, 53.91% of the peptides were non-sensitizing, and 100% of the peptides were non-toxic. The top five peptides in terms of physicochemical properties were screened as potential CPAPs (as shown in Table 1) for molecular docking. By comparing with the known functional bioactive peptides in the BIOPEP-UWM database (https: / / biochemia.uwm.edu.pl / biopep-uwm / ), it was found that these five peptides were all new bioactive peptides.

[0045] Table 1 Prediction results of peptide physicochemical properties

[0046]

[0047] Molecular docking can be used to determine the binding affinity between CPAP and Keap1 and screen CPAP. As shown in Table 2, the -CIE values ​​of the five peptides are 109.87, 109.32, 105.85, 105.81, and 51.94 kJ / mol, respectively, which are all higher than the -CIE value of the positive control TX6 (25.58 kJ / mol), indicating that the affinity of the five peptides to Keap1 is higher than that of TX6, and ANNGKQWAEVF has the strongest affinity. Figure 2 It can be seen that ANNGKQWAEVF can compete with Nrf2 for binding sites by occupying the area above the central cavity of the Keap1 Kelch domain ( Figure 2 A, docking 3D structure diagram); ANNGKQWAEVF forms hydrogen bond interactions through 13 amino acid residues including TYR334, ALA366, ARG380, forms hydrophobic interactions with LEU557, IE559, TYR572 amino acid residues, forms electrostatic interactions with ARG415 amino acid residues, and occupies 3 key sites ( Figure 2 B, docking 2D structure diagram), indicating that ANNGKQWAEVF is stably bound to Keap1. Therefore, ANNGKQWAEVF (H-Ala-Asn-Asn-Gly-Lys-Gln-Trp-Ala-Glu-Val-Phe-OH) was selected as CP1, and its molecular formula is C 57 H 82 N 16 O 17 , molecular weight is 1263.38Da.

[0048] Table 2 Peptide molecular docking results

[0049]

[0050] 2.2 Purity analysis of synthetic antioxidant peptides

[0051] After solid phase synthesis of CP1, its liquid chromatogram and mass spectrum are as follows Figure 3 As shown, it was found that the component with the highest purity in the synthetic products was CP1, and the purity was greater than 95%.

[0052] Example 2 Antioxidant activity application of cow placenta extract CP1

[0053] 1 Materials and methods

[0054] 1.1 Materials and Instruments

[0055] 1.1.1 Materials and reagents

[0056] CP1(ANNGKQWAEVF, molecular formula C 57 H 82 N16 O 17 , molecular weight 1263.38Da), solid phase synthesis, purity greater than 95%; control drug is Vit C (53219860), Sinopharm Chemical Reagent Co., Ltd.;

[0057] RAW264.7 cells were kindly provided by the Pathology Laboratory of Sichuan Agricultural University; the culture medium was RAW264.7-specific culture medium (CM-0190) provided by Wuhan Pronocell Life Science Co., Ltd.

[0058] Ferrozine (A601542), Shanghai Shenggong Biotechnology Co., Ltd.; DPPH micro kit (R27137), Shanghai Yuanye Biotechnology Co., Ltd.; hydrochloric acid (7647-01-0), Xilong Chemical Co., Ltd.; EDTA-Na2 (53219860), thiobarbituric acid (30178034), ferrous sulfate heptahydrate (10012116), ammonium acetate (631-61-8), Acetic acid (64-19-7), isopropanol (67-63-0), methanol (67-56-1), Sinopharm Chemical Reagent Co., Ltd.; salicylic acid (69-72-7), H2O2 (7722-84-1), ethanol (64-17-5), ferric chloride (10025-77-1), lecithin (8030-76-0), Chengdu Kelong Chemical Co., Ltd.; TBTZ (MC152L), SOD ELISA kit (ml643059), CAT ELISA (ml037752) kit, GSH-Px ELISA kit (ml058194), MDAELISA kit (ml094962), Shanghai ELISA Biotechnology Co., Ltd.; phosphate buffer (ST448), Shanghai Bio-Technology Co., Ltd.; MTS cell kit (G3580), Promega (Beijing) Biotechnology Co., Ltd.; RNA extraction solution (G3013), chloroform substitute (G3014), RNA dissolution solution (G3029), reverse transcription kit (G3337), MIX (G3326), RIPA lysis solution (G2002), BCA protein quantification kit (G2026), 5× reduced protein loading buffer (G2013), SDS-PAGE gel preparation kit (G2003), protein Marker (G2083), PVDF membrane (WGPVDF45), ECL chemiluminescence kit (G2014), electrophoresis buffer (G2081), TBS buffer (G0001), Wuhan Sewell Biotechnology Co., Ltd.

[0059] 1.1.2 Instruments and equipment

[0060] Electronic balance (JM-A30002), Zhuji Chaoze Weighing Equipment Co., Ltd.; electric constant temperature water bath (HH-S4A), Beijing Kewei Yongxing Instrument Co., Ltd.; inverted microscope (TS100-F), Nikon, Japan; ultra-low temperature refrigerator (88500V), multi-function fluorescence chemiluminometer (Varioskan Flash), Thermo Fisher Scientific, USA; fluorescence quantitative PCR instrument (CFX Connect), Bio-Rad, USA; clean bench (SW-CJ-1FD), Suzhou Antai Air Technology Co., Ltd.; magnetic stirrer (MS-150), decolorization shaker (DS-3D100), vertical electrophoresis instrument (SVE-2), electrophoresis power supply (SPW-6S), antibody incubation box (G9055-4), chemiluminometer (6100), Wuhan Sewell Biotechnology Co., Ltd.

[0061] 1.2 Test methods

[0062] 1.2.1 Chemical method for detecting antioxidant activity of CP1

[0063] (1) Detection of hydroxyl radical scavenging rate of CP1

[0064] CP1 and Vit C solutions were used as test solutions, and were recorded as CP1 group and control group, respectively. 300 μL of 9 mmol / L ferrous sulfate solution and 300 μL of 8 mmol / L H2O2 were added to 1 mL of test solution (concentrations were 0, 0.125, 0.25, 0.50, 1.00, 2.00 mg / mL), shaken, allowed to stand for 10 min, 300 μL of 9 mmol / L salicylic acid ethanol solution prepared with 50% ethanol was added, incubated at 37°C for 30 min, cooled to room temperature, and the absorbance was measured at 510 nm, recorded as A1. Distilled water was used to replace H2O2, and the absorbance was measured, recorded as A2; distilled water was used to replace ferrous sulfate solution and H2O2, and the absorbance was measured, recorded as A0. The hydroxyl radical scavenging rate was calculated according to the formula. Hydroxyl radical scavenging rate (%) = (A0-A1+A2) / A0×100.

[0065] (2) Detection of DPPH free radical scavenging rate of CP1

[0066] CP1 and Vit C solutions were used as test solutions, and were recorded as CP1 group and control group, respectively. 100 μL of the test solution (concentrations were 0, 0.125, 0.25, 0.50, 1.00, 2.00 mg / mL) was mixed with 100 μL of 0.2 mmol / L DPPH solution, placed at 37°C in the dark for 30 min, and the absorbance was measured at 517 nm, which was recorded as A1. Distilled water was used to replace the test solution, and the absorbance was measured, which was recorded as A0. Calculate the DPPH free radical scavenging rate: DPPH free radical scavenging rate (%) = (A0-A1) / A0×100.

[0067] (3) Detection of lipid peroxidation inhibition rate of CP1

[0068] CP1 and Vit C solutions were used as test solutions, and were recorded as CP1 group and control group, respectively. 1 mL of lecithin solution (30 mg of lecithin, dissolved in 3 mL of 10 mmol / L pH = 7.4 phosphate buffer) was added to 1 mL of test solution (concentrations were 0, 0.25, 0.50, 1.00, 2.00, 4.00 mg / mL), mixed, and then 1 mL of 0.4 mmol / L ferric chloride was added, and incubated at 37°C for 60 min. After incubation, 2 mL of TCA-TBA-HCl solution (15 g of trichloroacetic acid, 0.37 g of thiobarbituric acid and 2 mL of concentrated hydrochloric acid were dissolved in ultrapure water and fixed to 100 mL) was added, cooled after boiling in a water bath for 15 min, centrifuged at 6000 r / min for 10 min, and the supernatant was taken to measure the absorbance at 532 nm, which was recorded as A1. Ultrapure water was used to replace the test solution, and the absorbance was measured, which was recorded as A0. The lipid peroxidation inhibition rate was calculated according to the formula: Lipid peroxidation inhibition rate (%) = (A0-A1) / A0×100.

[0069] (4) Detection of transition metal ion chelation rate of CP1

[0070] CP1 and EDTA-Na2 solutions were used as test solutions, and were recorded as CP1 group and control group, respectively. Take 10 μL of 4 mmol / L ferrous sulfate solution and add it to 500 μL of test solution (concentration is 0, 0.25, 0.50, 1.00, 2.00, 4.00 mg / mL), mix well, react at room temperature for 3 minutes, then add 10 μL of 20 mmol / L ferroxine solution, mix well, react at room temperature in the dark for 10 minutes, and use a spectrophotometer to measure the absorbance at 562 nm, which is recorded as A1. Use distilled water instead of the test solution, measure the absorbance, and record it as A0. Calculate the transition metal ion chelation rate: transition metal chelation rate (%) = (A0-A1) / A0×100.

[0071] (5) Detection of the reducing power of CP1

[0072] CP1 and Vit C solutions were used as test solutions, and were recorded as CP1 group and control group, respectively. Take 0.51g sodium acetate to 2mL glacial acetic acid, dilute to 25mL, as working solution 1; take 0.078g TPTZ powder, add 83μL concentrated hydrochloric acid, dilute to 25mL with distilled water, as working solution 2; weigh 0.162g ferric chloride to 30mL distilled water, shake well, as working solution 3. Working solutions 1, 2, and 3 were mixed in a volume ratio of 10:1:1 to prepare FRAP working solution. Take 0.5mL of the test solution (concentrations of 0, 0.50, 1.00, 2.00, 4.00, 8.00mg / mL), add 3mL of FRAP working solution, shake well, heat in a constant temperature water bath at 37℃ for 10min, and measure the absorbance at 593nm, which is recorded as A1. Replace the test solution with distilled water, measure the absorbance, and record it as A0. Calculate the reducing power: reducing power = A1-A0.

[0073] 1.2.2 RAW264.7 cell recovery and culture

[0074] The cell cryopreservation tube was taken out from the ultra-low temperature refrigerator and immediately placed in a 37°C constant temperature water bath to thaw. After there was no ice residue in the tube, centrifuged at 1500r / min for 5min, and then the cryopreservation tube was opened under a sterile environment to remove the precipitate and resuspend it in complete culture medium to prepare a cell suspension.

[0075] The RAW264.7 cell suspension was cultured in a constant temperature incubator at 37°C, 95% O2 and 5% CO2. When the cell density exceeded 70% under an inverted microscope, the cells were passaged at a ratio of 1:3. During the passage process, the cells were blown with a 1 mL pipette to separate the cells from the culture dish, and the use of trypsin was avoided to prevent cell differentiation.

[0076] 1.2.3 Establishment of RAW264.7 cell oxidative stress model

[0077] (1) Inoculation: Take cells that are in the logarithmic growth phase and in good growth condition and inoculate them at 5×10 cells per well. 4 The cells were inoculated at a density of 100 μL / mL in a 96-well plate with an inoculation volume of 100 μL. The culture medium was discarded after culturing for 12 h.

[0078] (2) Grouping: A blank group (Group C) and a model group (Group M) were set up. 100 μL of complete culture medium was added to Group C, and 100 μL of complete culture medium containing 250, 300, 350, 400, and 450 μmol / L H2O2 was added to Group M. After 6 hours of continuous culture, the culture medium was discarded.

[0079] (3) Calculation of cell survival rate: The survival rate of RAW264.7 cells was determined by the MTS method. 10 μL of MTS detection solution was added to each well. After incubation in the dark for 2 h, the absorbance of each well at 490 nm was measured by an ELISA instrument. The absorbance of group M was recorded as A1, and the absorbance of group C was recorded as A2. The cell survival rate was calculated according to the formula, and the H2O2 concentration when the cell survival rate was close to 50% was selected as the modeling concentration for subsequent experiments. Cell survival rate % = A1 / A2×100.

[0080] 1.2.4 Effect of CP1 on the survival rate of normal RAW264.7 cells

[0081] (1) Vaccination: Same as 1.2.3.

[0082] (2) Grouping: C group and CP1 group were set up. 100 μL of complete culture medium was added to C group; 100 μL of complete culture medium containing CP1 was added to CP1, with final concentrations of 1.25, 2.5, 5, 10, 20, and 40 μg / mL. After culturing for 24 hours, the culture medium was discarded.

[0083] (3) Calculation of cell survival rate: Same as 1.2.3 (3). The absorbance of the CP1 group is recorded as A1, and the absorbance of the C group is recorded as A2. Calculate the cell survival rate and select the concentration range that has no inhibitory effect on the survival rate of RAW264.7 cells for the detection in 1.2.5.

[0084] 1.2.5 Effect of CP1 on the survival rate of RAW264.7 cells induced by oxidative stress

[0085] (1) Vaccination: Same as 1.2.3.

[0086] (2) Grouping: C group, M group and CP1 group were set up. 100 μL complete medium was added to C group, and 100 μL complete medium containing 400 μmol / L H2O2 was added to M group and CP1 group. After 6 hours of continuous culture, the medium was discarded. Then 100 μL complete medium was added to C group and M group; 100 μL complete medium containing CP1 was added to CP1 group, with final concentrations of 1.25, 2.5, 5, 10, and 20 μg / mL. After 24 hours of continuous culture, the medium was discarded.

[0087] (3) Calculation of cell survival rate: Same as 1.2.3(3). The absorbance of group M and CP1 is recorded as A1, and the absorbance of group C is recorded as A2. The cell survival rate is calculated according to the formula, and the optimal concentration of CP1 to alleviate oxidative stress in RAW264.7 cells is selected for detection in 1.2.6.

[0088] 1.2.6 Effects of cow placental antioxidant peptides on antioxidant-related indicators in oxidative stress cells

[0089] (1) Inoculation: Take cells that are in the logarithmic growth phase and in good growth condition and inoculate them at 1×10 per well. 6 The cells were inoculated at a density of 1000 μg / mL in a 6-well plate with an inoculation volume of 2000 μL. The culture medium was discarded after culturing for 12 h.

[0090] (2) Grouping: C group, M group and CP1 group were set up. 2000 μL complete medium was added to C group, and 2000 μL complete medium containing 400 μmol / L H2O2 was added to M group and CP1 group. After 6 hours of continuous culture, the medium was discarded. Then 2000 μL complete medium was added to C group and M group, and 2000 μL complete medium containing 20 μg / mL CP1 was added to CP1 group. After 24 hours of continuous culture, the medium was discarded.

[0091] (3) Determination of cell antioxidant indexes: After washing three times with phosphate buffer, the cell suspension was collected with phosphate buffer for detection of antioxidant pathway genes and proteins in 1.2.7 and 1.2.8. The intracellular levels of SOD, CAT, GSH-Px and MDA were detected according to the instructions of the ELISA kit.

[0092] 1.2.7 Detection of relative expression of Keap1, Nrf2 and HO-1 mRNA

[0093] (1) Extracting RNA: Use RNA extraction solution to extract the intracellular RNA in 1.2.6.

[0094] (2) Reverse transcription: Perform reverse transcription on ice according to the instructions of the reverse transcription kit.

[0095] (3) Primer design: Primers were designed using primer 5 software and species-specific primer alignment was performed using the NCBI Primer-Blast system. HO-1 gene upstream primer: GCTAAGACCGCCTTCC-TGCT, downstream primer: ACGAAGTGACGCCATCTGTGA; Nrf2 gene upstream primer: TGTCTTAATACCGAAAACAAGCAGC, downstream primer: GACCACAGTTGCCCACTT-CTTTT; Keap1 upstream primer: CAGATTGACAGCGTGGTTCG, downstream primer: TGCGGGCAGTCGTATTTGA; GAPDH upstream primer: CCTCGTCCCGTAGACAA-AATG, downstream primer: TGAGGTCAATGAAGGGGTCGT.

[0096] (4) Detection: Take 0.1mL PCR reaction plate, add 7.5μL Mix, 1.5μL upstream and downstream primers, 2.0μL cDNA and 4.0μL sterile water to each well. Amplification conditions: pre-denaturation at 95℃ for 30s; denaturation at 95℃ for 15s; annealing at 60℃ for 30s; 40 cycles. GAPDH was used as the internal reference gene, and 2 -ΔΔCT Methods Analytical data.

[0097] 1.2.8 Detection of Keap1, Nrf2 and HO-1 protein expression

[0098] Take the cell suspension in 1.2.6 and lyse the cells with RIPA lysis buffer on ice at 4℃. Measure the protein concentration of each group according to the instructions of the BCA protein concentration assay kit. Use SDS-PAGE gel electrophoresis to separate, transfer and block, add primary antibody, incubate overnight, add secondary antibody, incubate at room temperature for 30 minutes, wash with TBST buffer, and observe with a chemiluminescence instrument.

[0099] 1.2.9 Effects of temperature, pH, and digestion environment on the antioxidant activity of CP1

[0100] (1) Determine the effect of temperature on the antioxidant activity of CP1.

[0101] Place 1 mL of 2.00 mg / mL CP1 solution in a 2 mL centrifuge tube and divide it into 4 groups. Heat them in a water bath at 25°C, 50°C, 70°C, and 90°C for 1 h, then quickly cool them in an ice water bath. Finally, determine and calculate the DPPH free radical scavenging rate according to the method in 1.2.1 (2).

[0102] (2) Determine the effect of pH on the antioxidant activity of CP1.

[0103] Place 1 mL of 2.00 mg / mL CP1 solution in a 2 mL centrifuge tube and divide it into 5 groups. Use 1 mol / L hydrochloric acid and sodium hydroxide solution to adjust the pH value of each group to 3, 5, 7, 9, and 11, respectively. After reacting at room temperature for 2 h, use 1 mol / L sodium hydroxide and hydrochloric acid solution to adjust the pH value to 7. Finally, determine and calculate the DPPH free radical scavenging rate according to the method in 1.2.1 (2).

[0104] (3) Determine the effect of digestive environment on the antioxidant activity of CP1.

[0105] 1 mL of 2.00 mg / mL CP1 solution was placed in 2 mL centrifuge tubes and divided into a non-digestion group (N group), a gastric digestion group (G group), and a gastrointestinal digestion group (GI group).

[0106] Group N: Take CPAP solution without any treatment. Determine and calculate the DPPH free radical scavenging rate according to the method in 1.2.1(2).

[0107] Group G: 4% pepsin solution was added to the CPAP solution, and the pH value was adjusted to 2 with 1 mol / L hydrochloric acid solution. The solution was reacted in a 37°C water bath for 2 h to simulate gastric digestion. After digestion, the solution was placed in a boiling water bath for 10 min to terminate gastric digestion. The DPPH free radical scavenging rate was determined and calculated according to the method in 1.2.1(2).

[0108] GI group: After the CPAP solution was digested in the stomach according to the operation procedure of group G, the pH value was adjusted to 5.3 with 0.9 mol / L sodium bicarbonate, and then to 7.5 with 1 mol / L sodium hydroxide. Trypsin was added according to the 4% polypeptide content, and intestinal digestion was simulated in a 37°C water bath. After the reaction for 1 hour, the solution was taken out and boiled in a water bath for 10 minutes to terminate intestinal digestion. The DPPH free radical scavenging rate was determined and calculated according to the method in 1.2.1(2).

[0109] 1.3 Data Analysis

[0110] SPSS26.0 software was used for statistical analysis, and the mean ± standard deviation of each index was calculated. Dunnett's T3 method was used for significance analysis. P>0.05 indicated no significant difference, P<0.05 indicated significant difference, and P<0.01 indicated extremely significant difference. GraphPad Prism 9.0.0 software was used for drawing. Compared with group C, "#" and "##" represent P<0.05 and P<0.01, respectively. Compared with group M, "*" and "**" represent P<0.05 and P<0.01, respectively.

[0111] 2 Results and analysis

[0112] 2.1 Chemical detection of CP1 antioxidant activity

[0113] Depend on Figure 4 It can be seen that the hydroxyl radical and DPPH free radical scavenging rates, lipid peroxidation inhibition rate, transition metal chelation rate and reducing power of CP1 increased with the increase of sample concentration, but its hydroxyl radical and DPPH free radical scavenging rates, lipid peroxidation inhibition rate and reducing power were significantly lower than those of Vit C, and its transition metal chelation rate was significantly lower than that of EDTA-Na2 (P<0.01). 50 The DPPH free radical scavenging rate IC 50 The transition metal chelation capacity IC is 1.01 mg / mL. 50 The IC value of lipid peroxidation inhibition rate is 2.68 mg / mL. 50 The value is 1.95 mg / mL, and the reducing power is 0.66 at 8 mg / mL. Therefore, CP1 has good free radical scavenging ability, lipid peroxidation inhibition ability, transition metal chelating ability and reducing power.

[0114] 2.2 Effect of H2O2 on the survival rate of RAW264.7 cells

[0115] The MTS method was used to determine the effects of different concentrations of H2O2 on the activity of RAW264.7 cells (see Figure 5 ), the cell survival rate decreased with the increase of H2O2 concentration. When the H2O2 concentration was 200μmol / L, the cell survival rate was higher than 90.00%, which was not significantly different from group C (P>0.05). When the H2O2 concentration was 250μmol / L, the cell survival rate was higher than 80.00%, which was significantly different from group C (P<0.05). When the H2O2 concentration was 300-450μmol / L, the cell survival rate was significantly different from group C (P<0.01). Among them, when the H2O2 concentration was 400μmol / L, the cell survival rate dropped to 48.34±2.75%. At this time, the cells reached the damage requirements and had a certain vitality, which met the requirements of the oxidative stress model. Therefore, 400μmol / L was selected as the concentration of H2O2 to induce oxidative stress in RAW264.7 cells.

[0116] Effect of 2.3CP1 on the survival rate of normal and oxidatively stressed RAW264.7 cells

[0117] The MTS method was used to determine the effects of different concentrations of CP1 on the activity of normal RAW264.7 cells. Figure 6 A. When the CP1 concentration was 1.25-20.00 μg / mL, the cell survival rate was not significantly different from that of group C (P>0.05). At 40.00 μg / mL, the cell survival rate was significantly lower than that of group C (P<0.01). Therefore, 1.25-20.00 μg / mL was selected as the concentration range for CP1 to protect RAW264.7 cells. The effects of different concentrations of CP1 on the activity of RAW264.7 cells under oxidative stress are shown in the following table. Figure 6 B. After culturing oxidatively stressed RAW264.7 cells with CP1, the cell survival rate increased with the increase of CP1 concentration. After culturing with 1.25μg / mL CP1, the cell survival rate was not significantly different from that of the M group (P>0.05); after culturing with 2.50-20.00μg / mL CP1, the cell survival rate was significantly higher than that of the M group (P<0.01). After culturing with 20.00μg / mL CP1, the cell survival rate recovered to the highest level, which was 76.37±4.49%. Therefore, 20.00μg / mL was selected as the concentration of CP1 to alleviate oxidative stress in RAW264.7 cells.

[0118] Effects of 2.4CP1 on antioxidant indices of oxidative stress RAW264.7 cells

[0119] like Figure 7As shown in the results, after H2O2 induction, the levels of antioxidant enzymes SOD, CAT and GSH-Px in RAW264.7 cells were extremely significantly decreased, and the level of MDA was extremely significantly increased (P<0.01). After CP1 culture, the levels of SOD and CAT in cells were extremely significantly higher than those in the M group (P<0.01), and the levels of SOD and CAT were restored to 77.43±5.03ng / mL and 1481.94±46.27pg / mL, respectively; the levels of GSH-Px were significantly higher than those in the M group (P<0.05), and were restored to 82.49±11.09ng / mL, respectively; the levels of MDA were extremely significantly and significantly lower than those in the M group, and dropped to 25.54±2.74nmol / mL (P<0.01). The results showed that CP1 could increase the levels of antioxidant enzymes in oxidative stress cells, reduce the level of MDA, and protect cells from oxidative stress.

[0120] Effects of 2.5CP1 on antioxidant pathways in oxidatively stressed RAW264.7 cells

[0121] like Figure 8 As shown in the figure, H2O2 can significantly increase the expression of Keap1 gene and protein in RAW264.7 cells (P<0.01), and significantly decrease the expression of Nrf2 and HO-1 genes and proteins (P<0.01). However, CP1 culture can significantly reduce the expression of Keap1 gene (P<0.01) ( Figure 8 A), and significantly increased the expression of Nrf2 and HO-1 genes (P<0.01) ( Figure 8 B, C). At the same time, CP1 significantly reduced the expression of Keap1 protein (P<0.01) and significantly increased the expression of Nrf2 and HO-1 proteins (P<0.01) ( Figure 8 D, E), which is consistent with the gene expression results. This indicates that CP1 can activate the Keap1 / Nrf2 pathway in RAW2664.7 cells with oxidative stress, thereby alleviating the oxidative stress of RAW264.7 cells.

[0122] 2.6 Effects of temperature, pH, and digestion environment on the antioxidant activity of CP1

[0123] like Fig. 9 As shown in the results, the CP1 DPPH radical scavenging rate decreased with the increase of temperature, and the CP1 DPPH radical scavenging rate was significantly different at different temperatures (P<0.05); at 25-50℃, 50-70℃ and 70-90℃, the CP1 radical scavenging rate decreased by 18.28%, 52.32% and 39.60%, respectively. The results showed that temperature can affect the antioxidant activity of CP1, and its antioxidant activity is optimal at 25℃ ( Fig. 9 A). Fig. 9As shown in B, the CP1 DPPH free radical scavenging rate decreased with the increase of acidity and alkalinity. The CP1 free radical scavenging rate was significantly different at different pH values ​​(P<0.05). When the pH values ​​were 7-5, 5-3, 7-9, and 9-11, the CP1 free radical scavenging rate decreased by 34.00%, 40.60%, 72.41%, and 34.17%, respectively. The results showed that acidity and alkalinity would affect the antioxidant activity of CP1, and its antioxidant activity was best at pH=7. Fig. 9 As shown in Figure C, the CP1 DPPH radical scavenging rate decreased as it was digested and decomposed. The CP1 radical scavenging rates in the G and GI phases were significantly lower than those in the N phase (P<0.01). The CP1 radical scavenging rates in the G phase decreased by 82.31%, and in the GI phase, the CP1 radical scavenging rates decreased by 89.15%. The results showed that gastric digestion and gastrointestinal digestion affect the antioxidant activity of CP1, and its antioxidant activity is best in a non-digestive environment.

Claims

1. A method for preparing cow placenta extract CP1 and application of cow placenta extract CP1 as an antioxidant, characterized in that: The steps include: Step 1, the cow placenta is cut into pieces and homogenized by a tissue homogenizer, papain is added, and the mixture is inactivated at pH 6.5 and 55°C for 4.7 hours, inactivated in a boiling water bath for 10 minutes, and then centrifuged, the supernatant is collected, and the mixture is freeze-dried and freeze-dried for later use, which is recorded as CPE; the proteins and peptides in CPE are identified by LC-MS / MS technology: the sample is separated by using the HPLC liquid phase system Easy-nLC with a nanoliter flow rate, and then the amino acid sequence of the polypeptide in CPE is analyzed by mass spectrometry using a Q Exactive mass spectrometer; Step 2: The amino acid sequences of the polypeptides in CPE obtained in step 1 were used to predict their antioxidant activity, stability, water solubility, toxicity and sensitization through AnOxPP (http: / / www.cqudfbp.net / AnOxPP / index.jsp), ProtParam (http: / / we-b.expasy.org / protparam / ), Innovagen (http: / / www.innovagen.com / proteomics-tools / ), ToxinPred (http: / / crdd.osdd.net / raghava / toxinpred / ) and AllerTOP (v.2.0) (https: / / www.ddgpharmfac.net / AllerTOP / ), and the top five polypeptides were screened as potential CPAPs; Step 3: Further screening of CPAP using molecular docking method; first, the 3D structure of potential CPAP was drawn using ChemDraw19.0 software, imported into Discovery Studio 2019 client software, and used as a ligand after removing hydrogen atoms, and TX6 (Pub Chem ID: 121488089) was selected as a positive control; secondly, the Keap1 protein crystal structure (PDB ID: 2FLU) was downloaded from the RCSB protein database (https: / / www.rcsb.org), imported into Discovery Studio 2019 client software, and used as a receptor after removing ligands and water, adding hydrogen and cleaning the protein; then, the active center (x: 5, y: 9, z: 1, radius: ), and the "-CDOCKER" protocol was used for docking; finally, CPAP was obtained according to the -CDOCKER_INTE-RACTION_ENERGY (-CIE) score after docking, and was recorded as CP1; Step 4: According to the CP1 amino acid sequence, CP1 is synthesized by solid phase method with a purity greater than 95%.

2. The cow placenta extract CP1 obtained by the extraction method described in claim 1 is ANNGKQWAEVF (H-Ala-Asn-Asn-Gly-Lys-Gln-Trp-Ala-Glu-Val-Phe-OH), and its molecular formula is C 57 H 82 N 16 O 17 , molecular weight is 1263.38Da.

3. Use of the cow placenta extract CP1 obtained according to the extraction method described in claim 1 as an antioxidant.

Images