siRNA Compositions and Derivatives and Their Applications
By specifically modifying siRNA compositions and derivatives of the FBXL6 gene, the problem of limited efficacy of existing liver cancer treatment drugs is solved, significantly inhibiting tumor cell proliferation and liver cancer growth, and providing new and effective treatment methods.
Patent Information
- Application Number
- CN202510171979.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-17
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2045-02-17
AI Technical Summary
Existing hepatocellular carcinoma (HCC) therapeutic drugs such as sorafenib, lenvatinib or anti-pd-1/PD-L1 antibodies have limited efficacy and lack of clinically approved siRNA nucleic acid preparations, which cannot effectively inhibit the proliferation of tumor cells with high expression of the FBXL6 gene.
A siRNA composition and its derivatives of specific sequences are designed and synthesized, and the siRNA composition and terminal GalNAc modification are modified through 2’-OMe, 2’-F modification and both end thio modification and terminal GalNAc modification to form a conjugate, enhancing its stability and targeting, and is used to inhibit the expression of the FBXL6 gene.
It significantly inhibits tumor cell proliferation and liver cancer growth, improves the stability and cell targeting of siRNA, provides new treatment methods for liver cancer, and has good safety and effectiveness.
Smart Images

Figure CN120005885B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of nucleic acid drugs, and relates to siRNA compositions and derivatives and their applications. Background Art
[0002] Nucleic acid therapy is a treatment method with great potential. By introducing a nucleic acid sequence, it can up-regulate, down-regulate or correct the target gene, thereby achieving more precise treatment of diseases. siRNA is a class of artificially synthesized double-stranded RNAs, consisting of a sense strand and an antisense strand, usually 21 nt in length. The antisense strand degrades mRNA by completely complementary pairing with mRNA, thereby exerting its post-transcriptional regulatory function.
[0003] FBXL6 (F box and leucine rich repeat protein 6), also known as FBL6 protein, FBL6A protein, FLJ22888, and PP14630, is located on chromosome 8q24.3 and is a member of the FBXL subfamily of E3 ubiquitin ligase F-box proteins. The cDNA of the FBXL6 gene spans more than 1700 bp and encodes 539 amino acids. Previous patents have found that the FBXL6 gene is highly expressed in tumor cells. Based on the expression difference between normal cells and tumor cells, it was first discovered that FBXL6 can be used as a new anti-tumor drug target and has potential clinical application value in tumor treatment (Patent No.: ZL 2019 11266126.2).
[0004] Hepatocellular carcinoma (HCC) is the third leading cause of cancer-related death globally, with approximately 600,000 deaths each year. The most common causes are hepatitis B virus (HBV) and hepatitis C virus (HCV) infections, alcoholism, or long-term high-fat intake. Currently, surgical resection is still the main treatment option for HCC patients, but it is only limited to early HCC patients. Unfortunately, most liver cancer patients are diagnosed at an advanced stage. The efficacy of existing drug treatment regimens, such as sorafenib, lenvatinib, or anti-pd-1 / PD-L1 antibodies, is limited. Therefore, based on the current limitations, there is an urgent need to try different treatment methods. Currently, there is no clinically approved siRNA nucleic acid preparation for the treatment of liver cancer. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide an siRNA preparation for the FBXL6 gene. Through a series of in vitro experiments, it was found that the siRNA agent for the FBXL6 gene plays a key role in inhibiting the proliferation of tumor cells; through in vivo experiments in mice, it was found that the modified siRNA agent for the FBXL6 gene can significantly inhibit the formation of tumors in mice.
[0006] To achieve the above object, the present invention provides the following technical solutions:
[0007] The present invention provides a siRNA composition, which consists of at least one of the following 8 siRNA compounds:
[0008] #1 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 1
[0009] The antisense strand nucleic acid sequence is as shown in SEQ ID NO: 2
[0010] #2 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 3
[0011] The antisense strand nucleic acid sequence is as shown in SEQ ID NO: 4
[0012] #3 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 5 and the antisense strand nucleic acid sequence is as shown in SEQ ID NO: 6
[0013] #4 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 7 and the antisense strand nucleic acid sequence is as shown in SEQ ID NO: 8
[0014] #5 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 9 and the antisense strand nucleic acid sequence is as shown in SEQ ID NO: 10
[0015] #6 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 11 and the antisense strand nucleic acid sequence is as shown in SEQ ID NO: 12
[0016] #7 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 13 and the antisense strand nucleic acid sequence is as shown in SEQ ID NO: 14
[0017] #8 The sense strand nucleic acid sequence is as shown in SEQ ID NO: 15 and the antisense strand nucleic acid sequence is as shown in SEQ ID NO: 16
[0018] Furthermore, the present invention provides a derivative of the siRNA composition, which consists of at least one of the following 16 siRNA derivatives:
[0019] #1-1
[0020] Sense strand: Cm Af Cm Cf Gm Gf Cm Af Um Cf Am Af Cm Cf Gm Uf Am Af Um Af Gm
[0021] Antisense strand: Cf Um Af Um Uf Am Cf Gm Gf Um Uf Gm Af Um Gf Cm Cf Gm Gf Um Gf
[0022] #1-2
[0023] Sense strand Cf Cm Gf Gm Cf Am Uf Cf Af Am Cf Cm Gf Um Af Am Uf Am Gf
[0024] Antisense strand Cm Uf Am Uf Um Af Cm Gf Gm Uf Um Gm Am Uf Gm Cf Cm Gf Gm Um Gm
[0025] #2-1
[0026] Sense strand Um Gf Gm Af Gm Uf Gm Gf Cm Uf Um Af Um Gf Cm Cf Cm Af Am
[0027] Antisense strand Uf Um Gf Gm Gf Cm Af Um Af Am Gf Cm Cf Am Cf Um Cf Cm Af
[0028] #2-2
[0029] Sense strand Uf Gm Gf Am Gf Um Gf Gm Cf Uf Uf Am Uf Gm Cf Cm Cf Am Af
[0030] Antisense strand Um Uf Gm Gf Gm Cf Am Uf Am Af Gm Cm Cm Af Cm Uf Cm Cf Am Gm Gm
[0031] #3-1
[0032] Sense strand Um Gf Gm Af Am Af Um Cf Cm Uf Gm Gf Um Gf Cm Af Gm Af Um
[0033] Antisense strand Af Um Cf Um Gf Cm Af Cm Cf Am Gf Gm Af Um Uf Um Cf Cm Af
[0034] #3-2
[0035] Sense strand Uf Gm Gf Am Af Am Uf Cm Cf Uf Gf Gm Uf Gm Cf Am Gf Am Uf
[0036] Antisense strand: Am Uf Cm Uf Gm Cf Am Cf Cm Af Gm Gm Am Uf Um Uf Cm Cf Am Am Gm
[0037] #4-1
[0038] Sense strand: Gm Cf Um Uf Am Uf Gm Cf Cm Cf Am Af Um Cf Gm Gf Um Uf Um
[0039] Antisense strand: Af Am Af Cm Cf Gm Af Um Uf Gm Gf Gm Cf Am Uf Am Af Gm Cf
[0040] #4-2
[0041] Sense strand: Gf Cm Uf Um Af Um Gf Cm Cf Cf Af Am Uf Cm Gf Gm Uf Um Uf
[0042] Antisense strand: Am Af Am Cf Cm Gf Am Uf Um Gf Gm Cm Cm Af Um Af Am Gf Cm Cm Am
[0043] #5-1
[0044] Sense strand: Gm Uf Gm Af Gm Af Am Gf Gm Af Cm Cf Um Gf Gm Af Gm Cf Am
[0045] Antisense strand: Uf Gm Cf Um Cf Cm Af Gm Gf Um Cf Cm Uf Um Cf Um Cf Am Cf
[0046] #5-2
[0047] Sense strand: Gf Um Gf Am Gf Am Af Gm Gf Af Cf Cm Uf Gm Gf Am Gf Cm Af
[0048] Antisense strand: Um Gf Cm Uf Cm Cf Am Gf Gm Uf Cm Cm Um Uf Cm Uf Cm Af Cm Um Gm
[0049] #6-1
[0050] Sense strand: Um Gf Um Cf Gm Af Gm Gf Cm Uf Cm Uf Gm Cf Am Gf Am Af Am
[0051] Antisense strand: Uf Um Uf Cm Uf Gm Cf Am Gf Am Gf Cm Cf Um Cf Gm Af Cm Af
[0052] #6-2
[0053] Sense strand: Uf Gm Uf Cm Gf Am Gf Gm Cf Uf Cf Um Gf Cm Af Gm Af Am Af
[0054] Antisense strand: Um Uf Um Cf Um Gf Cm Af Gm Af Gm Cm Cm Uf Cm Gf Am Cf Am Gm Gm
[0055] #7-1
[0056] Sense strand: Cm Gf Gm Cf Um Gf Gm Cf Cm Uf Um Cf Am Gf Gm Af Um Cf Um
[0057] Antisense strand: Af Gm Af Um Cf Cm Uf Gm Af Am Gf Gm Cf Cm Af Gm Cf Cm Gf
[0058] #7-2
[0059] Sense strand: Cf Gm Gf Cm Uf Gm Gf Cm Cf Uf Uf Cm Af Gm Gf Am Uf Cm Uf
[0060] Antisense strand: Am Gf Am Uf Cm Cf Um Gf Am Af Gm Gm Cm Cf Am Gf Cm Cf Gm Gm Cm
[0061] #8-1
[0062] Sense strand: Um Gf Gm Uf Gm Af Gm Cf Um Uf Cm Uf Um Gf Gm Af Gm Gf Am
[0063] Antisense strand: Uf Cm Cf Um Cf Cm Af Am Gf Am Af Gm Cf Um Cf Am Cf Cm Af
[0064] #8-2
[0065] Sense strand: Uf Gm Gf Um Gf Am Gf Cm Uf Uf Cf Um Uf Gm Gf Am Gf Gm Af
[0066] Antisense strand: Um Cf Cm Uf Cm Cf Am Af Gm Af Am Gm Cm Uf Cm Af Cm Cf Am Cm Um. Here, m represents 2'-OMe modification, f represents 2'-F modification, with phosphorothioate modifications at both ends and a terminal GalNAc modification. GalNAc is covalently conjugated to the 3' end of the sense strand of siRNA in a trivalent state to form a conjugate. The chemical formula of GalNAc is as follows:
[0067]
[0068] Furthermore, the application of the siRNA composition in the preparation of a drug for inhibiting the expression of the FBXL6 gene;
[0069] Furthermore, the application of the siRNA derivative in the preparation of a drug for inhibiting the expression of the FBXL6 gene;
[0070] The FBXL6 gene is the tumor FBXL6 gene.
[0071] The beneficial effects of the present invention are as follows:
[0072] The siRNA composition and its derivatives for the FBXL6 gene provided by the present invention, in view of the limited efficacy of existing liver cancer treatment drugs, exhibit remarkable tumor growth inhibitory ability. It is confirmed by in vitro cell experiments that the siRNA composition and derivatives of the present invention can effectively inhibit the expression of the liver cancer FBXL6 gene, and thus significantly inhibit the proliferation of tumor cells. In in vivo experiments on mice, the siRNA preparation also performs excellently, can significantly inhibit the growth of liver cancer in mice, and has no obvious effect on the body weight of mice, indicating its good safety and effectiveness. In addition, through specific chemical modifications (such as 2'-OMe, 2'-F modifications, phosphorothioate modifications at both ends and terminal GalNAc modification), the present invention significantly improves the stability and cell targeting of siRNA, further enhancing its therapeutic effect. Therefore, the siRNA composition and derivatives of the present invention provide a new effective means for liver cancer treatment, with important clinical application value and broad market prospects.
[0073] Other advantages, objectives and features of the present invention will be described in part in the subsequent specification, and to some extent, will be obvious to those skilled in the art based on the study of the following text, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be achieved and obtained through the following specification. BRIEF DESCRIPTION OF THE DRAWINGS
[0074] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be described in detail preferably with reference to the accompanying drawings, where:
[0075] Figure 1 Verify the interference efficiency of 8 unmodified siRNAs of FBXL6 for different tumor cells;
[0076] Figure 2 The unmodified siRNA of the FBXL6 gene significantly inhibits the proliferation of tumor cells;
[0077] Figure 3 The double-stranded siRNA preparation of the FBXL6 gene significantly inhibits the growth of mouse liver cancer;
[0078] Figure 4 A shows that the modified siRNA preparation of the FBXL6 gene significantly inhibits the growth of mouse liver cancer compared with the unmodified siRNA preparation, Figure 4 B shows the effect on the volume of liver cancer tumors after treatment with modified and unmodified siRNAs, Figure 4 C shows the effect on the liver weight ratio of mice after treatment with modified and unmodified siRNAs. Specific embodiments
[0079] The following specific examples illustrate the embodiments of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the drawings provided in the following examples only illustrate the basic concept of the present invention schematically. Without conflict, the following examples and the features in the examples can be combined with each other.
[0080] Among them, the drawings are only for illustrative purposes, showing only schematic diagrams, not physical diagrams, and should not be construed as limiting the present invention; in order to better illustrate the embodiments of the present invention, some components in the drawings will be omitted, enlarged or reduced, and do not represent the dimensions of actual products; for those skilled in the art, it is understandable that some well-known structures and their descriptions in the drawings may be omitted.
[0081] In the accompanying drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components; in the description of the present invention, it should be understood that if there are terms such as "upper", "lower", "left", "right", "front", "rear", etc. indicating the orientation or positional relationship, they are based on the orientation or positional relationship shown in the accompanying drawings. This is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation. Therefore, the terms describing the positional relationship in the accompanying drawings are only for illustrative purposes and cannot be construed as a limitation of the present invention. For those of ordinary skill in the art, the specific meanings of the above terms can be understood according to specific circumstances.
[0082] I. Materials and Reagents Used in the Embodiment
[0083] Table 1 Sources of Cell and Reagent Information
[0084]
[0085]
[0086] II. The main instrument and equipment information used in the embodiment is shown in Table 2
[0087] Table 2 Main Instrument and Equipment Information
[0088] Instrument Name Manufacturer Biological Safety Cabinet Thermo Fisher Scientific Carbon Dioxide Incubator Thermo Fisher Scientific Inverted Phase Contrast Microscope Olympus Corporation Low-Speed Centrifuge Xiangyi Low-Temperature Freezing High-Speed Centrifuge Thermo Fisher Scientific Microplate Reader Thermo Fisher Scientific Electrophoresis System Bio-Rad Gel Imaging System Bio-Rad
[0089] Example 1
[0090] Preparation of Unmodified and Modified siRNAs of FBXL6
[0091] (1) The siRNA sequence targeting human FBXL6 mRNA without modification was designed by the online website siDESIGN Center according to the FBXL6 mRNA CDS sequence of NCBI.
[0092] Website: https: / / horizondiscovery.com / en / ordering-and-calculation-tools / sidesign-center
[0093] (2) The unmodified sequence and the siRNAs of FBXL6 mRNA with 2'-OMe modification, 2'-F modification, phosphorothioate modification at both ends, and terminal GalNAc modification were designed and synthesized by GenePharma (Shanghai) Co., Ltd., and the company issued a synthesis report. The unmodified siRNA sequences of the FBXL6 gene are:
[0094] #1 Sense Strand CACCGGCAUCAACCGUAAUAG (SEQ ID NO:1)
[0095] Antisense Strand CUAUUACGGUUGAUGCCGGUG (SEQ ID NO:2)
[0096] #2 sense strand UGGAGUGGCUUAUGCCCAAUC (SEQ ID NO:3)
[0097] antisense strand GAUUGGGCAUAAGCCACUCCA (SEQ ID NO:4)
[0098] #3 sense strand UGGAAAUCCUGGUGCAGAU (SEQ ID NO:5)
[0099] antisense strand AUCUGCACCAGGAUUUCCA (SEQ ID NO:6)
[0100] #4 sense strand GCUUAUGCCCAAUCGGUUU (SEQ ID NO:7)
[0101] antisense strand AAACCGAUUGGGCAUAAGC (SEQ ID NO:8)
[0102] #5 sense strand GUGAGAAGGACCUGGAGCA (SEQ ID NO:9)
[0103] antisense strand UGCUCCAGGUCCUUCUCAC (SEQ ID NO:10)
[0104] #6 sense strand UGUCGAGGCUCUGCAGAAA (SEQ ID NO:11)
[0105] antisense strand UUUCUGCAGAGCCUCGACA (SEQ ID NO:12)
[0106] #7 sense strand CGGCUGGCCUUCAGGAUCU (SEQ ID NO:13)
[0107] antisense strand AGAUCCUGAAGGCCAGCCG (SEQ ID NO:14)
[0108] #8 sense strand UGGUGAGCUUCUUGGAGGA (SEQ ID NO:15)
[0109] antisense strand UCCUCCAAGAAGCUCACCA (SEQ ID NO:16)
[0110] The siRNA modified sequences of the FBXL6 gene are (5'-3'):
[0111] #1-1
[0112] Sense strand Cm Af Cm Cf Gm Gf Cm Af Um Cf Am Af Cm Cf Gm Uf Am Af Um Af Gm
[0113] Antisense strand Cf Um Af Um Uf Am Cf Gm Gf Um Uf Gm Af Um Gf Cm Cf Gm Gf Um Gf
[0114] #1-2
[0115] Sense strand Cf Cm Gf Gm Cf Am Uf Cf Af Am Cf Cm Gf Um Af Am Uf Am Gf
[0116] Antisense strand Cm Uf Am Uf Um Af Cm Gf Gm Uf Um Gm Am Uf Gm Cf Cm Gf Gm Um Gm
[0117] #2-1
[0118] Sense strand Um Gf Gm Af Gm Uf Gm Gf Cm Uf Um Af Um Gf Cm Cf Cm Af Am
[0119] Antisense strand Uf Um Gf Gm Gf Cm Af Um Af Am Gf Cm Cf Am Cf Um Cf Cm Af
[0120] #2-2
[0121] Sense strand Uf Gm Gf Am Gf Um Gf Gm Cf Uf Uf Am Uf Gm Cf Cm Cf Am Af
[0122] Antisense strand Um Uf Gm Gf Gm Cf Am Uf Am Af Gm Cm Cm Af Cm Uf Cm Cf Am Gm Gm
[0123] #3-1
[0124] Sense strand Um Gf Gm Af Am Af Um Cf Cm Uf Gm Gf Um Gf Cm Af Gm Af Um
[0125] Antisense strand Af Um Cf Um Gf Cm Af Cm Cf Am Gf Gm Af Um Uf Um Cf Cm Af
[0126] #3-2
[0127] Sense strand Uf Gm Gf Am Af Am Uf Cm Cf Uf Gf Gm Uf Gm Cf Am Gf Am Uf
[0128] Antisense strand Am Uf Cm Uf Gm Cf Am Cf Cm Af Gm Gm Am Uf Um Uf Cm Cf Am Am Gm
[0129] #4-1
[0130] Sense strand Gm Cf Um Uf Am Uf Gm Cf Cm Cf Am Af Um Cf Gm Gf Um Uf Um
[0131] Antisense strand Af Am Af Cm Cf Gm Af Um Uf Gm Gf Gm Cf Am Uf Am Af Gm Cf
[0132] #4-2
[0133] Sense strand Gf Cm Uf Um Af Um Gf Cm Cf Cf Af Am Uf Cm Gf Gm Uf Um Uf
[0134] Antisense strand Am Af Am Cf Cm Gf Am Uf Um Gf Gm Cm Cm Af Um Af Am Gf Cm Cm Am
[0135] #5-1
[0136] Sense strand Gm Uf Gm Af Gm Af Am Gf Gm Af Cm Cf Um Gf Gm Af Gm Cf Am
[0137] Antisense strand Uf Gm Cf Um Cf Cm Af Gm Gf Um Cf Cm Uf Um Cf Um Cf Am Cf
[0138] #5-2
[0139] Sense strand Gf Um Gf Am Gf Am Af Gm Gf Af Cf Cm Uf Gm Gf Am Gf Cm Af
[0140] Antisense strand Um Gf Cm Uf Cm Cf Am Gf Gm Uf Cm Cm Um Uf Cm Uf Cm Af Cm Um Gm
[0141] #6-1
[0142] Sense strand: Um Gf Um Cf Gm Af Gm Gf Cm Uf Cm Uf Gm Cf Am Gf Am Af Am
[0143] Antisense strand: Uf Um Uf Cm Uf Gm Cf Am Gf Am Gf Cm Cf Um Cf Gm Af Cm Af
[0144] #6-2
[0145] Sense strand: Uf Gm Uf Cm Gf Am Gf Gm Cf Uf Cf Um Gf Cm Af Gm Af Am Af
[0146] Antisense strand: Um Uf Um Cf Um Gf Cm Af Gm Af Gm Cm Cm Uf Cm Gf Am Cf Am Gm Gm
[0147] #7-1
[0148] Sense strand: Cm Gf Gm Cf Um Gf Gm Cf Cm Uf Um Cf Am Gf Gm Af Um Cf Um
[0149] Antisense strand: Af Gm Af Um Cf Cm Uf Gm Af Am Gf Gm Cf Cm Af Gm Cf Cm Gf
[0150] #7-2
[0151] Sense strand: Cf Gm Gf Cm Uf Gm Gf Cm Cf Uf Uf Cm Af Gm Gf Am Uf Cm Uf
[0152] Antisense strand: Am Gf Am Uf Cm Cf Um Gf Am Af Gm Gm Cm Cf Am Gf Cm Cf Gm Gm Cm
[0153] #8-1
[0154] Sense strand: Um Gf Gm Uf Gm Af Gm Cf Um Uf Cm Uf Um Gf Gm Af Gm Gf Am
[0155] Antisense strand: Uf Cm Cf Um Cf Cm Af Am Gf Am Af Gm Cf Um Cf Am Cf Cm Af
[0156] #8-2
[0157] Justice Chain Uf Gm Gf Um Gf Am Gf Cm Uf Uf Cf Um Uf Gm Gf Am Gf Gm Af
[0158] Antisense strand Um Cf Cm Uf Cm Cf Am Af Gm Af Am Gm Cm Uf Cm Af Cm Cf Am Cm Um Note: m represents 2'-OMe modification
[0159] f represents 2'-F modification
[0160] Two-terminal thiolation
[0161] Terminal GalNAc modification: GalNAc is covalently conjugated to the 3′ end of the sense strand of siRNA in a trivalent state to form a conjugate, thereby achieving specific delivery to hepatocytes.
[0162] The chemical formula of GalNAc is as follows
[0163]
[0164] Example 2
[0165] method
[0166] 2.1 Tumor cell plating
[0167] (1) When the cell density reaches 80-90%, the cells are plated. Before plating, the cell morphology and density need to be observed under a microscope.
[0168] (2) For adherent tumor cells, aspirate the original culture medium in the culture dish, slowly add sterile PBS along the wall and shake twice, then discard the PBS.
[0169] (3) Add an appropriate amount of 0.25% trypsin according to the size of the culture dish. Observe under a microscope to see if the cells shrink and become rounded, and digestion is complete. (4) Repeatedly pipette the digested cells to detach the cells and disperse them to prepare a cell suspension. Then, transfer the suspension to a 15 mL centrifuge tube. Centrifuge at 1200 rpm for 3 minutes.
[0170] (5) Discard the supernatant and add appropriate amount of culture medium to prepare a single cell suspension for cell counting.
[0171] (6) Calculate the amount of diluted cell suspension based on the plating density and fill the remaining volume with culture medium. 96-well plates were inoculated with 3000 tumor cells per well and 90 μL of culture medium; 6-well plates were inoculated with 2x10 5Individual / Well Tumor Cells, Culture Medium Volume 1.5 mL.
[0172] 2.2 Transfection of Tumor Cells
[0173] (1) Seed the plates in advance according to the cell growth rate and culture using medium without antibiotics, so that the cells are in logarithmic growth and reach about 70 - 80% confluence at the time of transfection.
[0174] (2) Prepare the DNA dilution: Add 250 μl / well of Opti-MEM to an EP tube respectively, and then add 6 - 8 μl / well of siRNA and mix gently (6-well); 5 μl / well of Opti-MEM, and then add 0.5 μl / well of siRNA and mix gently (96-well).
[0175] (3) Prepare the Lip2000 dilution: Take a suitable EP tube and add 250 μl / well of Opti-MEM, add 3 - 4 μl / well of Lip2000 and mix (6-well); 5 μl / well of Opti-MEM, add 0.2 μl / well of Lip2000 and mix (96-well);
[0176] (4) Add the DNA dilution to the Lip2000 dilution, mix gently, and let it stand at room temperature for 10 - 15 min to form the DNA-Lip2000 complex.
[0177] (5) Add the prepared DNA-Lip2000 complex to the cell culture medium respectively, gently shake the culture plate to make the complex evenly distributed. Place it in a 37°C, 5% CO2 incubator and culture for 72 h, and replace the complete medium after 4 - 6 h.
[0178] 2.3 Cell Proliferation Experiment
[0179] (1) Use an inverted microscope to detect the cell growth status, and add 10 μL of CCK-8 solution to each well.
[0180] (2) Culture in a 37°C, 5% CO2 incubator for 1 - 2 h.
[0181] (3) Measure the absorbance at 450 nm using an enzyme-labeled instrument.
[0182] (4) Process and analyze the results using Excel and Graphpad Prism.
[0183] 2.4 Protein Immunoblotting (Western Blot) Experiment
[0184] (1) Preparation of Protein Samples
[0185] A. Aspirate the liquid in the 6-well plate, wash it twice with PBS by shaking, and discard the PBS. Thereafter, all operations are carried out on an ice bath.
[0186] B. Add 80 - 100 μL of RIPA lysis buffer to each well of cells, spread the lysis buffer evenly, and lyse the cells in an ice bath for 10 min.
[0187] C. Use a cell scraper to scrape off the cells, transfer the lysis buffer to a 1.5 mL centrifuge tube, and pipette repeatedly to fully break the cells. Continue to lyse the cells in an ice bath for 5 - 10 min. Try to avoid introducing air bubbles repeatedly during the pipetting process.
[0188] D. Centrifuge at 12000 rpm at 4 °C for 15 min, and take the supernatant.
[0189] E. Measure the protein quantification of the supernatant according to the steps of the BCA kit from Beyotime.
[0190] F. According to the BCA results, uniformly quantify all samples. If the volume is insufficient, supplement with lysis buffer. Add 1 / 4 volume of 5x protein loading buffer, mix well, and incubate in a metal bath at 100 °C for 10 min. Store at -20 °C for later use.
[0191] (2) Electrophoresis
[0192] A. Prepare a 10% SDS-PAGE gel according to the instructions of the SDS-PAGE gel kit from Beyotime.
[0193] B. Prepare the electrophoresis buffer: 3 g of Trizma base + 14.4 g of Glycine + 1 g of SDS + 1 L of water.
[0194] C. Protein loading: Fix the prepared SDS-PAGE gel in the electrophoresis tank, fill it with electrophoresis buffer, pull out the comb, and add approximately 25 - 50 μL of protein sample and 2 μL of prestained protein marker to the sample wells.
[0195] D. Electrophoresis: 80 V for 30 min in the stacking gel; 110 V for 1 h in the separating gel.
[0196] (3) Membrane transfer and development
[0197] A. Prepare the membrane transfer buffer: 3 g of Trizma base + 14.4 g of Glycine + 200 mL of methanol + 800 mL of water.
[0198] B. After SDS-PAGE electrophoresis, pry open the glass plates of the gel slab, cut off the separating gel, and transfer the gel into the membrane transfer buffer. Cut a 0.45 μm NC membrane of the same size as the separating gel. Place the sponge pads, filter papers, gel, membrane, filter papers, and sponge pads (from bottom to top) on the membrane transfer device from the negative electrode (black bottom) to the positive electrode. Make sure to remove air bubbles during placement, especially between the membrane and filter paper, gel and membrane, and filter paper and gel.
[0199] C. Transfer the membrane at a constant voltage of 80 V for 2 h.
[0200] D. Blocking: Remove the NC membrane from the transfer system and add it to 5% milk in TBST for blocking at room temperature for 1 h.
[0201] E. Primary antibody incubation: Cut the NC membrane according to the target molecular weight, and add it to the primary antibody diluted with 5% BSA in TBST for incubation overnight at 4°C.
[0202] F. Secondary antibody incubation: Recover the primary antibody and wash with TBST 3 times, 10 min each time. Select the appropriate secondary antibody according to the species origin of the primary antibody and incubate at room temperature for 1 h.
[0203] G. Development: Recover the secondary antibody and wash with TBST 3 times, 10 min each time. Develop and take pictures with a Bio-Rad gel imaging system.
[0204] 2.5 Subcutaneous xenograft tumor experiment in nude mice
[0205] (1) Take cells in the logarithmic growth phase, and the cell density is preferably about 80-90%. Replace the fresh medium the night before collecting the cells.
[0206] (2) After digesting the cells with trypsin, wash them twice with pre-cooled PBS to remove the residual serum in the cells.
[0207] (3) Pipette the cell pellet with PBS to an appropriate concentration. Generally, the cell amount for subcutaneous tumor inoculation is 5×10 6 cells / mouse, the inoculation volume is 0.1-0.2 ml, and the ratio of Matrigel to PBS is 1:1.
[0208] (4) After anesthetizing the nude mice, inject the tumor cells subcutaneously on the outer side of the middle of the left axilla.
[0209] (5) After the nude mice wake up, put them back into the cage and observe once every 2 days, measuring the body weight and the length and width of the tumor.
[0210] (6) When the tumor volume reaches 100 cm 3 ³, inject each mouse with a double-stranded siRNA preparation of the FBXL6 gene at a concentration of 1 nmol, twice a week (diluted with physiological saline), and collect specimens 22 days after inoculation.
[0211] 3. Biological research examples
[0212] 3.1 FBXL6 gene unmodified siRNA significantly inhibits human FBXL6 gene expression and can significantly inhibit the proliferation of different tumor cells
[0213] 3.1.1 Interfere with FBXL6 in different tumor cells and detect the interference efficiency of 8 unmodified siRNAs
[0214] Using the human hepatocellular carcinoma cell line Huh7, the colorectal cancer cell line HCT116, the breast cancer cell line MCF7, and the pancreatic cancer cell line PANC-1, different FBXL6 siRNAs were transfected, and the efficiency of FBXL6 gene knockdown was detected by WB method. The experimental results are as Figure 1 shown in A - D. All 8 unmodified FBXL6 siRNAs can significantly inhibit the expression of the FBXL6 gene.
[0215] 3.1.2 Unmodified siRNAs of the FBXL6 gene significantly inhibit the proliferation of tumor cells
[0216] Due to the uncontrolled cell cycle of tumor cells, they are like microorganisms parasitizing inside cells, not controlled by the normal growth regulation system, and can continuously divide and proliferate. Due to their continuous proliferation, the disease will progress rapidly. In order to explore the effect of interfering with the FBXL6 gene on the proliferation of tumor cells in this invention, the human hepatocellular carcinoma cell line Huh7, the colorectal cancer cell line HCT116, the breast cancer cell line MCF7, and the pancreatic cancer cell line PANC-1 were used, and FBXL6 siRNA (purchased from Shanghai GenePharma Co., Ltd.) was transfected. The effect of unmodified FBXL6 siRNAs on the proliferation of tumor cells was detected by the CCK8 method. The research results are as Figure 2 shown in A - D. Unmodified FBXL6 siRNAs can significantly inhibit the proliferation of tumor cells, indicating that inhibiting FBXL6 expression will significantly slow down the progression of the disease.
[0217] 3.2 Double-stranded siRNA preparation of the FBXL6 gene significantly inhibits the generation of liver cancer in mice
[0218] 3.2.1 At the animal level, the double-stranded siRNA preparation of the FBXL6 gene significantly inhibits the generation of liver cancer in mice
[0219] In order to explore the effect of the double-stranded siRNA preparation of the FBXL6 gene on the tumor proliferation of liver cancer mice in this invention, a subcutaneous liver cancer model of mice with stable high expression of the FBXL6 gene was constructed. The construction method is as follows: Male nude mice at 4 - 6 weeks old were taken, and a suspension of Huh7 cells with stable high expression of the FBXL6 gene was subcutaneously inoculated at the left axilla of each nude mouse, and the inoculation volume was 100 μL. Generally, tumors can be seen after 7 - 10 days. The tumor size was measured every 2 - days, and the longest and shortest parts of the tumor were measured with a vernier caliper, and the volume V = 1 / 2 * a * b2 (a is the long axis and b is the short axis) was calculated. Two weeks later, a double-stranded siRNA preparation of the FBXL6 gene was injected into the tumor of each mouse at a concentration of 1 nmol, twice a week (diluted with normal saline), and specimens were collected 22 days after inoculation. The research results show that the double-stranded siRNA preparation of the FBXL6 gene has no significant effect on the body weight of mice (as 6 shown in Figure 3A), but can significantly inhibit the proliferation of mouse liver cancer cells (such as Figure 3 B-D).
[0220] 3.2.2 At the animal level, the double-stranded modified siRNA preparation of the FBXL6 gene can significantly inhibit the generation of liver cancer in mice compared with the unmodified siRNA
[0221] This invention aims to explore the effects of unmodified siRNA and double-stranded siRNA preparations of the FBXL6 gene on tumor proliferation in liver cancer mice, and to construct a stable orthotopic xenograft liver cancer model of mice with high expression of the FBXL6 gene. The construction method is as follows: Take male nude mice at 4-6 weeks old, and subcutaneously inoculate 5*10 6 Huh7 cell suspension with stable high expression of the FBXL6 gene, and the inoculation volume is 100 μL. When the subcutaneous tumor is in the logarithmic growth phase, cut the subcutaneous tumor into small pieces (1 mm 3 ). After anesthetizing the mice, cut the rectus abdominis muscle, open the upper peritoneum, expose the liver tissue, and inoculate it into the left liver lobe of male nude mice. One week after tumor implantation, start the treatment with unmodified siRNA and double-stranded modified siRNA preparations of the FBXL6 gene, and intraperitoneally inject the siRNA preparation (0.5 mg / kg, diluted with normal saline) twice a week. Four weeks after inoculation, inject an overdose of pentobarbital sodium to cause death, open the abdomen to collect liver tissue and take pictures. The research results show that compared with the unmodified siRNA of the FBXL6 gene, the double-stranded modified siRNA preparation of the FBXL6 gene can more significantly inhibit the generation of liver cancer in mice (such as Figure 4 ).
[0222] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the present technical solution, and they should all be covered by the scope of the claims of the present invention.
Claims
1. An siRNA composition, characterized in that: The composition is composed of any one of the following two groups of siRNAs: #5: The positive strand nucleic acid sequence is shown in SEQ ID NO: 9, The antisense strand nucleic acid sequence is shown in SEQ ID NO: 10; #7: The positive strand nucleic acid sequence is shown in SEQ ID NO: 13, The antisense strand nucleic acid sequence is shown in SEQ ID NO:
14.
2. The derivative of the siRNA composition according to claim 1, characterized in that: Derivatives #5-1 and #5-2 were modified by #5 siRNA, and derivatives #7-1 and #7-2 were modified by #7 siRNA. The sequences of the derivatives are shown below: #5-1: The positive chain sequence is Gm Uf Gm Af Gm Af Am Gf Gm Af Cm Cf Um Gf Gm Af Gm Cf Am, The sequence of the antisense strand is Uf Gm Cf Um Cf Cm Af Gm Gf Um Cf Cm Uf Um Cf Um Cf Am Cf; #5-2: The sequence of the positive chain is Gf Um Gf Am Gf Am Af Gm Gf Af Cf Cm Uf Gm Gf Am Gf Cm Af, The sequence of the antisense strand is Um Gf Cm Uf Cm Cf Am Gf Gm Uf Cm Cm Um Uf Cm Uf Cm Af Cm UmGm; #7-1: The sequence of the positive chain is Cm Gf Gm Cf Um Gf Gm Cf Cm Uf Um Cf Am Gf Gm Af Um Cf Um, The sequence of the antisense strand is Af Gm Af Um Cf Cm Uf Gm Af Am Gf Gm Cf Cm Af Gm Cf Cm Gf; #7-2: The sequence of the positive chain is Cf Gm Gf Cm Uf Gm Gf Cm Cf Uf Uf Cm Af Gm Gf Am Uf Cm Uf, The sequence of the antisense strand is Am Gf Am Uf Cm Cf Um Gf Am Af Gm Gm Cm Cf Am Gf Cm Cf Gm GmCm; Wherein, m represents 2'-OMe modification, f represents 2'-F modification, both ends are thio-modified, and the terminal is GalNAc-modified. GalNAc is covalently conjugated to the 3' end of the sense strand of siRNA in a trivalent state to form a conjugate. The chemical formula of GalNAc is as follows: 。 3. Use of the siRNA composition according to claim 1 in the preparation of a drug for treating liver cancer, wherein the drug inhibits the expression of the FBXL6 gene in liver cancer.
4. Use of the siRNA derivative according to claim 2 in the preparation of a drug for treating liver cancer, wherein the drug inhibits the expression of the FBXL6 gene in liver cancer.
Citation Information
Patent Citations
Application of FBXL6 as target in preparation of antitumor drugs
CN111004848A
Application of shRNA for inhibiting SOX30 gene expression
CN117947023A