Sclerotium rolfsii, fungicide, molecular marker and fermentation method

Abstract

The invention belongs to the technical field of microbial biological products, and particularly relates to sclerotium rolfsii, a fungicide, a molecular marker and a fermentation method. The invention provides a Sclerotium rolfsii TP-A strain, the preservation number of the Sclerotium rolfsii TP-A strain is CGMCC (China General Microbiological Culture Collection Center) No.41666, and the molecular marker of the Sclerotium rolfsii TP-A strain is shown as SEQ ID NO.2. The Sclerotium rolfsii TP-A strain has the advantages that the The sclerotium rolfsii TP-A provided by the invention can be used for producing the scleroglucan by utilizing glucose fermentation under proper conditions, and the yield of the scleroglucan is high. The result of the embodiment shows that the yield of the scleroglucan prepared from the sclerotium rolfsii TP-A can reach 34.1 g / L. The invention further provides a fermentation method of the scleroglucan, and the yield of the prepared scleroglucan is high.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial biological products, and specifically relates to a strain of Sclerotium sclerotiorum, a bacterial agent, a molecular marker and a fermentation method. Background Art

[0002] Scleroglucan is an extracellular polysaccharide secreted by some fungi. It is a non-ionic water-soluble β-glucan. Scleroglucan is composed of β-1,3-pyranose glucose and β-1,6-pyranose glucose residues. In aqueous solution, scleroglucan presents a molecular model of triple helical conformation, in which the side groups carried on the same helical chain are linked together under the mediation of water molecules to form a helical structure.

[0003] At present, the main strain for industrial production of scleroglucan is Sclerotium uniformis. The reported Sclerotium uniformis strains produce low yields of scleroglucan. Summary of the invention

[0004] The purpose of the present invention is to provide a strain of Sclerotium uniformis, a bacterial agent, a molecular marker and a fermentation method. The yield of scleroglucan prepared by the Sclerotium uniformis TP-A provided by the present invention is high.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The invention provides a strain of Sclerotium rolfsii TP-A, whose deposit number is CGMCC No.41666.

[0007] The present invention provides a bacterial agent, comprising the Sclerotium truncatum TP-A described in the above technical solution.

[0008] The present invention provides the use of Sclerotium truncatum TP-A described in the above technical solution or the bacterial agent described in the above technical solution in preparing scleroglucan and / or increasing the yield of scleroglucan.

[0009] The present invention provides a method for fermenting scleroglucan. The scleroglucan is obtained by inoculating the Sclerotium truncatum TP-A described in the above technical solution into a fermentation medium for fermentation culture. The fermentation medium contains glucose.

[0010] Preferably, the initial rotation speed of the fermentation culture is 250 rpm, which increases by 50 rpm every 10 hours to 400 rpm and is maintained until the end of fermentation; the ventilation volume of the fermentation culture is 1 to 1.5 vvm.

[0011] Preferably, the fermentation medium comprises: 60-80 g / L glucose, 2.0-4.0 g / L NaNO3, 1.0-3.0 g / L yeast powder, 0.5-1.0 g / L MgSO4, 0.5-1.0 g / L KCl, 0.5-1.0 g / L citric acid and 0.5-1.5 g / L K2HPO4.

[0012] The present invention provides a molecular marker for detecting or identifying Sclerotium truncatum TP-A described in the above technical solution, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.2.

[0013] The present invention provides the use of a reagent for detecting the molecular marker described in the above technical solution in the preparation of a detection or identification product for Sclerotium truncatum TP-A described in the above technical solution.

[0014] The present invention provides a primer pair for amplifying the molecular marker described in the above technical solution, including TP-A-1 and TP-A-2, the nucleotide sequence of TP-A-1 is shown in SEQ ID NO.3, and the nucleotide sequence of TP-A-2 is shown in SEQ ID NO.4.

[0015] The present invention provides a kit for detecting or identifying the Sclerotium truncatum TP-A described in the above technical solution, comprising the primer pair described in the above technical solution.

[0016] Beneficial effects of the present invention: The present invention provides a strain of Sclerotium rolfsii TP-A, with a deposit number of CGMCC No. 41666. The Sclerotium rolfsii TP-A provided by the present invention can produce scleroglucan by glucose fermentation under suitable conditions, and the yield of scleroglucan is high. The results of the embodiment show that the yield of scleroglucan prepared by Sclerotium rolfsii TP-A can reach 34.1 g / L.

[0017] The invention also provides a scleroglucan fermentation method, and the scleroglucan prepared has high yield.

[0018] The present invention also provides a molecular marker for detecting or identifying Sclerotium uniformum TP-A described in the above technical solution. When the gene sequencing result of the strain is completely consistent with the molecular marker sequence, it indicates that the strain is Sclerotium uniformum TP-A. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the phylogenetic tree of Sclerotium TP-A;

[0020] Figure 2 This is the result diagram of the effect of glucose concentration on the production of scleroglucan by Sclerotium TP-A;

[0021] Figure 3 This is the result diagram of the effect of different organic nitrogen sources on the production of scleroglucan by Sclerotium TP-A;

[0022] Figure 4 This is the result diagram of the effect of yeast powder concentration on the production of scleroglucan by Sclerotium TP-A;

[0023] Figure 5 This is the result diagram of the effect of MgSO4 concentration on the production of scleroglucan by Sclerotium TP-A;

[0024] Figure 6 This is the result diagram of the effect of different ventilation rates on the production of scleroglucan by Sclerotium TP-A;

[0025] Figure 7 This is a graph showing the effect of different rotation speeds in the fermentation tank on the production of scleroglucan by Sclerotium TP-A.

[0026] Biological Deposit Description

[0027] Sclerotium rolfsii TP-A was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on November 20, 2024, with the deposit number CGMCC No.41666. The address of the deposit unit is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0028] The present invention provides a strain of Sclerotium rolfsii TP-A, with a deposit number of CGMCC No. 41666. The ITS sequence of the Sclerotium rolfsii TP-A of the present invention is shown in SEQ ID NO.1.

[0029] SEQ ID NO. 1: GACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCC.

[0030] The invention uses peanut plants infected with white rot as raw materials to separate Sclerotium truncatum TP-A. The Sclerotium truncatum TP-A is used to produce scleroglucan with high yield.

[0031] The present invention provides a bacterial agent, comprising the Sclerotium truncatum TP-A described in the above technical solution.

[0032] The present invention provides the use of Sclerotium truncatum TP-A described in the above technical solution or the bacterial agent described in the above technical solution in preparing scleroglucan and / or increasing the yield of scleroglucan.

[0033] The scleroglucan prepared by using the Sclerotium truncatum TP-A in the present invention has a high yield, which can reach 34.1 g / L.

[0034] The invention provides a fermentation method for scleroglucan, wherein the Sclerotium truncatum TP-A is inoculated into a culture medium for fermentation and culture to obtain scleroglucan; the culture medium contains glucose.

[0035] As an optional embodiment, the present invention inoculates the seed liquid of the neat sclerotium TP-A into a culture medium for fermentation culture to obtain hard glucan. As an optional embodiment, the method for preparing the seed liquid of the present invention comprises: inoculating the cake of the neat sclerotium TP-A into a seed culture medium for seed culture to obtain TP-A seed liquid. The present invention has no special limitation on the preparation method of the cake, and a conventional method can be used. The culture medium used in the preparation of the cake of the present invention can be a PDA culture medium. As an optional embodiment, the temperature of the seed culture of the present invention is 26-30°C, preferably 28°C; the time of the seed culture is 65-75h, preferably 72h; the rotation speed of the seed culture can be 220-280rpm, preferably 250rpm. The present invention has no specific limitation on the amount of liquid in the seed culture medium, and conventional parameters can be used. In a specific embodiment of the present invention, the amount of liquid in the seed culture medium is 50mL of seed culture medium in a 250mL conical flask.

[0036] As an optional embodiment, the composition of the seed culture medium of the present invention includes: 30-40 g / L glucose, 2.0-4.0 g / L NaNO3, 1.0-3.0 g / L yeast powder, 0.5-1.0 g / L MgSO4, 0.5-1.0 g / L KCl, 0.5-1.0 g / L citric acid and 0.5-1.5 g / L K2HPO4, more preferably 40 g / L glucose, 2.0 g / L NaNO3, 1.0 g / L yeast powder, 1.0 g / L MgSO4, 1.0 g / L KCl, 1.0 g / L citric acid and 1.5 g / L K2HPO4; the pH of the seed culture medium is 4.2±0.2, preferably 4.0.

[0037] As an optional embodiment, the inoculation amount of the TP-A seed solution of the present invention is 8% to 12% of the volume of the culture medium. In a specific embodiment of the present invention, the inoculation amount is 8%, 9%, 10%, 11% or 12% of the volume of the culture medium. The temperature of the fermentation culture of the present invention is 26 to 30°C; in a specific embodiment of the present invention, the temperature of the fermentation culture is 26, 27, 28, 29 or 30°C; the time of the fermentation culture is 4 to 6 days, or 4 to 5 days; in a specific embodiment of the present invention, the time of the fermentation culture is 4, 5 or 6 days. The culture medium used for the fermentation culture of the present invention contains glucose.

[0038] As an optional embodiment, the composition of the culture medium (i.e., fermentation medium) used in the fermentation culture of the present invention includes: 60-80 g / L glucose, 1.0-3.0 g / L yeast powder, 2.0-4.0 g / L NaNO3, 0.5-1.0 g / LMgSO4, 0.5-1.0 g / L KCl, 0.5-1.0 g / L citric acid and 0.5-1.5 g / L K2HPO4; preferably includes 70 g / L glucose, 2.0 g / L NaNO3, 2.0 g / L yeast powder, 0.5 g / L MgSO4, 0.5 g / L KCl, 0.5 g / L citric acid and 0.5 g / L K2HPO4.

[0039] As an optional embodiment, the fermentation medium of the present invention includes 60-80 g / L glucose, preferably 70 g / L; in a specific embodiment of the present invention, the mass volume concentration of glucose in the fermentation medium is 60, 70 or 80 g / L, providing a carbon source for the growth of Sclerotium TP-A.

[0040] As an optional embodiment, the fermentation medium of the present invention includes 1.0-3.0 g / L yeast powder, or 1.5-2.5 g / L, more preferably 2 g / L; in a specific embodiment of the present invention, the mass volume concentration of yeast powder in the fermentation medium is 1.0, 1.5, 2.0, 2.5 or 3.0 g / L, and the role of the yeast powder is to provide nitrogen source nutrients required for the growth of Sclerotium TP-A.

[0041] As an optional embodiment, the fermentation medium of the present invention includes 2.0-4.0 g / L NaNO3, or 2.0-3.0 g / L; in a specific embodiment of the present invention, the mass volume concentration of NaNO3 in the fermentation medium is 2.0, 2.5, 3.0, 3.5 or 4.0 g / L. The role of the NaNO3 is to provide an inorganic nitrogen source for Sclerotium TP-A, promote the growth and reproduction of microorganisms, and increase the scleroglucan fermentation yield of Sclerotium TP-A.

[0042] As an optional embodiment, the fermentation medium of the present invention includes 0.5-1.0 g / LMgSO4, or 0.5-0.75 g / L; in a specific embodiment of the present invention, the mass volume concentration of MgSO4 in the fermentation medium is 0.5, 0.6, 0.75, 0.9 or 1.0 g / L. The role of MgSO4 is to provide the magnesium element necessary for the growth of Sclerotium TP-A. Magnesium is an activator of many enzymes, which can promote the metabolism of microorganisms and increase the scleroglucan fermentation yield of Sclerotium TP-A.

[0043] As an optional embodiment, the fermentation medium of the present invention includes 0.5-1.0 g / L KCl, or 0.5-0.7 g / L; in a specific embodiment of the present invention, the mass volume concentration of KCl in the fermentation medium is 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 g / L. The role of KCl is to provide potassium ions, maintain the electrolyte balance in the fermentation system, and regulate the osmotic pressure. The appropriate potassium ion concentration also helps to increase the activity of some enzymes, thereby improving the fermentation efficiency and product quality of Sclerotium TP-A.

[0044] As an optional embodiment; the fermentation medium of the present invention includes 0.5-1.0 g / L citric acid, or 0.5-0.9 g / L. In a specific embodiment of the present invention, the mass volume concentration of citric acid in the fermentation medium is 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 g / L. During the fermentation process, the citric acid promotes the fermentation reaction of Sclerotium TP-A mainly by catalysis and pH adjustment.

[0045] As an optional embodiment, the fermentation medium of the present invention includes 0.5-1.5 g / L K2HPO4, or 0.5-1.2 g / L. In a specific embodiment of the present invention, the mass volume concentration of citric acid in the fermentation medium is 0.5, 0.7, 0.8, 0.9, 1.1 or 1.2 g / L. The role of the K2HPO4 is to act as a buffer, effectively maintaining a relatively stable fermentation environment, and ensuring the smooth progress of the fermentation reaction of Sclerotium TP-A.

[0046] The pH of the fermentation medium of the present invention is 4.2±0.2, preferably 4.0. The various material compositions and proportions of the fermentation medium of the present invention can increase the yield of scleroglucan produced by Sclerotium truncatum TP-A.

[0047] As an optional embodiment, the initial rotation speed of the fermentation culture of the present invention is 250 rpm, which is gradually increased to 400 rpm by 50 rpm every 10 hours, and maintained at 400 rpm until the end of fermentation; the ventilation volume of the fermentation culture of the present invention is 1 to 1.5 vvm, preferably 1 vvm. The setting of the rotation speed and ventilation volume of the fermentation culture of the present invention can increase the yield of scleroglucan.

[0048] The present invention provides a molecular marker for detecting or identifying Sclerotium truncatum TP-A described in the above technical solution, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 2. When the gene sequencing result of the strain is completely consistent with the nucleotide sequence of the molecular marker, it indicates that the strain is Sclerotium truncatum TP-A.

[0049] When the genome of the strain is used as a template, if the gene sequencing result is completely consistent with the molecular sequence SEQ ID NO.2, it means that the strain is a TP-A strain; when the genome of hard glucan powder and its lightly processed products is used as a template, if the gene sequencing result is completely consistent with the molecular sequence SEQ ID NO.2, it means that the product is one or more of the hard glucan produced by TP-A or its lightly processed products.

[0050] The present invention provides the use of a reagent for detecting the molecular marker described in the above technical solution in the preparation of a product for detecting or identifying Sclerotium truncatum TP-A described in the above technical solution. As an optional embodiment, the product includes a reagent and / or a kit. As an optional embodiment, the present invention has no special requirements for the preparation method of the kit, and a method familiar to those skilled in the art can be used.

[0051] The present invention provides a primer pair for amplifying the molecular marker described in the above technical solution, including TP-A-1 and TP-A-2, the nucleotide sequence of the TP-A-1 is shown in SEQ ID NO.3, and the nucleotide sequence of the TP-A-2 is shown in SEQ ID NO.4. As an optional embodiment, the amplification includes PCR amplification; the PCR amplification system includes: 100ng / μL DNA template: 0.4μL; 20μM primer pair: 0.3μL TP-A-1, 0.3μL TP-A-2; PrimeSTAR Max Premix (2X): 12.5μL; add water to 25μL. The reaction conditions of the PCR amplification include: ①98℃: 30~45s, ②50℃: 10~20s, ③72℃: 40~60s, ①~③ total 34 cycles; 72℃ extension for 2min.

[0052] The present invention provides a kit for detecting or identifying Sclerotium truncatum TP-A described in the above technical solution, comprising the primer pair described in the above technical solution. The present invention has no special requirements for the preparation method of the kit, and a method familiar to those skilled in the art can be used.

[0053] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0054] The culture medium and assay method used in the following examples

[0055] 1. Culture medium

[0056] Composition of PDA medium (g / L): potato extract powder 12.0, glucose 20.0 and agar 14.0; pH 5.6±0.2;

[0057] The composition of the seed culture medium (g / L): glucose 40; NaNO3 2.0; yeast powder 1.0; MgSO4 1.0; KCl 1.0; citric acid 1.0; K2HPO4 1.5; pH 4.0.

[0058] 2. Determination method

[0059] The obtained fermentation broth was subjected to viscosity measurement, scleroglucan yield measurement and glucose residual measurement, and the specific method was as follows:

[0060] (1) Viscosity measurement method: The viscosity of the fermentation broth was measured using a Brookfield viscometer (spindle No. 64, 12 rpm).

[0061] (2) Method for determining the yield of scleroglucan: Weigh a certain mass of fermentation broth, add an equal volume of distilled water, and stir it evenly with a glass rod. Heat to 75°C for 20 minutes, and adjust the pH to 7.0 with 1 mol / L NaOH solution after cooling to room temperature. Then add three times the volume of anhydrous ethanol to the fermentation broth, stir so that the scleroglucan is fully in contact with the ethanol and then precipitates. Finally, place the extracted scleroglucan in a 90°C oven for 2 hours, dry it, and take it out. Grind it with a grinder and weigh it.

[0062] (3) Method for determining residual glucose content: Take a small amount of fermentation broth in a 5 mL centrifuge tube, dilute it 70 times with distilled water, mix it thoroughly, and filter it to obtain the filtrate. Take 15 μL of the filtrate and use a glucose / lactose residual sugar meter to determine the residual glucose content.

[0063] 3. Figure 2 to Figure 7 The graph is the average value of parallel experiments.

[0064] Example 1 Isolation and identification of Sclerotium truncatum TP-A strain

[0065] The strain TP-A was isolated from the surface of peanut plants infected with white rot. The specific isolation method is as follows: cut the stem segment at the lesion site of peanut white rot, the length of the stem segment is more than 1 cm, and then the surface of the stem segment is disinfected with 75% alcohol by volume, and then treated with 30% sodium hypochlorite solution by mass concentration for 2 minutes, rinsed with sterile water 3 times, transferred to the PDA culture medium plate, and placed in a 30°C incubator to culture until the mycelium is about to cover the plate. Cut a 5mm diameter bacterial cake at the edge of the mycelium, re-inoculate it into a new PDA culture medium plate for purification, repeat the purification 3 times, and obtain a single pure strain colony. The isolated strain is named TP-A.

[0066] The identification method of strain TP-A is as follows: the genome of strain TP-A is extracted using a fungal genome extraction kit; its ITS sequence is identified by PCR. The primers used are universal primer ITS1 (SEQ ID NO.3: TCCGTAGGTGAACCTGCGG) and universal primer ITS4 (SEQ ID NO.4: TCCTCCGCTTATTGATATGC).

[0067] PCR system: 100 ng / μL DNA template: 0.4 μL; 20 μM primer pair: 0.3 μL ITS1 and 0.3 μL ITS4; PrimeSTARMax Premix (2X): 12.5 μL; add water to 25 μL.

[0068] PCR reaction conditions: 98°C: 30 s, 50°C: 10 s, 72°C: 40 s, 34 cycles; extension at 72°C for 2 min;

[0069] After electrophoresis detection, the target fragment was recovered from the gel and sent to a sequencing company for sequencing. The sequence length was 766 bp, and its sequence is shown in SEQ ID NO.1. Its evolutionary tree is shown in Figure 1 As shown, since Sclerotium rolfsii is also known as Agroathelia rolfsii, it can be considered that TP-A belongs to Agroathelia rolfsii, that is, Sclerotium rolfsii.

[0070] Example 2 Optimization of Components of Scleroglucan Fermentation Medium

[0071] The experiment on optimizing the composition of scleroglucan fermentation medium was carried out under shake flask conditions.

[0072] 1. Glucose concentration optimization

[0073] Fermentation method: Grow Sclerotium TP-A on a PDA plate for 4 days, inoculate it into a seed culture medium, put 50 mL of the seed culture medium into a 250 mL conical flask, and then culture it at 28°C and 250 rpm for 72 hours. The obtained seed liquid is inoculated into fermentation media 1 to 3 at a volume ratio of 10%, respectively, put 100 mL of the fermentation culture medium into a 500 mL conical flask, and then culture it at 28°C and 250 rpm for 96 hours to obtain a fermentation liquid.

[0074] The composition of fermentation medium 1 was (g / L): glucose 60, NaNO3 2.0, yeast powder 1.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0; three parallel experiments were set;

[0075] The composition of fermentation medium 2 was (g / L): glucose 70, NaNO3 2.0, yeast powder 1.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0; three parallel experiments were set;

[0076] The composition of fermentation medium 3 was (g / L): glucose 80, NaNO3 2.0, yeast powder 1.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5, pH 4.0; three parallel experiments were set up.

[0077] The obtained fermentation broth was subjected to viscosity measurement, scleroglucan yield measurement and glucose residual measurement. The results are shown in Tables 1 and Figure 2 , where Viscosity represents viscosity; Scleroglucan represents scleroglucan; Glucose represents glucose, the same below.

[0078] Table 1 Results of determination of viscosity, scleroglucan and residual glucose in fermentation broth

[0079]

[0080] It can be seen that the carbon source is crucial to the fermentation of microorganisms, and glucose is one of the commonly used carbon sources for microbial fermentation. It is very necessary to explore the effect of glucose concentration on the production of scleroglucan by Sclerotium TP-A. Figure 2 As shown in the figure, with the increase of glucose concentration, the viscosity of the fermentation broth and the yield of scleroglucan showed a trend of increasing first and then decreasing. When the glucose concentration was 70 g / L, the average viscosity of the three parallel tests was 8932 cP, the average yield of scleroglucan reached 27.69 g / L, the average residual glucose content was 23.69 g / L, and the glucose utilization rate was 66.15%. At this time, the strain TP-A had the best fermentation effect.

[0081] 2. Effect of organic nitrogen source types on scleroglucan production

[0082] Fermentation method: Grow Sclerotium TP-A on a PDA plate for 4 days, inoculate it into a seed culture medium with a liquid volume of 50 mL of seed culture medium / 250 mL of a conical flask, and then culture it at 28°C, 250 rpm for 72 hours. The resulting seed liquid is inoculated into fermentation culture media 4 to 8 at a volume ratio of 10% inoculation rate, respectively, with a liquid volume of 100 mL of fermentation culture medium / 500 mL of a conical flask, and then cultured at 28°C, 250 rpm for 96 hours to obtain a fermentation liquid.

[0083] The composition of fermentation medium 4 was (g / L): 70 glucose, 2.0 NaNO3, 1.0 yeast powder, 0.5 MgSO4, 0.5 KCl, 0.5 citric acid and 0.5 K2HPO4; pH 4.0; three parallel experiments were set;

[0084] The composition of fermentation medium 5 was (g / L): 70 glucose, 2.0 NaNO3, 1.0 corn steep liquor powder, 0.5 MgSO4, 0.5 KCl, 0.5 citric acid and 0.5 K2HPO4; pH 4.0; three parallel experiments were set;

[0085] The composition of fermentation medium 6 was (g / L): 70 glucose, 2.0 NaNO3, 1.0 soybean powder, 0.5 MgSO4, 0.5 KCl, 0.5 citric acid and 0.5 K2HPO4; pH 4.0; three parallel experiments were set;

[0086] The composition of fermentation medium 7 was (g / L): 70 glucose, 2.0 NaNO3, 1.0 soy protein, 0.5 MgSO4, 0.5 KCl, 0.5 citric acid and 0.5 K2HPO4; pH 4.0; three parallel experiments were set;

[0087] The composition of fermentation medium 8 was (g / L): 70 glucose, 2.0 NaNO3, 1.0 peptone, 0.5 MgSO4, 0.5 KCl, 0.5 citric acid and 0.5 K2HPO4; pH 4.0; three parallel experiments were set up.

[0088] The obtained fermentation broth was subjected to viscosity measurement, scleroglucan yield measurement and glucose residual measurement. The results are shown in Table 2 and Figure 3 , where Viscosity stands for viscosity; Scleroglucan stands for scleroglucan; and Glucose stands for glucose.

[0089] Table 2 Results of determination of viscosity, scleroglucan and residual glucose in fermentation broth

[0090]

[0091] The effects of yeast powder, corn syrup powder, soybean powder, soy protein and peptone as organic nitrogen sources on TP-A production of scleroglucan were investigated. It can be seen that yeast powder and corn syrup powder have the best effect on TP-A production of scleroglucan among organic nitrogen sources, and the viscosity is almost the same. The scleroglucan yield of yeast powder as an organic nitrogen source is 27.4g / L, which is slightly higher than the scleroglucan yield of corn syrup powder as a nitrogen source, which is 25.43g / L. And when yeast powder is used as a nitrogen source, the remaining glucose at the end of fermentation is the least, which is 25.67g / L. Therefore, yeast powder is determined to be an organic nitrogen source.

[0092] 3. Effect of yeast powder concentration on scleroglucan production

[0093] The effect of different concentrations of yeast powder on the production of scleroglucan by strain TP-A was further explored.

[0094] The fermentation method is the same as step 2, the only difference being the composition of the fermentation medium.

[0095] The composition of fermentation medium 9 to 12 is as follows:

[0096] The composition of fermentation medium 9 was (g / L): glucose 70, NaNO3 2.0, yeast powder 0.5, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0; three parallel experiments were set;

[0097] The composition of the fermentation medium 10 was (g / L): glucose 70, NaNO3 2.0, yeast powder 1.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0; three parallel experiments were set;

[0098] The composition of the fermentation medium 11 was (g / L): glucose 70, NaNO3 2.0, yeast powder 1.5, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0; three parallel experiments were set;

[0099] The composition of the fermentation medium 12 was (g / L): 70 glucose, 2.0 NaNO3, 2.0 yeast powder, 0.5 MgSO4, 0.5 KCl, 0.5 citric acid and 0.5 K2HPO4; pH 4.0; three parallel experiments were set up.

[0100] The obtained fermentation broth was subjected to viscosity measurement, scleroglucan production measurement and glucose residual measurement. The results are shown in Figure 4It can be seen that the optimum concentration of yeast powder is 2g / L. Under this condition, the viscosity of the fermentation liquid and the yield of scleroglucan are the highest at the end of fermentation, with a viscosity of 8948cP, a scleroglucan yield of 26.76g / L, and a residual glucose content (i.e., residual sugar) of 22.5g / L.

[0101] 4. Effect of magnesium sulfate concentration on scleroglucan yield

[0102] The fermentation method is the same as step 2, the only difference being the composition of the fermentation medium.

[0103] The composition of the fermentation medium is as follows:

[0104] The composition of the fermentation medium 13 was (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5, pH 4.0; three parallel experiments were set;

[0105] The composition of the fermentation medium 14 was (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 1.0, KCl 0.5, citric acid 0.5 and K2HPO4 0.5, pH 4.0; three parallel experiments were set;

[0106] The composition of the fermentation medium 15 was (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 1.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5, pH 4.0; three parallel experiments were set;

[0107] The composition of the fermentation medium 16 was (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 2.0, KCl 0.5, citric acid 0.5 and K2HPO4 0.5, pH 4.0; three parallel experiments were set up.

[0108] The obtained fermentation broth was subjected to viscosity measurement, scleroglucan production measurement and glucose residual measurement. The results are shown in Figure 5 and Table 3.

[0109] During the fermentation process, MgSO4 is mainly used to provide the magnesium necessary for microbial growth. Therefore, the effects of four concentrations of MgSO4, 0.05% (i.e. 0.5 g / L), 0.1% (i.e. 1.0 g / L), 0.15% (i.e. 1.5 g / L) and 0.2% (i.e. 2 g / L), on TP-A fermentation were investigated. The results are shown in Figure 2. Figure 5As shown in Table 3, the fermentation medium had better effects when the initial concentration of MgSO4 was 0.5 g / L, 1.0 g / L and 1.5 g / L. Considering the need to save energy as much as possible after the scale-up process, the optimal concentration of MgSO4 was selected as 0.5 g / L. At this time, the average yield of scleroglucan was 30.26 g / L.

[0110] Table 3 Results of determination of viscosity, scleroglucan and residual glucose in fermentation broth

[0111]

[0112]

[0113] In summary, the composition of the optimal fermentation medium is (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0.

[0114] Example 3 Optimization of ventilation rate in scleroglucan fermentation

[0115] During the fermentation process in the fermenter, dissolved oxygen is crucial to the fermentation of scleroglucan, and dissolved oxygen is mainly affected by ventilation volume and stirring speed.

[0116] Fermentation method: Grow Sclerotium TP-A on a PDA plate for 4 days, inoculate it into a seed culture medium with a liquid volume of 50 mL seed culture medium / 250 mL conical flask, and then culture it at 28°C, 250 rpm for 72 h. The resulting seed liquid is inoculated into the fermentation medium at a volume ratio of 10% inoculation rate for fermentation culture. A 15 L fermentation tank is filled with 10 L of fermentation medium and then cultured at 28°C, 250 rpm.

[0117] The fermentation medium composition was (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0.

[0118] The ventilation rates during the fermentation culture were set at 0.5 vvm, 1 vvm and 1.5 vvm, respectively. The fermentation culture was carried out for 120 h, and the scleroglucan yield, residual glucose content and fermentation liquid viscosity were measured. The results are shown in Tables 4 and Figure 6 .

[0119] Table 4 Results of determination of viscosity, scleroglucan and residual glucose in fermentation broth

[0120]

[0121] It can be seen that the yield of scleroglucan is the lowest when the ventilation volume is 0.5vvm, indicating that low ventilation is not conducive to the fermentation of scleroglucan. When the ventilation volume is 1vvm and 1.5vvm, the viscosity of scleroglucan fermentation liquid and the yield of scleroglucan are close, and the fermentation effect is slightly better when the ventilation volume is 1vvm. At the same time, considering the energy consumption during the fermentation process, the ventilation volume of 1vvm is more suitable for the fermentation of scleroglucan.

[0122] Example 4 Optimization of the fermentation speed of scleroglucan

[0123] The speed is also crucial for the fermentation of scleroglucan. Too low a speed will lead to low dissolved oxygen. As mentioned above, low dissolved oxygen is not conducive to the fermentation of scleroglucan; but too high a speed may damage the mycelial structure of Sclerotium sclerotiorum and affect subsequent fermentation. Therefore, the fermentation is carried out by gradually increasing the speed. In the early stage, the speed is low to avoid damaging the strain structure, and in the later stage, the speed is high to ensure the dissolved oxygen in the fermentation tank.

[0124] The TP-A seed solution of Sclerotium uniformis cultured for 72 hours was inoculated into a 15L fermenter containing 10L fermentation medium at a volume ratio of 10%, and the fermentation culture was carried out for 120 hours at a temperature of 28°C and a ventilation volume of 1vvm.

[0125] The fermentation medium composition was (g / L): glucose 70, NaNO3 2.0, yeast powder 2.0, MgSO4 0.5, KCl 0.5, citric acid 0.5 and K2HPO4 0.5; pH 4.0.

[0126] Four speed modes are designed:

[0127] The first mode (denoted as 0): the initial rotation speed of the fermentation culture is 0 rpm. At the 48th hour of the fermentation culture, the rotation speed is adjusted to 250 rpm, and then gradually increased to 400 rpm at a rate of 50 rpm / 10 h and maintained until the end of the fermentation.

[0128] The second mode (denoted as 50): the initial rotation speed of the fermentation culture is 50 rpm, which is gradually increased to 400 rpm at 50 rpm / 10 h and maintained until the end of the fermentation.

[0129] The third mode (denoted as 150): the initial rotation speed of the fermentation culture is 150 rpm, which is gradually increased to 400 rpm at 50 rpm / 10 h and maintained until the end of the fermentation.

[0130] The fourth mode (denoted as 250): the initial rotation speed of the fermentation culture is 250 rpm, which is gradually increased to 400 rpm at 50 rpm / 10 h and maintained until the end of the fermentation.

[0131] After the fermentation was completed, the yield of scleroglucan, the viscosity of the fermentation liquid and the residual glucose content of the fermentation liquid were measured to compare the fermentation effects under the four speed modes. The results are shown in Table 5 and Figure 7 .

[0132] Table 5 Results of determination of viscosity, scleroglucan and residual glucose in fermentation broth

[0133] Initial speed (rpm) Viscosity(cP) Scleroglucan(g / L) Glucose(g / L) 0 8249 25.02 27.30 50 8499 26.13 24.50 150 8549 30.25 18.20 250 10098 34.10 14.70

[0134] It can be seen that in the fourth speed mode, the speed of 250rpm in the early stage can not only shorten the lag period but also avoid the damage of the mycelial structure due to excessive speed, and the speed of 400rpm in the later stage can also ensure sufficient dissolved oxygen in the fermentation tank, which is conducive to the fermentation of the strain. This makes the fermentation effect of scleroglucan the best, and the yield reaches 34.1g / L.

[0135] Example 5 Molecular markers of scleroglucan producing strains

[0136] Two primers were designed based on the key gene of scleroglucan production in Sclerotium TP-A, the two primers were TP-A-1 (SEQ ID NO.3: ATGGCAGTACCACCCGTTTG) and TP-A-2 (SEQ ID NO.4: TTATGCATCGCGCTCAGATG). The specific method of using molecular markers for identification is as follows:

[0137] (1) extracting the genome of the scleroglucan producing strain TP-A, or the genome of the scleroglucan powder produced by the strain TP-A and its slightly processed products;

[0138] (2) PCR system: 100 ng / μL DNA template: 0.4 μL; 20 μM primer pair: 0.3 μL TTP-A-1, 0.3 μL TTP-A-2; PrimeSTAR Max Premix (2X): 12.5 μL; add water to 25 μL.

[0139] (3) PCR reaction conditions: ① 98°C: 30-45 s, ② 50°C: 10-20 s, ③ 72°C: 40-60 s, ①-③ for a total of 34 cycles; 72°C extension for 2 min;

[0140] (4) After electrophoresis detection, the target fragment was recovered from the gel and sent to a sequencing company for sequencing. The molecular sequence length was 1109 bp, and the molecular marker sequence was shown in SEQ ID NO. 2, that is, the specific molecular marker of the strain producing scleroglucan was obtained.

[0141] When the genome of the strain is used as a template, if the gene sequencing result is completely consistent with the molecular sequence SEQ ID NO.2, it means that the strain is a TP-A strain; when the genome of hard glucan powder and its lightly processed products is used as a template, if the gene sequencing result is completely consistent with the molecular sequence SEQ ID NO.2, it means that the product is one or more of the hard glucan produced by TP-A or its lightly processed products.

[0142]

[0143] In summary, the present invention provides a strain of Sclerotium rolfsii TP-A, with a deposit number of CGMCC No. 41666, and the molecular marker of Sclerotium rolfsii TP-A is shown in SEQ ID NO. 2. The Sclerotium rolfsii TP-A provided by the present invention can produce scleroglucan by glucose fermentation under suitable conditions, and the yield of scleroglucan is high.

[0144] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Sclerotium rolfsii TP-A, with a deposit number of CGMCC No.41666.

2. A bacterial agent, characterized in that Contains the Sclerotium truncatum TP-A as claimed in claim 1.

3. Use of the Sclerotium truncatum TP-A described in claim 1 or the bacterial agent described in claim 2 in preparing scleroglucan and / or increasing the yield of scleroglucan.

4. A fermentation method for scleroglucan, characterized in that: The Sclerotium truncatum TP-A described in claim 1 is inoculated into a fermentation medium for fermentation culture to obtain scleroglucan; the fermentation medium contains glucose.

5. The fermentation method according to claim 4, characterized in that: The initial rotation speed of the fermentation culture is 250 rpm, which increases by 50 rpm every 10 hours to 400 rpm and is maintained until the end of the fermentation; the ventilation volume of the fermentation culture is 1 to 1.5 vvm.

6. The fermentation method according to claim 4, characterized in that: The fermentation medium comprises: 60-80 g / L glucose, 2.0-4.0 g / L NaNO3, 1.0-3.0 g / L yeast powder, 0.5-1.0 g / L MgSO4, 0.5-1.0 g / L KCl, 0.5-1.0 g / L citric acid and 0.5-1.5 g / L K2HPO4.

7. A molecular marker for detecting or identifying the Sclerotium truncatum TP-A according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

2.

8. Use of a reagent for detecting the molecular marker described in claim 7 in preparing a product for detecting or identifying Sclerotium truncatum TP-A described in claim 1.

9. A primer pair for amplifying the molecular marker according to claim 7, characterized in that: It comprises TP-A-1 and TP-A-2, wherein the nucleotide sequence of TP-A-1 is shown as SEQ ID NO.3, and the nucleotide sequence of TP-A-2 is shown as SEQ ID NO.

4.

10. A kit for detecting or identifying the Sclerotium truncatum TP-A according to claim 1, characterized in that: Containing the primer pair according to claim 9.

Images