Recombinant bacterium for degrading crab shells as well as construction method and application of recombinant bacterium

Abstract

The invention belongs to the technical field of microbial genetic engineering, and particularly relates to a recombinant bacterium for degrading crab shells as well as a construction method and application of the recombinant bacterium. According to the invention, the pseudomonas putida KT2440 capable of carrying out growth and life activities by utilizing the crab shell substrate is subjected to metabolic engineering transformation, and two transformed engineering bacteria of overexpression strains KT + IV and KT + lasBT are constructed by utilizing overexpression exogenous protease genes lasBT and IV, so that the protein utilization rate is improved, the strains can better adapt to the fermentation environment of the crab shell substrate, and the yield of the crab shell substrate is improved. The growth ability of the strain is enhanced, high-value utilization of the crab shells is promoted, and a foundation is laid for efficient and large-scale conversion of the crab shells into high-value chemicals.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial genetic engineering, and more specifically, relates to a recombinant bacterium for degrading crab shells, a construction method and an application thereof. Background Art

[0002] As the main waste product of crustacean aquatic product processing, crab shells are rich in organic components such as protein, chitin and lipids, and have great potential for resource utilization. However, traditional treatment methods, such as chemical or physical methods, have problems such as high energy consumption and serious environmental pollution. Although microbial fermentation technology can achieve green transformation, its application still faces significant challenges. The complex components of crab shells, such as the complex structure of cross-linked proteins and chitin, lead to low efficiency of microbial degradation, poor strain adaptability and slow growth, which seriously restricts its industrial application.

[0003] In the prior art, although Pseudomonas putida KT2440 has a certain broad spectrum of substrates, its natural metabolic capacity is not sufficient to efficiently decompose the various components in crab shells, resulting in a high substrate residual rate and low bacterial biomass during the fermentation process. Summary of the invention

[0004] The purpose of the present invention is to provide a recombinant bacterium for degrading crab shells and a construction method and application thereof.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] The invention provides a recombinant bacterium for degrading crab shells. The recombinant bacterium is Pseudomonas putida KT2440 carrying an exogenous protease gene. The exogenous protease gene is an IV gene with a sequence as shown in SEQ ID NO.5 or a lasBT gene with a sequence as shown in SEQ ID NO.6.

[0007] The present invention transforms the metabolic engineering of Pseudomonas putida KT2440 which can use crab shell substrate for growth and life activities, and constructs the overexpression strain KT by overexpressing exogenous protease genes lasBT and IV. +IV , KT +lasBT The two engineered bacteria after modification improved their protein utilization rate, enabled the strains to better adapt to the crab shell substrate fermentation environment, enhanced the growth ability of the strains, promoted the high-value utilization of crab shells, and laid the foundation for the efficient and large-scale transformation of crab shells into high-value chemicals.

[0008] The present invention also provides a method for constructing the recombinant bacteria, comprising: transferring a recombinant overexpression plasmid carrying an exogenous protease gene into the Pseudomonas putida KT2440, and obtaining the recombinant bacteria through positive clone screening.

[0009] Furthermore, the recombinant overexpression plasmid carrying the exogenous protease gene is obtained by inserting the exogenous protease gene between the BamH I and Sac I sites of the pUCP18 plasmid.

[0010] The invention also provides application of the recombinant bacteria in fermentation and degradation of crab shells.

[0011] The present invention also provides a method for degrading crab shells, comprising: using crab shells as raw materials to prepare a fermentation medium, inoculating the recombinant bacteria, and degrading the crab shells through fermentation.

[0012] Furthermore, the crab shell culture medium is obtained by adding 1 to 10 g of crab shell fragments into 90 to 99 mL of LB liquid culture medium.

[0013] Furthermore, the inoculation amount of the bacterial solution is 0.5% to 1.5% of the volume of the crab shell culture medium.

[0014] Furthermore, the fermentation conditions are: temperature 28-32° C., fermentation time 40-45 h, and rotation speed 150-250 rpm / min.

[0015] The present invention also provides application of the recombinant bacteria in preparing products for degrading crab shells.

[0016] Furthermore, the degrading of crab shells includes degrading proteins and fats in the crab shells.

[0017] The present invention has the following beneficial effects:

[0018] The present invention transforms the Pseudomonas putida KT2440 that can use crab shell substrate for growth and life activities through metabolic engineering, and constructs an overexpression strain KT by overexpressing exogenous protease genes lasBT and IV. +IV , KT +lasBT The two engineered bacteria after modification reduced the substrate residue by reducing the dry weight percentage of protein and fat in the substrate. The modified strains can better adapt to the fermentation environment of crab shell substrates, increase bacterial growth, thereby increasing bacterial biomass, promote the high-value utilization of crab shells, and lay the foundation for the efficient and large-scale conversion of crab shells into high-value chemicals. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the structure of the overexpression vector of the exogenous protease gene, wherein A is a schematic diagram of the structure of the recombinant plasmid pPR-IV, and B is a schematic diagram of the structure of the recombinant plasmid pPR-lasBT.

[0020] Figure 2 This is a graph of bacterial growth.

[0021] Figure 3This is a graph showing the percentage of dry weight of protein in crab shell culture medium after fermentation.

[0022] Figure 4 This is a graph showing the percentage of dry weight fat in crab shell culture medium after fermentation. DETAILED DESCRIPTION

[0023] The present invention is described in detail with respect to specific examples below, but it should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0024] The Pseudomonas putida KT2440 in the present invention was purchased from the American ATCC Biological Standard Resource Center.

[0025] Example 1: Strain construction and fermentation.

[0026] 1. Preparation of experimental materials.

[0027] 1. Raw material preparation: The swimming crabs used in the experiment were purchased from the Meixi Village Vegetable Market in Ningbo. The raw materials were steamed at 105°C for 15 min. After cooling to room temperature, the muscles and internal organs were removed with dissecting tools, and the crab shell was retained. After being washed with clean water, it was dried at a constant temperature of 55°C for 12 h, crushed in a mortar until it passed through a 400-mesh sieve, and then dried at a constant temperature of 55°C to constant weight.

[0028] 2. Culture medium: The culture medium used in the present invention is prepared as follows: 10g peptone, 5g yeast powder, and 5g sodium chloride nutrient source are dissolved in 1L deionized water, autoclaved at 121°C for 20min, and cooled to obtain LB liquid culture medium; 10g peptone, 5g yeast powder, 5g sodium chloride, and 15g agar powder are dissolved in 1L water, autoclaved at 121°C for 20min, cooled to 60°C, shaken and poured into a plate, and solidified as LB agar culture medium. Crab shell culture medium is prepared by adding 7g crab shell fragments to 93mL of unsterilized LB liquid culture medium, shaking, sealing film covering the bottle mouth, and autoclaving at 121°C for 20min.

[0029] 3. Strain construction: The primers used for vector construction are listed in Table 1. The vector used was pUCP18, and the E. coli DH5α strain was used for all molecular operations during plasmid construction. The plasmid was constructed according to the standard molecular cloning protocol and verified by DNA sequencing for subsequent analysis. The overexpression vector was Figure 1 shown.

[0030] The IV gene sequence is shown in SEQ ID NO.5, and the lasBT gene sequence is shown in SEQ ID NO.6:

[0031]

[0032]

[0033] The target gene IV and lasBT gene were synthesized and sequence verified; the PCR reaction system was: Mix is ​​25 μL, upstream primer and downstream primer are 2 μL each, gene synthesis fragment is 2 μL, and sterile enzyme-free water is added to 25 μL. The PCR reaction procedure is: the first step is 98°C, 2min; the second step is 98°C, 10s; 60°C, 15s; 75°C, 30s, repeated 30 cycles; the third step is 72°C, 5min. The target gene is recovered by double restriction digestion with BamH I and Sac I, and connected to the pUCP18 vector by T4 ligase to obtain recombinant plasmids pPR-IV and pPR-lasBT; after the recombinant plasmids are transformed into E.coli DH5α competent cells, the recombinant plasmids in the strain with the correct sequence are extracted, and the constructed recombinant plasmids pPR-IV and pPR-lasBT are introduced into Pseudomonas putida KT2440 by electroporation using a gene introduction instrument to obtain the Pseudomonas putida engineered strain KT expressing exogenous protease +IV and KT +lasBT , the import parameters are 1200V, 400Ω.

[0034] Table 1. Primers used for vector construction.

[0035] Primer name Sequence 5'-3' SEQ ID NO. IV F CGGAATTCCATGCATAAGAGAACGTACCTGAAT 1 IV GGATCCTCAGGGCGCGAAGTAGCGGGAGAT 2 F CCGCGGATCCAAATAAAACGAAAGGCTCAGTCG 3 BT R CCCGGAATTCAAAAGGCCATCCGTCAGGAT 4

[0036] 2. Strain cultivation and fermentation.

[0037] Pick KT separately +IV and KT +lasBT The monoclonal colony was inoculated into 5 mL of LB liquid medium containing 30 mg / L gentamicin sulfate, and cultured at 30°C and 200 rpm for 24 h to obtain the seed solution. 7 The seed liquid with a CFU / mL was inoculated into the crab shell culture medium at a 1% inoculation rate to ferment and obtain the fermentation liquid. At the same time, an empty vector transformed strain was set as the control group. The fermentation parameter combination was: temperature 30°C, fermentation time 42h, and rotation speed 200rpm.

[0038] 3. Data measurement and processing.

[0039] 1. Determination of cell growth: Use the dilution plate method. In a sterile clean bench, dilute the fermentation liquid by 10 times to 10 -7 Take 100 μL of 10 -7 The 100-fold dilution was evenly spread on LB solid culture medium, cultured in a constant temperature incubator at 30°C for 24 hours, and the colonies growing on the plate were counted.

[0040] 2. Detection of protein content: The protein content is detected by Kjeldahl method, and the operation steps are as follows: ① Digestion: Weigh 0.5g of fermentation liquid into the digestion tube, add 0.3g of copper sulfate and 3g of sodium sulfate, and shake gently to mix. Place a small funnel at the mouth of the digestion tube, slowly add 10mL of 70% concentrated sulfuric acid by mass, and then support the digestion tube on the digestion furnace for heating and digestion. At the beginning, the temperature of the digestion furnace is set to 240℃ and heated for 1h, then the temperature is increased to 420℃ and continued to heat for 2h, and the digestion furnace is turned off to cool naturally to obtain the digestion liquid. The blank control adopts the same operation without adding fermentation liquid. ② Alkalinization distillation: After the digestion liquid is completely cooled, start the Kjeldahl nitrogen analyzer, slowly add 10mL of 40% sodium hydroxide solution by mass and start 300 sodium distillation for 10min to ensure that the ammonia is fully volatilized. The volatilized ammonia is condensed through the condenser and collected in a 2% boric acid solution by mass to obtain a 2% boric acid solution containing ammonia. ③ Titration: Titrate the 2% boric acid solution containing ammonia with 0.1 mol / L hydrochloric acid standard solution until it turns slightly red as the end point. Record the volume of the hydrochloric acid standard solution consumed and calculate the protein dry weight percentage according to the following formula:

[0041]

[0042] Wherein, V is the volume of hydrochloric acid standard solution consumed during sample titration, in mL; V0 is the volume of hydrochloric acid standard solution consumed during blank titration, in mL; C is the concentration of hydrochloric acid standard solution, in mol / L; m is the sample mass, in g; 14 is the molecular mass of nitrogen; and 6.25 is the coefficient for converting nitrogen into protein.

[0043] 4. Detection of fat content: The fat content is detected by Soxhlet extraction method. The specific steps are as follows: Weigh 5g of fermentation liquid and place it in an evaporating dish, add 20g of quartz sand, evaporate it to dryness in a boiling water bath, and dry it in an electric blast drying oven at 100°C for 30 minutes, then take it out, grind it into powder, and transfer it all into a filter paper tube. Place the filter paper tube into the extraction cylinder of the Soxhlet extractor, connect it to the receiving bottle that has been dried to constant weight, add anhydrous ether or petroleum ether from the upper end of the extractor condenser to two-thirds of the bottle volume, heat it in a water bath, and extract it with anhydrous ether or petroleum ether for 8 hours. Remove the receiving bottle, evaporate it to dryness in a water bath when there is 1mL of solvent left in the receiving bottle, and then dry it at 100°C for 1 hour. Cool it in a dryer for 0.5 hours and weigh it. Repeat the above steps until constant weight. Calculate the dry weight percentage of fat according to the formula:

[0044]

[0045] Wherein, X is the percentage of dry fat, in %; M1 is the mass of the receiving bottle and fat after constant weight, in g; M0 is the mass of the receiving bottle, in g; M2 is the mass of the fermentation liquid, in g; 100 is the conversion factor.

[0046] Data processing: The data were analyzed using SPSS Statistics 17.0 software by one-way analysis of variance and Tukey's HSD test (p < 0.05), and the graphics were drawn by Origin 2018 software.

[0047] 4. Experimental results.

[0048] Compared with the control group, KT +IV and KT +lasBT The bacterial growth increased by 95.22% and 301.41%, and crab shell fermentation increased KT +IV and KT +lasBT The amount of bacterial growth, such as Figure 2 As shown. Figure 3 and Figure 4 As shown in the results of substrate detection, the protein dry weight percentage and fat dry weight percentage of the experimental group were significantly reduced compared with the control group. The protein dry weight percentage of the control group was 22.04%, and the KT +lasBT The percentage of histone dry weight was 15.12%, KT +IV The percentage of histone dry weight was 13.14%; the percentage of fat dry weight in the control group was 5.12%, KT +lasBT The dry fat percentage of the group was 1.13%, KT +IV The dry weight percentage of fat in the group was 1.14%.

[0049] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0050] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0051] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A recombinant bacterium for degrading crab shells, characterized in that: The recombinant bacterium is Pseudomonas putida KT2440 carrying an exogenous protease gene, wherein the exogenous protease gene is an IV gene with a sequence as shown in SEQ ID NO.5 or a lasBT gene with a sequence as shown in SEQ ID NO.

6.

2. The method for constructing the recombinant bacteria according to claim 1, characterized in that: include: The recombinant overexpression plasmid carrying the exogenous protease gene is transferred into the Pseudomonas putida KT2440, and the recombinant bacteria are obtained through positive clone screening.

3. The method for constructing a recombinant bacterium according to claim 2, characterized in that: The recombinant overexpression plasmid carrying the exogenous protease gene is obtained by inserting the exogenous protease gene between the BamH I and Sac I sites of the pUCP18 plasmid.

4. Use of the recombinant bacteria according to claim 1 in fermentation degradation of crab shells.

5. A method for degrading crab shells, characterized in that: include: A crab shell culture medium is prepared using crab shells as raw materials, and the bacterial solution of the recombinant bacteria according to claim 1 is inoculated, and the crab shells are degraded through fermentation.

6. The method according to claim 5, characterized in that The crab shell culture medium is obtained by adding 1 to 10 g of crab shell fragments into 90 to 99 mL of LB liquid culture medium.

7. The method according to claim 5, characterized in that The inoculation amount of the bacterial liquid is 0.5% to 1.5% of the volume of the crab shell culture medium.

8. The method according to claim 5, characterized in that The fermentation conditions are: temperature 28-32° C., fermentation time 40-45 h, and rotation speed 150-250 rpm / min.

9. Use of the recombinant bacteria according to claim 1 in preparing products for degrading crab shells.

10. The use of the recombinant bacteria according to claim 9 in preparing a product for degrading crab shells, characterized in that: The degrading of crab shells includes degrading protein and fat in the crab shells.

Images