Coronavirus-like protein delivery system and preparation method and application thereof

Abstract

The embodiment of the invention discloses a coronavirus-like protein delivery system as well as a preparation method and application thereof. Based on the basic principle of protein supramolecules, a protein cage Encap is taken as a research object, Encap is taken as a protein capsid to realize encapsulation of therapeutic protein such as IFN-alpha in Encap self-assembled protein, a chemical click strategy is utilized to realize external modification of targeting peptide LinTT1 on Encap, and the constructed coronavirus-like protein delivery system has blood brain barrier penetrability and can be used for preparing a targeted protein delivery system. The protein delivery system realizes targeted therapy of cancer cells, prolongs the half-life period of the therapeutic protein, opens up a new path for in-vivo delivery of the therapeutic protein, and has the advantages of low production cost, batch production and good application prospect.

Description

Technical Field

[0001] The embodiments of the present invention relate to the field of biomedical technology, and specifically to a coronavirus-like protein delivery system and a preparation method and application thereof. Background Art

[0002] In current biomedical research, the development of therapeutic strategies for cancer is an extremely challenging task. Cancer is a complex disease characterized by rapid cell proliferation, high invasiveness, and resistance to treatment. Interferon-α (IFN-α), as a therapeutic protein with antiviral, antiproliferative, and immunomodulatory effects, has shown potential application value in the treatment of a variety of tumors. However, due to its molecular weight and polarity issues, IFN-α is difficult to penetrate physiological barriers such as the blood-brain barrier (BBB), which greatly limits the efficacy of the drug. Therefore, the development of an effective drug delivery system that can penetrate physiological barriers and target cancer cells is key to improving the therapeutic effect.

[0003] In the field of drug delivery, engineered synthetic polymers and liposomes have been widely used as the main nanocarriers due to their unique physicochemical properties and biocompatibility. Despite their many advantages, they still face significant obstacles in targeting specific cancer types. The variability of polymer chain length and the inconsistency of lipid bilayer composition in liposomes lead to structural heterogeneity. This heterogeneity affects biocompatibility, especially when nanocarriers are manufactured using various methods such as thin film hydration and reverse evaporation. In addition, as artificial synthetic constructs, both engineered polymers and liposomes have chemical structures that are different from naturally occurring molecules in the body. In particular, synthetic polymers exhibit a series of surface functional groups that easily attract protein adsorption. This leads to the formation of a "protein corona", which can be recognized by the immune system. Once recognized, the immune system may regard these nanocarriers as foreign bodies and trigger an immune response. This response may lead to rapid clearance of drug carriers from the body, thereby reducing drug concentrations at the tumor site.

[0004] To solve these problems, protein-based delivery systems provide a potential solution. Proteins have good biocompatibility and low immunogenicity, which can reduce the body's immune clearance. However, as biological macromolecules, proteins have limited natural ability to penetrate the BBB, making it difficult to achieve effective targeted delivery to cancer cells. Summary of the invention

[0005] The applicant discovered that neuroviruses such as rabies virus can penetrate the BBB barrier. The particle size of rabies virus is extremely small, at 50-100nm, and it consists of two parts: a spiral nucleocapsid protein and a lipid envelope. The nucleocapsid contains the RNA genome and nucleoprotein of the virus. The lipid envelope comes from the membrane of the host cell, covers the surface of the nucleocapsid, and contains viral glycoprotein (G protein). The reasons are: first, the rabies virus envelope contains viral glycoprotein (G protein), which can bind to the host cell receptor and then enter the nerve cell; secondly, the rabies virus particle size is extremely small and can be transported into the CNS through the axons of the nervous system, and then spread retrogradely along the nerves to the central nervous system.

[0006] In this context, inspired by the structural characteristics of neuroviruses, we speculated whether it is possible to target protein drugs by utilizing natural proteins and engineering them to form coronavirus particles (Virus-like particles). Based on this, the present invention designs an engineered coronavirus-like protein delivery system (Virus-LikeParticles, VLPs): protein cage Encapsulin (Encap) is used as a VLPs delivery carrier to deliver IFN-α to cancer cells. Through the engineered design of Encap, the present invention not only improves the BBB penetration of IFN-α, but also enhances its targeting and accumulation in cancer cells, which is expected to improve the therapeutic effect on cancer cells and reduce systemic side effects.

[0007] To this end, an embodiment of the present invention provides a coronavirus-like protein delivery system and a preparation method and application thereof.

[0008] In order to achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0009] According to a first aspect of an embodiment of the present invention, the present invention provides a method for preparing a coronavirus-like protein delivery system, the method comprising:

[0010] (1) constructing a recombinant vector 1 carrying the nucleotide sequence shown in SEQ ID No. 1, a recombinant vector 2 carrying the nucleotide sequence shown in SEQ ID No. 2, and a recombinant vector 3 carrying the nucleotide sequence shown in SEQ ID No. 3;

[0011] (2) Co-expressing recombinant vector 1 and recombinant vector 2 to obtain the self-assembling protein IFN-α@Encap-ST;

[0012] (3) Expressing the recombinant vector 3 to obtain the protein SC-LinTT1;

[0013] (4) IFN-α@Encap-ST and SC-LinTT1 undergo a chemical click reaction to obtain the coronavirus-like protein delivery system.

[0014] Furthermore, the expression vector of the recombinant vector 1 is pBAD, the expression vector of the recombinant vector 2 is pET-28a(+), and the expression vector of the recombinant vector 3 is pET-28a(+).

[0015] Furthermore, the preparation method of the self-assembling protein IFN-α@Encap-ST is as follows:

[0016] The recombinant vector 1 and the recombinant vector 2 were transformed into Escherichia coli BL21 (DE3), inoculated into LB liquid culture medium containing ampicillin and kanamycin, and cultured until the OD value reached 0.4-0.6, then IPTG with a final concentration of 0.3 mM was added, and the culture was induced at 16°C, 200 rpm for 4 hours, and then arabinose with a final concentration of 0.1% was added, and the culture was induced at 16°C, 200 rpm for 16 hours, the bacteria were collected, lysed, ultrasonically broken, and purified to obtain the self-assembling protein IFN-α@Encap-ST.

[0017] More specifically, the preparation method of the protein SC-LinTT1 is as follows:

[0018] The recombinant vector 3 was transformed into Escherichia coli BL21 (DE3), inoculated into LB liquid culture medium containing kanamycin, and cultured until the OD value reached 0.4-0.6, then IPTG with a final concentration of 0.3 mM was added, and induced at 16°C, 160rpm for 20 hours, the bacteria were collected, lysed, ultrasonically disrupted, and purified to obtain the protein SC-LinTT1.

[0019] Furthermore, the mass ratio of IFN-α@Encap-ST to SC-LinTT1 is 1:10;

[0020] The chemical click reaction is carried out in the presence of a phosphate buffer;

[0021] The conditions of the chemical click reaction are: 16° ​​C., 200 rpm, 12 h.

[0022] According to a second aspect of an embodiment of the present invention, the present invention provides a coronavirus-like protein delivery system, which is made by the method described in any one of the above items.

[0023] According to a third aspect of an embodiment of the present invention, the present invention provides use of the preparation method as described in any one of the above items in preparing a therapeutic protein delivery system.

[0024] According to a fourth aspect of an embodiment of the present invention, the present invention provides use of the coronavirus-like protein delivery system as described above in the preparation of anticancer drugs.

[0025] Furthermore, the cancer is glioma or cervical cancer, and further, the glioma is glioblastoma.

[0026] The embodiments of the present invention have the following advantages:

[0027] The present invention is based on the basic principle of protein supramolecular, takes the protein cage Encapsulin (Encap) as the research object, uses Encap as the protein capsid to realize the encapsulation of therapeutic proteins such as IFN-α in the Encap self-assembling protein, and uses the chemical click strategy to realize the external modification of the targeting peptide LinTT1 on Encap. The constructed coronavirus-like protein delivery system has blood-brain barrier penetrability, realizes targeted treatment of cancer cells (such as glioblastoma and cervical cancer), and prolongs the half-life of therapeutic proteins, opening up a new path for their in vivo delivery. In addition, the protein delivery system of the present invention has low production cost, can be mass-produced, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the implementation methods of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the implementation methods or the description of the prior art. Obviously, the drawings in the following description are only exemplary, and for ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work.

[0029] Figure 1 Characterization of IFN-α@Encap-LinTT1 provided by the present invention;

[0030] Figure 2 The blood-brain barrier penetration effect of eGFP@Encap-LinTT1 provided by the present invention;

[0031] Figure 3 The killing effect of IFN-α@Encap-LinTT1 provided by the present invention on GL261 cells;

[0032] Figure 4 The killing effect of IFN-α@Encap-LinTT1 provided by the present invention on HeLa cells. DETAILED DESCRIPTION

[0033] The following is a description of the implementation of the present invention by specific embodiments. People familiar with the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] The present invention provides a coronavirus-like protein delivery system, the construction process of which is shown in Figure 1 AC in.

[0035] We first constructed pBAD-Int C -EncapTM-ST plasmid and pET28(a)-IFN-α-Int N Plasmids such as Figure 1 A in the figure, where EncapTM is a protein with self-assembly properties in nature (derived from the hyperthermophilic organism Thermotogamaritima), composed of 60 identical subunits, which self-assemble to form a hollow spherical icosahedral capsid structure, as a main shell part of the coronavirus-like protein delivery system. The spherical hollow structure of the protein cage nanoparticle provides two different spaces: the internal space and the external surface. The internal space of EncapTM can be loaded with therapeutic proteins such as IFN-α, but in order not to affect the self-assembly properties of EncapTM to prevent protein misassembly. We introduced the splicing peptide Int at the C-terminus of EncapTM. C Part, the splicing peptide Int is introduced at the N-terminus of the cargo N part, forming pBAD-Int C -EncapTM-ST and pET28(a)-IFN-α-Int N The two plasmids were co-expressed in E. coli BL21 to form the self-assembling protein IFN-α@EncapTM-ST, in which the splicing peptide can effectively help EncapTM to capture the cargo and encapsulate it. Figure 1 The outer surface of the delivery system EncapTM is modified by introducing a Spy tag, referred to as ST, at the N-terminus of EncapTM and introducing a Spy catcher, referred to as SC, at the C-terminus of the targeting peptide LinTT1 (the peptide modification here can be arbitrarily selected such as homing peptides, cell penetrating peptides CPPs, tumor cell targeting peptides RGD, etc.), forming a plasmid pBAD-Int C -EncapTM-ST and pET28(a)-SC-LinTT1 Figure 1 A and Figure 1As shown in B, the Spy tag and the Spy catcher form an isopeptide bond to complete the surface targeted modification of EncapTM. The resulting coronavirus-like protein delivery system is IFN-α@EncapTM-LinTT1. Figure 1 D in the figure is the SDS-PAGE and WB images of the above protein, which show that the protein size is consistent with the expectation. Figure 1 Figure E is an electron microscopy display of the final coronavirus-like protein delivery system. Figure 1 F and Figure 1 The G in the equation is the potential and particle size of the system. Figure 1 The Linker in A can generally be GGSGG, GGSGGGGSGG, etc. Note: Int N -Int C Assembly is a protein trans-splicing autocatalytic process in which two split intein fragments Int N and Int C Binds and folds into an active intein, then removes itself in a traceless manner, linking the fusion polypeptide with a native peptide bond. In the coronavirus-like delivery system IFN-α@Encap-LinTT1 N Acts as a capture cargo (IFN-α).

[0036] SpyTag (ST) and SpyCatcher (SC) are split proteins derived from the fibronectin-binding protein FbaB of Streptococcus pyogenes. The 15 kDa SC and 13 amino acid ST peptides spontaneously form irreversible isopeptide covalent bonds upon recognition and can be individually genetically fused to any type of protein without significantly altering the function of the fusion protein.

[0037] Product working process and function: The coronavirus-like protein delivery system of the present invention can be internally encapsulated by co-expression with short-half-life therapeutic proteins such as IFN-α in Escherichia coli. The targeting peptide LinTT1 then modifies the delivery system Encap encapsulated with the therapeutic protein to form a targeted nanodrug. The nanodrug is then injected intravenously to cross the blood-brain barrier and ultimately release the drug in the cancer cell foci to achieve targeted cancer cell therapy.

[0038] Example 1

[0039] This example provides the preparation of IFN-α@Encap-LinTT1:

[0040] (1) Protein Int C -Encap-ST encoding gene was constructed into Escherichia coli expression plasmid pBAD by molecular cloning technology to obtain recombinant vector 1.

[0041] Protein Int C The nucleotide sequence of the EncapTM-ST encoding gene (derived from the hyperthermophilic organism Thermotoga maritima) is as follows:

[0042]

[0043] Protein Int N -IFN-α encoding gene (target gene PCR synthesis) was constructed into Escherichia coli expression plasmid pET-28a(+) by molecular cloning technology to obtain recombinant vector 2.

[0044] Protein Int N The nucleotide sequence of the IFN-α encoding gene is as follows:

[0045] TGCGATCTGCCGCAGACCCACTCTCTGGGCAGCCGTCGTACCCTGATGCTGCTGGCGCAGATGCGTCGTATCTCTCTGTTCTCTTGCCTGAAAGATCGTCACGATTTCGGTTTCCCGCAGGAAGAATTTGGTAACCAGTTCCAGAAAGCGGAAACCATCCCGGTTCTGCACGAAATGATCCAGCAGATCTTCAACCTGTTCAGCACCAAAGATAGCTCTGCGGCGTGGGATGAAACCCTGCTGGATAAATTCTACACCGAACTGTACCAGCAGCTGAACGATCTGGAAGCGTGCGTTATCCAGGGCGTTGGTGTTACCGAAACCCCGCTGATGAAAGAAGATAGCATCCTGGCGGTTCGTAAATACTTCCAGCGTATCACCCTGTACCTGAAAGAAAAGAAATACTCTCCGTGCGCGTGGGAAGTTGTTCGTGCGGAAATCATGCGTAGCTTCAGCCTGAGCACCAACCTGCAGGAATCTCTGCGTAGCAAAGAAGGTAACTCCGGTGGCGGCCTGGTTGCTGGCGGCTCTGGTGGCGGCTCCGGCACTAGCGCGGAATACTGCCTGTCTTACGAAACCGAAATCCTGACCGTGGAATACGGCCTGTTGCCGATCGGTAAAATCGTTGAAAAACGCATCGAATGCACCGTTTACAGCGTTGATAACAACGGCAACATCTACACCCAGCCGGTTGCGCAGTGGCACGACCGTGGTGAACAGGAAGTTTTCGAATACTGTCTGGAAGATGGTAGCCTGATCCGTGCGACCAAAGATCACAAATTCATGACCGTTGATGGTCAGATGCTGCCGATCGACGAAATCTTTGAACGTGAACTGGATCTGATGCGTGTTGATAACCTGCCGAAC (SEQ ID No.2).

[0046] The protein SC-LinTT1 encoding gene was constructed into the Escherichia coli expression plasmid pET-28a(+) by molecular cloning technology to obtain the recombinant vector 3.

[0047] The nucleotide sequence of the gene encoding protein SC-LinTT1 is as follows:

[0048] ATGGTTGATACCCTGAGCGGCCTGAGCAGCGAACAGGGCCAGAGCGGCGATATGACCATCGAAGAAGATAGCGCGACCCACATCAAATTCAGCAAACGTGATGAAGATGGTAAAGAACTGGCGGGCGCGACCATGGAACTGCGTGATAGCAGCGGCAAAACCATCAGCACCTGGATC AGCGATGGCCAGGTTAAAGATTTCTACCTGTATCCGGGCAAATACACCTTCGTTGAAACCGCGGCGCCGGATGGCTACGAAGTTGCGACCGCGATCACCTTCACCGTTAACGAACAGGGCCAGGTTACCGTTAACGGCAAAGCGACCAAAGGCGATGCGCACATCGAATTCGCG (SEQ ID No. 3).

[0049] (2) Transform recombinant vector 1 and recombinant vector 2 into Escherichia coli BL21 (DE3). Take 10 μL of bacterial solution and inoculate it into 6 ml of LB liquid medium containing ampicillin and kanamycin (50 mg / ml), and culture it at 37°C and 200 rpm overnight. Take 5 ml of overnight cultured bacteria and transfer it into 3 L of LB liquid medium containing ampicillin and kanamycin (50 mg / ml), and culture it at 37°C and 200 rpm until the OD value is between 0.4 and 0.6. Add isopropyl β-d-1-thiogalactopyranoside (IPTG) to a final concentration of 0.3 mM, induce it at 16°C and 160 rpm for 4 hours, and then add 0.1% arabinose to continue induction under the above conditions for 16 hours. Collect the cells by centrifugation at 8000g for 20 minutes at 4°C. Lyse the cells with Lysis buffer and disrupt them by ultrasonication. Centrifuge the disrupted bacterial solution at 8000 rpm for 100 minutes, and collect the supernatant. The protein in the cell lysate was purified by immobilized metal affinity chromatography Ni-NTA column, Wash buffer was used to elute non-specifically bound impurities, and finally Elution buffer was used to elute the target protein.

[0050] The purified protein was subjected to SDS-PAGE followed by Coomassie blue staining and Western blot to identify the size of the recombinant protein. Figure 1 As shown in D, the self-assembled IFN-α@Encap-ST was successfully expressed and purified. C -The molecular weight of Encap-ST protein is 55 kDa, IntN The actual molecular weight of the IFN-α protein is 32 kDa, and the actual molecular weight of the assembled protein is 88 kDa.

[0051] (3) Transform the recombinant vector 3 into Escherichia coli BL21 (DE3), take 10 μL of the bacterial solution and inoculate it into 6 ml of LB liquid medium containing kanamycin (50 mg / ml) and culture it at 37°C and 200 rpm overnight. Take 5 ml of the overnight culture and transfer it into 3 L of LB liquid medium containing kanamycin (50 mg / ml), culture it at 37°C and 200 rpm until the OD value is between 0.4 and 0.6, add isopropyl β-d-1-thiogalactopyranoside (IPTG) to a final concentration of 0.3 mM, and induce protein expression at 16°C and 160 rpm for 20 hours. Collect the cells by centrifugation at 8000g for 20 minutes at 4°C. Lyse the cells with Lysis buffer, disrupt them by ultrasonication, centrifuge the disrupted bacterial solution at 8000 rpm for 100 minutes, and collect the supernatant. The protein in the cell lysate was purified by immobilized metal affinity chromatography Ni-NTA column, Wash buffer was used to elute non-specifically bound impurities, and finally Elution buffer was used to elute the target protein to obtain the expressed protein SC-LinTT1 (actual molecular weight was 18 kDa).

[0052] (4) The eluted self-assembled protein IFN-α@Encap-ST and protein SC-LinTT1 were concentrated at 3400rpm using ultrafiltration tubes (Millipore UFC910096, USA) and replaced with PBS, phosphate buffer (50 mM K2HPO4 and 100 mM NaCl, pH 7.4), and Tris-HCl to 1.5 mg / ml. IFN-α@Encap-ST and LinTT1-SC were mixed in different mass ratios of 2:8, 4:6, 5:5, 6:4, 1:10, 10:1 and 8:2 to prepare a series of mixtures. These mixtures were then incubated at 16°C for 12 hours and samples were taken for SDS-PAGE. The remaining samples were placed at 4°C. Figure 1 SDS-PAGE gel images in F and G.

[0053] The protein delivery system was reacted in PBS, phosphate buffer (50 mM K2HPO4 and 100 mM NaCl, pH 7.4), and Tris-HCl at the same ratio and reaction conditions. SDS-PAGE and TEM images showed that the best buffer for LinTT1 modification of IFN-α@Encap was phosphate buffer at a ratio of 1:10 ( Figure 1F, G, and H in Figure 3) obtained the coronavirus-like protein delivery system IFN-α@Encap-LinTT1. There were almost no successfully modified samples obtained in other ratios and buffers.

[0054] Example 2

[0055] This example provides the characterization of IFN-α@Encap-LinTT1:

[0056] 10 μL of sample was placed on a carbon-coated copper grid (Electron Microscopy Sciences), incubated for 1 min, and the residual solution was removed with filter paper. 5 μL of uranyl acetate (1% w / v) was placed on the grid and incubated for 1 min. Excess uranyl acetate solution was removed with filter paper, and the sample was dried overnight before imaging. The prepared grids were observed on a HT7800 transmission electron microscope (TEM) equipped with a 100 kV (FEI) cathode (LaB6, FEI), and electron microscopy (TEM) images were recorded using an UltraScan 1000 charge-coupled device (CCD) camera (Gatan). A Zetasizer Nano-zs90 (Malvern) laser was used at 25 °C with a laser wavelength of 633 nm and a scattering angle of 90°. The samples were filtered (pore size 0.22 μm, MilliporeCorp.) before analysis. All data were analyzed using Zetasizer software 6.32.

[0057] The obtained finished product IFN-α@Encap-LinTT1 was characterized by TEM and DLS. Figure 1 As shown in Figures E, H, and I, the peak particle size of IFN-α@Encap-LinTTI is 43.49 nm, and the overall particles are negatively charged.

[0058] Example 3

[0059] This example provides the blood-brain barrier penetration effect of eGFP@Encap-LinTT1, wherein the construction method of eGFP@Encap-LinTT1 is the same as that of Example 1, except that IFN-α is replaced by eGFP.

[0060] Hecat and G261 cells were cultured in DMEM containing 10% FBS and 1% double antibody, respectively. Milli hanging culture inserts were added to a 24-well plate (transwell). Hacat cells were plated at 5×10 4 The cells were seeded in the upper chamber at a density of 5 × 10 4The cells were inoculated onto a circular glass slide at the bottom of the lower chamber at a density of 1.5%, 5%, and 10%, and eGFP@Encap-LinTT1 (2 μg / ml) was added to the upper chamber at 2.5%, 5%, and 10%. After treatment, the luminescence of the cells in the lower chamber was observed under a microscope. The results showed that the coronavirus-like protein delivery system without the therapeutic protein IFN-α of the present invention has a good blood-brain barrier penetration effect. Figure 2 shown.

[0061] Example 4

[0062] This example provides an in vitro anti-tumor detection scheme for IFN-α@Encap-LinTT1:

[0063] GL261 cells were cultured in DMEM containing 10% FBS and 1% double antibody, and 2.5%, 5%, 10%, and 20% of the nanodrug (IFN-α@Encap-LinTT1 in Example 1) and IFN-α were added, respectively. The effect of the nanodrug on cytotoxicity was detected by live / dead staining. The results showed that both IFN-α@Encap-LinTTI and IFN-α had a killing effect on GL261 cancer cells, and IFN-α@Encap-LinTT1 had a significant killing effect on GL261 cells at a concentration of 5%. Figure 3 In addition, the CCK8 experiment was used to detect the effects of different concentrations of 2.5%, 5%, 10%, and 20% of the nanodrug (IFN-α@Encap-LinTT1 in Example 1) and IFN-α on the viability of GL261 cells, and the results were normalized to the medium control. All tests were repeated three times, and the results showed that the nanodrug IFN-α@Encap-LinTT1 enhanced the cytotoxicity of IFN-α. Figure 3 A in the figure. The cells were seeded in a six-well plate and a scratch test was performed to detect the effect of the nanodrug IFN-α@Encap-LinTT1 on cell migration. The results showed that 20% IFN-α@Encap-LinTT1 significantly inhibited the migration of GL261 cells. Figure 3 C and D in the figure. GL261 cells were cultured in a small dish, and then treated with 10% nanodrug IFN-α@Encap-LinTTI and IFN-α, respectively. 7-AAD staining working solution was added and resuspended into a single cell suspension. The cells were incubated at 37°C for 10 minutes, and then screened by flow cytometry (BD, SORP ARIAIII). After evaluation, the toxic effects of nanodrug IFN-α@Encap-LinTT1 and IFN-α itself on GL261 cells were compared. The results showed that the nanodrug IFN-α@Encap-LinTT1 enhanced the toxicity of IFN-α to GL261 cells. Figure 3In E, IFN-α@Encap-LinTT1 enhanced the anti-glioma cell effect of IFN-α.

[0064] HeLa cells were cultured in a DMEM medium containing 10% FBS and 1% double antibody, and 2.5%, 5%, 10%, and 20% of the nanodrug (IFN-α@Encap-LinTT1 in Example 1) and IFN-α were added, respectively. The effect of the nanodrug on cytotoxicity was detected by live / dead staining. The results showed that both IFN-α@Encap-LinTT1 and IFN-α had a killing effect on HeLa cells, and IFN-α@Encap-LinTT1 had a significant killing effect on HeLa cells at a concentration of 5%. Figure 4 A and B in Figure 1. In addition, the CCK8 experiment was used to detect the effects of different concentrations of nanomedicine (IFN-α@Encap-LinTT1 in Example 1) and IFN-α on the viability of G261 cells, and the results were normalized to the medium control. All tests were repeated three times, and the results showed that IFN-α@Encap-LinTT1 enhanced the cytotoxicity of IFN-α. Figure 4 C. The cells were seeded in a six-well plate and a scratch test was performed to detect the effect of the nanodrug IFN-α@Encap-LinTT1 on cell migration. The results showed that 20% IFN-α@Encap-LinTT1 significantly inhibited the migration of HeLa cells. Figure 4 D and E in the figure. The above results indicate that IFN-α@Encap-LinTT1 enhances the toxicity of IFN-α to HeLa cells and also enhances the anti-cervical cancer cell effect of IFN-α.

[0065] Although the present invention has been described in detail above by general description and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

[0066] Sequence Listing

[0067] <110> Zhongke Zhicao (Zhejiang) Technology Co., Ltd.

[0068] <120> A coronavirus-like protein delivery system and its preparation method and application

[0069] <130> GG241434164A

[0070] <160> 3

[0071] <170> PatentIn version 3.5

[0072] <210> 1

[0073] <211> 1113

[0074] <212> DNA

[0075] <213> Artificial series

[0076] <400> 1

[0077] atgattaaaa tcgcgacccg taaatacctg ggtaaacaga acgtttatga tatcggcgtt 60

[0078] gaacgtgatc acaacttcgc gctgaaaaac ggttttatcg cgtctaactg cttcaacggc 120

[0079] ggtggtggta gcggtggtgg tggttccggt ggcggtggct ctggcaccgg tggtagcgaa 180

[0080] tttctgaaac gttccttcgc gccgctgacc gaaaaacagt ggcaggaaat tgataaccgt 240

[0081] gcgcgtgaaa tcttcaaaac ccagctgtac ggtcgtaaat tcgttgatgt tgaaggtccg 300

[0082] ggcggcggtg gcggtcacca ccaccatcac cacgcttccg gtggtggtgg tggctacggc 360

[0083] tgggaatacg cagcgcaccc gctgggtgaa gttgaagttc tgtccgacga aaacgaagtt 420

[0084] gttaaatggg gcctgcgtaa aagcctgccg ctgatcgaac tgcgcgctac cttcaccctg 480

[0085] gacctgtggg aactggacaa cctggaacgt ggtaaaccga acgttgatct gagctctctg 540

[0086] gaaaccg ttcgtaaagt tgccgaattt gaagtgaag tgatcttccg tggttgtgaa 600

[0087] aaatccggtg ttaaaggtct gctgagcttc gaagaacgta aaatcgaatc tggctccacc 660

[0088] ccgaaagatc tgctggaagc gattgtgcgc gcgctgagca tcttctctaa agatggcatc 720

[0089] gaaggcccgt acaccctggt tatcaacacc gaccgttgga tcaacttcct gaaagaaa 780

[0090] gcaggtcact acccgctgga aaaacgtgtt gaaaagcc tgcgcgggggg caaaattatc 840

[0091] accactccgc gtattgaga tgccctggtt gtgtctgaac gtggtggcga cttcaaactg 900

[0092] atcctgggcc aggatctgag catcggttac gaagatcgtg aaaaagatgc ggttcgtctg 960

[0093] ttcatcaccg aaaccttcac cttccaggtt gtgaacccgg aagcgctgat cctgctgaaa1020

[0094] ttcgaaccgc cgccgccgct gccaccgccg ccggaaccgc cgccgccggg tagcgcgcac1080

[0095] atcgttatgg ttgatgcgta caaaccgacc aaa 1113

[0096] <210> 2

[0097] <211> 867

[0098] <212> DNA

[0099] <213> Artificial sequence

[0100] <400> 2

[0101] tgcgatctgc cgcagaccca ctctctgggc agccgtcgta ccctgatgct gctggcgcag 60

[0102] atgcgtcgta tctctctgtt ctcttgcctg aaagatcgtc acgatttcgg tttcccgcag 120

[0103] gaagaatttg gtaaccagtt ccagaaagcg gaaaccatcc cggttctgca cgaaatgatc 180

[0104] cagcagatct tcaacctgtt cagcaccaaa gatagctctg cggcgtggga tgaaaccctg 240

[0105] ctggataaat tctacaccga actgtaccag cagctgaacg atctggaagc gtgcgttatc 300

[0106] cagggcgttg gtgttaccga aaccccgctg atgaaagaag atagcatcct ggcggttcgt 360

[0107] aaatacttcc agcgtatcac cctgtacctg aaagaaaaga aatactctcc gtgcgcgtgg 420

[0108] gaagttgttc gtgcggaaat catgcgtagc ttcagcctga gcaccaacct gcaggaatct 480

[0109] ctgcgtagca aagaaggtaa ctccggtggc ggcctggttg ctggcggctc tggtggcggc 540

[0110] tccggcacta gcgcggaata ctgcctgtct tacgaaaccg aaatcctgac cgtggaatac 600

[0111] ggcctgttgc cgatcggtaa aatcgttgaa aaacgcatcg aatgcaccgt ttacagcgtt 660

[0112] gataacaacg gcaacatcta cacccagccg gttgcgcagt ggcacgaccg tggtgaacag 720

[0113] gaagttttcg aatactgtct ggaagatggt agcctgatcc gtgcgaccaa agatcacaaa 780

[0114] ttcatgaccg ttgatggtca gatgctgccg atcgacgaaa tctttgaacg tgaactggat 840

[0115] ctgatgcgtg ttgataacct gccgaac 867

[0116] <210> 3

[0117] <211> 351

[0118] <212> DNA

[0119] <213> Artificial Sequence

[0120] <400> 3

[0121] atggttgata ccctgagcgg cctgagcagc gaacagggcc agagcggcga tatgaccatc 60

[0122] gaagaagata gcgcgaccca catcaaattc agcaaacgtg atgaagatgg taaagaactg 120

[0123] gcgggcgcga ccatggaact gcgtgatagc agcggcaaaa ccatcagcac ctggatcagc 180

[0124] gatggccagg ttaaagattt ctacctgtat ccgggcaaat acaccttcgt tgaaaccgcg 240

[0125] gcgccggatg gctacgaagt tgcgaccgcg atcaccttca ccgttaacga acagggccag 300

[0126] gttaccgtta acggcaaagc gaccaaaggc gatgcgcaca tcgaattcgc g 351

Claims

1. A method for preparing a coronavirus-like protein delivery system, characterized in that: The method comprises: (1) constructing a recombinant vector 1 carrying the nucleotide sequence shown in SEQ ID No. 1, a recombinant vector 2 carrying the nucleotide sequence shown in SEQ ID No. 2, and a recombinant vector 3 carrying the nucleotide sequence shown in SEQ ID No. 3; (2) Co-expressing recombinant vector 1 and recombinant vector 2 to obtain the self-assembling protein IFN-α@Encap-ST; (3) Expressing the recombinant vector 3 to obtain the protein SC-LinTT1; (4) IFN-α@Encap-ST and SC-LinTT1 undergo a chemical click reaction to obtain the coronavirus-like protein delivery system.

2. The method for preparing the coronavirus-like protein delivery system according to claim 1, characterized in that: The expression vector of the recombinant vector 1 is pBAD, the expression vector of the recombinant vector 2 is pET-28a(+), and the expression vector of the recombinant vector 3 is pET-28a(+).

3. The method for preparing the coronavirus-like protein delivery system according to claim 1, characterized in that: The preparation method of the self-assembling protein IFN-α@Encap-ST is as follows: The recombinant vector 1 and the recombinant vector 2 were transformed into Escherichia coli BL21 (DE3), inoculated into LB liquid culture medium containing ampicillin and kanamycin, and cultured until the OD value reached 0.4-0.6, then IPTG with a final concentration of 0.3 mM was added, and the culture was induced at 16°C, 200 rpm for 4 hours, and then arabinose with a final concentration of 0.1% was added, and the culture was induced at 16°C, 200 rpm for 16 hours, the bacteria were collected, lysed, ultrasonically broken, and purified to obtain the self-assembling protein IFN-α@Encap-ST.

4. The method for preparing the coronavirus-like protein delivery system according to claim 1, characterized in that: The preparation method of the protein SC-LinTT1 is as follows: The recombinant vector 3 was transformed into Escherichia coli BL21 (DE3), inoculated into LB liquid culture medium containing kanamycin, and cultured until the OD value reached 0.4-0.6, then IPTG with a final concentration of 0.3 mM was added, and induced at 16°C, 160rpm for 20 hours, the bacteria were collected, lysed, ultrasonically disrupted, and purified to obtain the protein SC-LinTT1.

5. The method for preparing the coronavirus-like protein delivery system according to claim 1, characterized in that: The mass ratio of IFN-α@Encap-ST to SC-LinTT1 is 1:10; The chemical click reaction is carried out in the presence of a phosphate buffer; The conditions of the chemical click reaction are: 16° ​​C., 200 rpm, 12 h.

6. A coronavirus-like protein delivery system, characterized in that: The method is prepared by the method according to any one of claims 1 to 5.

7. Use of the preparation method according to any one of claims 1 to 5 in preparing a therapeutic protein delivery system.

8. Use of the coronavirus-like protein delivery system according to claim 6 in the preparation of anticancer drugs.

9. The use according to claim 8, characterized in that: The cancer is glioma or cervical cancer.

Images