Application of tomato SlMYB48 protein or coding gene thereof in regulation and control of plant salt tolerance

Abstract

The invention relates to the technical field of biology, and particularly discloses application of a tomato SlMYB48 protein or a coding gene thereof in regulation and control of plant salt tolerance. The tomato SlMYB48 gene can positively regulate and control the salt tolerance of the plant, the salt tolerance of the plant can be effectively improved by overexpressing the SlMYB48 gene, and a gene resource and a new method are provided for cultivating a new variety of the high-salt-tolerance plant. According to the invention, a pBI121 vector and a 35S promoter are applied to drive expression of the tomato SlMYB48 gene in arabidopsis thaliana, a salt-tolerant arabidopsis thaliana strain is created, the salt tolerance of the arabidopsis thaliana strain is remarkably improved, and the salt-tolerant arabidopsis thaliana strain has important application value.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of a tomato S1MYB48 protein or a coding gene thereof in regulating plant salt tolerance. Background Art

[0002] tomato( Solanum lycopersicumL. ) is the second largest vegetable crop in the world in terms of cultivated area. During the growth and development of tomatoes, salt stress has a huge impact on their yield and quality. Transcription factors are involved in many physiological processes of plants. When plants face changes in external stimuli, they induce the expression of related genes, activate the plant's defense mechanism, and play an important role in plant stress resistance.

[0003] The MYB transcription factor family is large in number and has diverse functions in plants. Most of them are related to plant growth and development and stress, and have attracted much attention from scholars. MYB transcription factors contain a highly conserved myb domain, which is composed of 1-4 incompletely repeated R structures at the N-terminus. There are three types of R structures, namely R1, R2 and R3. It is a folded protein composed of about 52 amino acids in the form of helix-turn-helix (HTH). There is a tryptophan residue every 18 or 19 amino acids in the R structure. These three tryptophan residues play a hydrophobic role and help maintain the stability of the structure. The C-terminus of the MYB protein is different from the N-terminus. It is not highly conserved and contains a transcriptional activation region. This region folds into an amphipathic helical structure. Acidic amino acids are usually present in this region and are responsible for regulating protein activity. MYB transcription factors are divided into four subclasses according to the number of R structures contained in the MYB gene. 1R-MYB contains an R structure that can specifically bind to chromosome telomeres and maintain chromosome structure. It is mainly involved in regulating plant growth and development and stress response. R2R3-MYB contains two R structures and is the most numerous subclass in the plant MYB family. It is also the most widely studied class. It has the function of transcriptional activation at the C-terminus and participates in regulating the plant cell cycle and epidermal cell morphological differentiation, growth and development, regulating the primary and secondary metabolism of plants, participating in hormone response, and regulating the survival ability of plants in the face of biotic and abiotic stresses. R1R2R3-MYB contains 3 R structures. This subclass is less common in plants, with only 5 found. It exists in the genomes of Arabidopsis, tobacco and rice. It is mainly involved in regulating the plant cell cycle, cell differentiation process and improving the survival ability of plants in adversity. 4R-MYB contains 4 R structures, which are repeated by 4 structures similar to R1 or R2. It is the smallest class in the MYB transcription factor family and has only been found in very few plants. There is little research on the function of this subclass. R2R3-MYB contains two R structures and is the most numerous subclass in the plant MYB family and the most widely studied class. It has the function of transcriptional activation at the C-terminus, participates in regulating the plant cell cycle and epidermal cell morphological differentiation, growth and development, regulates the process of plant primary and secondary metabolism, participates in hormone response, and regulates the survival ability of plants in the face of biotic and abiotic stresses.

[0004] Molecular breeding can quickly and directionally modify plant genes, greatly improving breeding efficiency. Controlling gene expression through molecular breeding methods to improve plant traits and provide a theoretical basis and germplasm resources for breeding excellent varieties is an important direction for the development of plant breeding. Previous studies have found that when tomatoes are treated with simulated seawater of different concentrations, the expression level of SlMYB48 shows a significant upward trend with the increase in the proportion of seawater, indicating that SlMYB48 may be involved in the tolerance of tomatoes to salt stress. The study of SlMYB48 transcription factors provides a theoretical basis for breeding new salt-tolerant tomato varieties, which has important guiding and practical significance for crop production and the development and utilization of saline-alkali land. Summary of the invention

[0005] On the basis of existing research, the present invention further subjected wild-type tomato materials to salt stress treatment, extracted RNA, and screened genes that can significantly respond to salt stress using transcriptome analysis, and obtained the gene SlMYB48 after analysis. By intervening in the expression of the SlMYB48 gene, the salt tolerance of tomatoes can be regulated.

[0006] The technical solution of the present invention is as follows.

[0007] In a first aspect, the present invention provides an application of a tomato SlMYB48 protein or a gene encoding it in regulating salt tolerance of tomatoes, specifically for increasing the activity of the tomato SlMYB48 protein or enhancing the expression of its encoding gene.

[0008] In a second aspect, the present invention provides the use of tomato S1MYB48 protein or its encoding gene in salt-tolerant genetic breeding or transgenic plant preparation.

[0009] In the present invention, the tomato S1MYB48 protein has any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids, and having the same functional protein; (3) an amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO.1; preferably, the homology is at least 90%; more preferably, the homology is 95%; In the present invention, the CDS sequence of the gene encoding the tomato S1MYB48 protein has any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence having the same functional protein obtained by replacing, inserting or deleting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.2.

[0010] The nucleotide sequence shown in SEQ ID NO. 2 is the CDS sequence of the S1MYB48 protein in tomato. Considering the degeneracy of codons, all nucleotide sequences encoding the tomato S1MYB48 protein are within the protection scope of the present invention.

[0011] As a preferred technical solution, the coding gene of SlMYB48 protein is overexpressed by an overexpression vector, and the overexpression vector is pBI121.

[0012] As a preferred technical solution, the overexpression sequence comprises a nucleotide sequence as shown in SEQ ID NO.2.

[0013] In a third aspect, the present invention provides a vector for overexpressing the tomato S1MYB48 gene, wherein the insertion sites of the overexpression sequence on the expression vector pBI121 are XbaI and SacI.

[0014] The coding region (CDS) of the target gene is constructed into the corresponding plasmid vector through an overexpression vector to achieve the effect of overexpression of the target gene and increase the expression of the tomato SlMYB48 protein coding gene. The overexpression vector is pBI121.

[0015] The coding region (CDS) of the target gene is the nucleotide sequence shown in SEQ ID NO. 2, which is constructed into the expression vector pBI121 to obtain pBI121 for overexpressing the SlMYB48 gene.

[0016] The above-mentioned pBI121-SlMYB48 overexpression vector can achieve efficient expression of the tomato SlMYB48 gene.

[0017] In a fourth aspect, the present invention provides biological materials for overexpressing the tomato S1MYB48 gene, wherein the biological materials include vectors, transgenic cells or engineered bacteria.

[0018] The vector may be a pBI121 gene overexpression vector containing a 35S promoter, a coding region (CDS) sequence of SlMYB48, and a kanamycin selection gene; The engineered bacteria may be Escherichia coli or Agrobacterium containing the PBI-S1MYB48 gene overexpression vector.

[0019] In a fifth aspect, the present invention provides a method for regulating plant salt tolerance, comprising: regulating the expression level of the SlMYB48 gene.

[0020] The protein encoded by the tomato S1MYB48 gene has any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids, and having the same functional protein; (3) an amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO.1; As a preferred technical solution, the homology is at least 90%; more preferably, the homology is 95%.

[0021] As a preferred technical solution, in the above method, the salt tolerance of the plant is improved by reducing the expression level of the tomato SlMYB48 gene in the plant; or, a salt-tolerant strain is cultivated by hybridizing a strain overexpressing the tomato SlMYB48 gene with other strains.

[0022] The above-mentioned increase in the expression level of the SlMYB48 gene in the plant can be achieved by conventional technical means in the art.

[0023] As a preferred technical solution, the expression level of the tomato SlMYB48 gene in the plant is achieved by using an overexpression vector, and the pBI121 overexpression system uses the tomato SlMYB48 gene CDS sequence.

[0024] As a preferred technical solution, the method for constructing the pBI121 overexpression system is to connect the CDS to the vector between the restriction sites XbaI and SacI to obtain the recombinant pBI121-SlMYB48 vector.

[0025] In the present invention, the plant is a monocotyledon or a dicotyledon, including but not limited to tomato, rice, Arabidopsis, grape, soybean, cucumber, wheat, and corn.

[0026] The application of tomato SlMYB48 protein or its encoding gene in regulating plant salt tolerance can enhance the activity of tomato SlMYB48 protein or increase the expression level of its encoding gene; the amino acid sequence of the tomato SlMYB48 protein is shown in SEQ ID NO.1; the CDS sequence of the gene encoding the tomato SlMYB48 protein is shown in SEQ ID NO.2.

[0027] Advantages of the present invention: The present invention finds through screening and analysis that the tomato SlMYB48 gene can positively regulate plant salt tolerance, and by increasing the expression of the SlMYB48 gene, the plant salt tolerance can be effectively improved, providing gene resources and new methods for cultivating new salt-tolerant plant varieties. On the one hand, by overexpressing the SlMYB48 gene, a plant strain with stronger salt tolerance can be obtained; on the other hand, the high-expression strain of the SlMYB48 gene can also be hybridized with other varieties to cultivate salt-tolerant strains and enrich salt-tolerant germplasm resources. The SlMYB48 gene and its activating factor have great application value in plant salt-tolerant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The pBI121 vector map and the construction map of the pBI121-SlMYB48 gene overexpression vector in Example 1 of the present invention are shown; Figure 2 This is a plaque identification diagram of Escherichia coli transformed with the gene expression vector pBI121-S1MYB48 constructed in Example 1 of the present invention; wherein M is a DNA Mark, and the band sizes are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp from top to bottom; lane numbers 1-13 are transformation plaque numbers, lane 14 is a H2O blank control, and lane 15 is a positive control; Figure 3 The figure is a graph showing the electrophoresis detection result of the transformed Arabidopsis plants containing the SlMYB48 gene screened by PCR in Example 1 of the present invention, wherein M is a DNA Mark, and the band sizes are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp from top to bottom; H2O is a negative control, P is a construct of the SlMYB48-pBI121 vector plasmid, WT is wild-type Arabidopsis, and 1-12 are the PCR results of the transformed plants; Figure 4 The expression of the SlMYB48 gene in the transformed Arabidopsis plants in Example 1 of the present invention, WT is the wild type; OE1-OE4 are Arabidopsis plants overexpressing the SlMYB48 gene; Figure 5 This is a comparison chart of seed germination under salt stress treatment of the SlMYB48 overexpression strain (SlMYB48) and the wild type (WT) material provided in Example 2 of the present invention; Figure 6 It is a growth status comparison diagram of the SlMYB48 overexpression strain (SlMYB48) and the wild type (WT) material before and after salt stress treatment at the seedling stage provided in Example 2 of the present invention; Figure 7This is a comparison of NBT staining of leaves of the SlMYB48 overexpression strain (SlMYB48) and the wild type (WT) material after salt stress treatment provided in Example 2 of the present invention; Figure 8 This is a comparison diagram of related enzyme activities of the SlMYB48 overexpression strain (SlMYB48) and the wild type (WT) material after salt stress treatment provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0029] The present invention is further described below in conjunction with specific embodiments.

[0030] The following examples are only used to further illustrate the present invention in detail, but do not constitute any limitation to the present invention; the materials used in the following examples, unless otherwise specified, were purchased from conventional chemical reagent companies and raw material suppliers.

[0031] Example 1: Construction of SlMYB13 gene overexpression vector (1) Selection of restriction sites Log in to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) and query the sequence of the tomato SlMYB48 gene (the CDS sequence is shown in SEQ ID NO.2, and the coding protein sequence is shown in SEQ ID NO.1). Combined with the pBI121 plasmid map ( Figure 1 ), analysis of the restriction site of the SlMYB48 gene sequence revealed that the four restriction sites of SmaI, BamHI, XbaI, and SacI can all be used, and XbaI and SacI are preferred for vector construction in the present invention.

[0032] (2) Construction of overexpression vector According to the selected restriction sites, primers F: GAGAACACGGGGGACTCTAGatggcacaagaagaaatgagaagaggacc (SEQ ID NO.3); R: CGATCGGGGAAATTCGAGCTttagccagcaaagaatgtgttatcctggttg (SEQ ID NO.4) were synthesized for PCR amplification. The reaction procedure was as follows: 94°C for 5 min; 94°C for 30 s, 50°C for 45 s, 72°C for 42 s, 30 cycles; 72°C for 10 min, 16°C for 30 min. The PCR amplification product was electrophoresed at 100 V and 200 mA for 30 min, and recovered using a DNA gel recovery kit (Axygen). The recovered product was labeled as rDNA1.

[0033] The pBI121 plasmid and rDNA1 were digested with XbaI / SacI and ligated with T4 ligase to obtain the MYB48 overexpression vector pBI121-SlMYB48. Figure 1 Recombination map.

[0034] After transformation of E. coli DH5α, detection primers JC-F: TCTCCACTGACGTAAGGGAT (SEQ ID NO.5) and JC-R: GACATCCATAGTGTATTTGGGCA (SEQ ID NO.6) containing the vector and the target fragment were designed. The reaction procedure was 94°C for 5 min; 94°C for 30 s, 50°C for 45 s, 72°C for 42 s, 30 cycles; 72°C for 10 min, 16°C for 30 min, and the amplified sequence was 736 bp. The results of PCR amplification and electrophoresis detection are shown in Figure 2 .

[0035] (3) Transformation of Agrobacterium tumefaciens with pBI121-SlMYB48 plasmid The recombinant pBI121-SlMYB48 vector in step (2) was transformed into the Agrobacterium GV3101 strain by heat shock method to obtain recombinant Agrobacterium. The specific method is as follows: take 50μL of Agrobacterium GV3101 competent cells in a centrifuge tube, add 2μL of pBI121-SlMYB48 plasmid, ice bath for 45 minutes, freeze in liquid nitrogen for 1 minute, bath in 37℃ water for 3 minutes, add 1mL YEB liquid medium, culture at 28℃ and 125rpm for 3 hours, centrifuge at 12000rpm for 1 minute to concentrate the bacterial solution, add 400μL YEB liquid medium to melt the bacterial solution, and apply it on YEB solid medium (containing 50mg·L Kan). -1 and Rif70mg·L -1 ), invert and culture in an incubator at 28℃ in the dark for 2~3 days; pick spots for PCR detection using JC-F and JC-R primers, and shake the correct plaques for preservation.

[0036] (4) Agrobacterium-mediated transformation of Arabidopsis Take 50 μL of recombinant Agrobacterium culture medium and add it to 50 mL of YEB liquid medium (Kan 50 mg·L -1 and Rif 70mg·L -1) in a triangular flask, set the shaker at 28°C and 200rpm to culture until OD600 reaches 0.6-0.8. Centrifuge at 4°C and 4000rpm for 15min to collect the bacteria; prepare the infection solution: weigh 10g sucrose (5%) and dissolve it in 200mL ddH2O, then add 40μL SilwetL-77 (0.02%), stir evenly with a rotor, and pour the above bacterial solution into the infection solution to mix thoroughly. Soak the Arabidopsis thaliana in the infection solution for 10s, gently shake the infection solution during the period, take it out and place it at room temperature for 10min and infect it again; cover the infected plants with plastic wrap to keep them moist, and take them out after three days and harvest them when the siliques are ripe.

[0037] Arabidopsis seed identification: transfer appropriate amount of harvested Arabidopsis seeds into a 1.5ml sterile centrifuge tube, add 600L sterile water and 400μL NaClO to sterilize the seeds for 6-7min, wash the seeds with sterile water for 6-7 times, and sow them on MS screening medium containing kanamycin at a final concentration of 50mg / ml. After about 10 days, positive transgenic seedlings can grow normally on the screening medium and grow true leaves, while negative transgenic seedlings cannot grow normally, turn white and die. The positive transgenic seedlings screened out are T1 generation. Afterwards, molecular detection is performed on the T1 generation transgenic seedlings, that is, DNA of the T1 generation transgenic seedlings is extracted as a template. The detection primers Kana-F: CACAGTCGATGAATCCAGAA (SEQ ID NO.7) and Kana-R: CCGAGAAAGTATCCATCATG (SEQ ID NO.8) containing the vector and the target fragment were designed. The reaction procedure was 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 20 s, 30 cycles; 72°C for 10 min, 16°C for 30 min. The PCR amplification electrophoresis detection results are shown in Figure 3 .

[0038] Continue to sow T1 generation positive plants and keep them as seeds until T3 generation, and perform qRT-PCR expression identification. The real-time fluorescence quantitative PCR instrument used is 7500 model (ABI, USA), and the kit is iScript™ gDNA Clear cDNA Synthesis Kit (Bio-Rad Bio-Medical Products Shanghai Co., Ltd.). The primers were SlMYB48-F (SEQ ID NO.9ACGATACGGGTGGACTTGAC) and SlMYB48-R (SEQ ID NO.10TGACATCCATAGTGTATTTGGGCA), and the reaction system (20μL) components were 2×qPCR Mix 10μL; Primer F (10μM), Primer R (10μM) 0.5μL each, cDNA 0.5μL, ddH2O 8.5μL; PCR reaction conditions were: 95°C pre-denaturation for 5min, 95°C denaturation for 10s, 60°C annealing for 30s, 40 cycles: 95°C denaturation for 15s, 60°C extension for 1min. The test results are shown in Figure 4 OE1 had the highest expression level, so it was selected for subsequent experiments.

[0039] Example 2: Salt tolerance testing of transgenic Arabidopsis thaliana strains (1) The seeds of the homozygous overexpression line SlMYB48-OE1 verified by sequencing were selected for germination experiments together with the wild type. After surface disinfection, the WT and transgenic Arabidopsis seeds were sown on MS solid medium containing 50mM, 100mM, and 150mM NaCl, respectively. After purification at 4℃ for 3 days, they were placed in a light incubator at 22℃ and 16h / 8h (light / dark). The germination rate of Arabidopsis seeds was measured every 24h. Three biological replicates were set for each treatment. The test results are shown in Figure 5 The results showed that there was little difference in germination rate between WT and SlMYB48-OE1 Arabidopsis lines on MS medium, but the germination time of SlMYB48-OE1 Arabidopsis lines was two days earlier than that of WT. Under 50mM NaCl stress, the germination rate of transgenic Arabidopsis seeds was 1.8 times that of wild-type Arabidopsis seeds; under 100mM NaCl stress, the germination rate of transgenic Arabidopsis seeds was 3.5 times that of wild-type Arabidopsis seeds; and under 150mM NaCl stress, the germination rate of transgenic Arabidopsis seeds was 5.3 times that of wild-type Arabidopsis seeds.

[0040] (2) Salt stress tolerance test of Arabidopsis wild-type and overexpression seedlings. After disinfection, wild-type and transgenic Arabidopsis seeds were sown on MS medium and placed in an Arabidopsis greenhouse for 7 days (16 h light / 8 h dark). They were then transplanted onto MS solid medium containing different concentrations of NaCl. The salt treatment concentration gradient was 0, 50, 100 and 150 mM. Each concentration treatment had 3 replicates and was placed vertically in the Arabidopsis greenhouse for cultivation. Phenotypic identification and root length statistics were performed around 7 days later. Three biological replicates were set for each treatment. The test results are shown in Figure 6 . At 0 mM NaCl concentration, both wild-type and transgenic Arabidopsis can grow normally. The growth of the root part of SlMYB48-OE1 Arabidopsis is better than that of WT, and the main root length is slightly longer than that of WT. At 100 mM NaCl concentration, the growth of the two treatments was inhibited to a certain extent, and the root length of the transgenic line was 1.16 times that of the wild-type Arabidopsis. At 150 mM NaCl concentration, the growth of the wild-type and transgenic Arabidopsis lines was further inhibited. Compared with the wild-type Arabidopsis, the transgenic Arabidopsis lines showed higher salt stress tolerance, longer main roots, about 1.7 times the root length of the wild-type Arabidopsis, and the wild-type Arabidopsis could not grow normally, the plants wilted, the leaves turned yellow, and the main roots did not grow.

[0041] (3) SlMYB48-OE1 and wild type (WT) treated with salt stress in (2) were also selected for NBT staining. NBT (nitro blue tetrazolium) staining is a method for detecting superoxide anions (O 2- ) method, and took the leaves of wild-type Arabidopsis and transgenic Arabidopsis thaliana treated with salt stress for 7 days for NBT staining. The specific experimental method is as follows: take the primary leaves and immediately put them into a syringe filled with 5mL NBT dye solution; evacuate, maintain negative pressure of -0.1MPa for 20-30min (completely immerse the leaves, and increase the time for appropriate immersion); let it stand at room temperature (25℃) for 60min, and discard the NBT dye solution. Add 95% ethanol and immerse the sample, decolorize it in an 80℃ water bath, and change 95% ethanol every 10min. After the green color of the sample has completely faded, take out the sample, take pictures of the leaves with a stereo microscope, and record the staining results. The test results are shown in Figure 7 When treated with 0 mM NaCl, the staining degree of each strain was similar; when treated with 100 mM NaCl, the color of each strain deepened, but the overexpression strain was lighter than the wild type; when treated with 150 mM NaCl, the color of each strain deepened further, the leaves of the wild-type Arabidopsis were dark blue, while the leaves of the overexpression strain were light blue, indicating that the content of superoxide anions in SlMYB48-OE1 was low and the damage to leaf tissue was small.

[0042] (4) SlMYB48-OE1 and wild type (WT) treated with salt stress in (2) were selected to measure the activities of catalase (CAT), peroxidase (POD), superoxide dismutase (SOD) and malondialdehyde (MDA) and proline content. POD, SOD and CAT are the main enzymes in the plant antioxidant system, and their activities can reflect the degree to which the plant is affected by external adversity. The increase in MDA content will cause the degradation of phospholipids, inactivate membrane proteins, and lead to cell membrane collapse. Detecting the MDA content of plants can reflect the degree of damage to the plant cell membrane after low temperature stress. Free proline in plants is one of the main osmotic regulating substances, which can reduce the osmotic potential of cells, maintain the homeostasis of the internal environment of plant cells, and reduce the impact of stress on plants. The measurement results are as follows Figure 8 As shown, compared with WT, the CAT, POD, SOD activities and proline content of SlMYB48-OE1 were significantly increased, and the MDA content was significantly decreased, indicating that SlMYB48-OE1 can improve the salt tolerance of plants.

[0043] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of protection. The scope of protection claimed by the present invention is defined by the attached claims and their equivalents.

Claims

1. Application of tomato S1MYB48 protein or its encoding gene in regulating plant salt tolerance, characterized in that: Increase the activity of tomato SlMYB48 protein or the expression of its coding gene; The tomato S1MYB48 protein has an amino acid sequence as shown in SEQ ID NO.1; The CDS sequence of the gene encoding tomato S1MYB48 protein is shown in SEQ ID NO.

2.

2. The use of the tomato S1MYB48 protein or its encoding gene in regulating plant salt tolerance according to claim 1, characterized in that: The tomato S1MYB48 protein also has any one of the following amino acid sequences: a. An amino acid sequence of a protein having the same function obtained by replacing, inserting or deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO.1; b. an amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO.1; The CDS sequence of the gene encoding the tomato S1MYB48 protein also has a nucleotide sequence with the same functional protein obtained by replacing, inserting or deleting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.

2.

3. Use of the tomato S1MYB48 protein or its encoding gene as described in any one of claims 1 or 2 in salt-tolerant genetic breeding or transgenic plant preparation.

4. The use according to claim 3, characterized in that: Through the overexpression vector, the coding region of the target gene is constructed into the corresponding plasmid vector to achieve the effect of overexpression of the target gene and increase the expression of the tomato SlMYB48 protein coding gene. The overexpression vector is pBI121.

5. The use according to claim 4, characterized in that: The coding region of the target gene is the nucleotide sequence shown in SEQ ID NO.2, which is constructed into the expression vector pBI121 to obtain pBI121 for overexpressing the SlMYB48 gene.

6. A biomaterial comprising pBI121 for overexpressing the S1MYB48 gene according to claim 5, characterized in that: The biological material includes a vector, a transgenic cell or an engineered bacterium; The overexpression vector pBI121 is an overexpression vector containing the 35S promoter, the SlMYB48 coding region sequence, and kanamycin resistance; The engineering bacteria are Escherichia coli or Agrobacterium containing a pBI121-SlMYB48 gene overexpression vector.

7. A method for regulating plant salt tolerance, characterized in that: Regulating the expression level of the tomato SlMYB48 gene; the encoded protein of the tomato SlMYB48 gene has the amino acid sequence shown in SEQ ID NO.

1.

8. A method for regulating plant salt tolerance according to claim 7, characterized in that: The salt tolerance of the plant is improved by increasing the expression level of the tomato S1MYB48 gene in the plant; or, a salt-tolerant strain is cultivated by hybridizing a strain overexpressing the tomato S1MYB48 gene with other strains.

9. A method for regulating plant salt tolerance as claimed in claim 7, characterized in that: Increasing the expression level of the tomato SlMYB48 gene in the plant is achieved by using the overexpression vector pBI121. The overexpression sequence used in the pBI121 vector is the CDS sequence of SlMYB48, specifically the nucleotide sequence shown in SEQ ID NO.2.

Images