Function and application of endoplasmic reticulum-Golgi apparatus intermediate compartment protein 1 in regulation of immunity and inflammation

Abstract

The invention provides a function and application of endoplasmic reticulum-Golgi apparatus intermediate compartment protein 1 in regulating immunity and inflammation. Specifically, the invention provides an ERGIC1 regulator and application thereof, a pharmaceutical composition containing the ERGIC1 regulator, a kit containing the ERGIC1 regulator, a method for regulating immune response and / or inflammatory response of a required object, and a method for regulating TLR function. The function of the ERGIC1 protein in immune-related and inflammation-related reactions is found for the first time, immune, cellular and molecular mechanisms of the ERGIC1 protein are disclosed, and it is proved that the ERGIC1 or related factors of the ERGIC1 can serve as a treatment target of immune and inflammation disorder-related diseases.

Description

Technical Field

[0001] The present invention relates to the fields of biomedicine, disease prevention and treatment, and more particularly to the function and application of endoplasmic reticulum-Golgi intermediate compartment protein 1 in regulating immunity and inflammation. Background Art

[0002] The occurrence of host autoimmunity and inflammation is an important factor in maintaining host health. Pathogen invasion is one of the main pathogenic causes of various major diseases in the host. For example, the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and monkeypox virus (MPV) that have become prevalent in recent years have caused the occurrence of two major diseases that seriously damage human health. As the first line of defense for the host to resist pathogen infection, innate immunity can produce various immune responses during pathogen invasion. For example, antiviral immune responses driven by various pattern recognition receptors such as Toll-like receptors (TLRs), NOD-like receptors (NLRs), RIG-I-like receptors (RLRs), and cGAS-STING are accompanied by the production of a large number of different types of inflammatory factors, thereby effectively resisting pathogen invasion. Appropriate immune responses can clear pathogens and are beneficial to the body. However, excessive autoimmune responses will produce excessive inflammatory factors, trigger a cytokine storm, and thus cause the occurrence of autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis, and psoriasis, endangering human health.

[0003] The endoplasmic reticulum-Golgi intermediate compartment (ERGIC), as an important site for the occurrence of various immune responses, plays a key role in regulating the process of host immune response. And endoplasmic reticulum-Golgi intermediate compartment protein 1 (ERGIC1), as an important regulatory molecule on the ERGIC organelle, has been shown to play an important role in regulating the occurrence of non-infection-related diseases, non-inflammation-related diseases, or non-immune-related diseases. However, there is still no clear study on whether it plays a regulatory function in regulating the immune and inflammatory responses of the host, nor is there any research on the related pathological, immune, cellular or molecular mechanisms.

[0004] The problem to be solved by the present invention is to discover whether ERGIC1 has immune regulatory and inflammatory level regulatory functions during the occurrence of mammalian (including human) host immune responses and inflammatory responses, and to study and clarify its related immune, cellular and molecular mechanisms, with a view to using ERGIC1 and its related factors as therapeutic targets for immune and inflammation-related diseases. Summary of the Invention

[0005] The object of the present invention is to disclose the functions and applications of ERGIC1 (ER-Golgi intermediate compartment protein 1) in the regulation of immunity and inflammation in mammals (including humans).

[0006] Another object of the present invention is to provide the application of an ERGIC1 regulator in regulating immune responses and / or inflammatory responses and its potential application in the treatment of related diseases.

[0007] In the first aspect of the present invention, there is provided the use of an ERGIC1 regulator for preparing a composition or preparation for regulating the immune response and / or inflammatory response of a subject in need thereof.

[0008] In another preferred embodiment, the regulation of the immune response and / or inflammatory response of the subject in need thereof includes:

[0009] (a) promoting the immune response and / or inflammatory response of the subject in need thereof; and / or

[0010] (b) inhibiting the immune response and / or inflammatory response of the subject in need thereof.

[0011] In another preferred embodiment, the inflammatory response is caused by an immune response.

[0012] In another preferred embodiment, the immune response includes: non-specific immune response, specific immune response, or a combination thereof.

[0013] In another preferred embodiment, the immune response includes: type I allergic reaction, type II allergic reaction, type III allergic reaction, type IV allergic reaction, or a combination thereof.

[0014] In another preferred embodiment, the immune response is caused by a pathogen.

[0015] In another preferred embodiment, the pathogen includes: virus, chlamydia, rickettsia, mycoplasma, bacterium, spirochete, fungus, protozoan, worm, or a combination thereof.

[0016] In another preferred embodiment, the virus includes animal virus, plant virus, bacteriophage.

[0017] In another preferred embodiment, the plant virus includes tobacco mosaic virus.

[0018] In another preferred embodiment, the virus includes RNA virus, DNA virus.

[0019] In another preferred embodiment, the RNA virus includes: double-stranded RNA virus, positive single-stranded RNA virus, negative single-stranded RNA virus, retrovirus, satellite virus.

[0020] In another preferred example, the RNA virus includes but is not limited to: influenza virus, coronavirus, human immunodeficiency virus, human T-lymphotropic virus, rabies virus, respiratory syncytial virus, parainfluenza virus, metapneumovirus, measles virus, mumps virus, rubella virus, enterovirus, rotavirus, norovirus, astrovirus, hepatitis A virus, hepatitis C virus, hepatitis E virus, Japanese encephalitis virus, Ebola virus, Marburg virus, Lassa virus, lymphocytic choriomeningitis virus, hantavirus, yellow fever virus, dengue virus, Zika virus, or a combination thereof.

[0021] In another preferred example, the influenza virus includes but is not limited to: influenza A virus, influenza B virus, influenza C virus, influenza D virus.

[0022] In another preferred example, the coronavirus includes but is not limited to: novel coronavirus, Middle East respiratory syndrome virus, common cold human coronavirus (such as OC43), infectious bronchitis virus (IBV).

[0023] In another preferred example, the enterovirus includes: EV71, Coxsackievirus, poliovirus.

[0024] In another preferred example, the human T-lymphotropic virus (HTLV) includes: HTLV-I type, HTLV-II type.

[0025] In another preferred example, the DNA virus includes but is not limited to: vertebrate DNA virus, insect DNA virus, plant DNA virus, single-stranded DNA phage, double-stranded DNA phage, algal DNA virus.

[0026] In another preferred example, the DNA virus includes: double-stranded DNA virus, single-stranded DNA virus.

[0027] In another preferred example, the DNA virus includes but is not limited to: herpesviridae virus, poxvirus family, adenoviridae (adenovirus), human papillomavirus (HPV), parvoviridae (parvovirus B19, bocavirus, adeno-associated virus), hepadnaviridae (hepatitis B virus).

[0028] In another preferred example, the herpesviridae includes but is not limited to: herpes simplex virus (HSV, including HSV-1 (human herpesvirus 1) and HSV-2 (human herpesvirus 2)), varicella-zoster virus (human herpesvirus 3), Epstein-Barr virus (human herpesvirus 4), cytomegalovirus (human herpesvirus 5), human herpesvirus 6, human herpesvirus 7, human herpesvirus 8, herpesvirus B.

[0029] In another preferred example, the Poxviridae family includes, but is not limited to: Variola virus, Monkeypox virus.

[0030] In another preferred example, the immune response includes: an antiviral response.

[0031] In another preferred example, modulating the immune response and / or inflammatory response of a desired subject includes:

[0032] (a) Upregulating (or increasing) the transcription and / or protein level of a proinflammatory cytokine; or downregulating (or decreasing) the transcription and / or protein level of a proinflammatory cytokine;

[0033] (b) Upregulating (or increasing) the transcription and / or protein level of an Interferon (IFN); or downregulating (or decreasing) the transcription and / or protein level of an Interferon;

[0034] (c) Upregulating (or increasing) the transcription and / or protein level of an Interleukin (IL); or downregulating (or decreasing) the transcription and / or protein level of an Interleukin;

[0035] (d) Upregulating (or increasing) the transcription and / or protein level of an Interferon-Stimulated Gene (ISG); or downregulating (or decreasing) the transcription and / or protein level of an Interferon-Stimulated Gene; and / or

[0036] (e) Upregulating (or increasing) the transcription and / or protein level of a regulator of proinflammatory cytokines; or downregulating (or decreasing) the transcription and / or protein level of a regulator of proinflammatory cytokines.

[0037] In another preferred example, the proinflammatory cytokines include, but are not limited to: TNF-α, TNF-β, IL-1 (IL-1b, IL-1a), IL-2, IL-6, IL-8, IL-12, IL-18, IFN-γ, macrophage migration inhibitory factor (MIF), IL-4, IL-13, IL-10, IL-1Ra, or a combination thereof

[0038] In another preferred example, the interferons include, but are not limited to: IFN-β, IFN-α, IFN-γ, IFN-λ, or a combination thereof.

[0039] In another preferred example, the interleukin includes but is not limited to: IL-1b, IL-1a, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, IL-37, IL-38, IL-39, IL-40, IL-41, IL-42, or a combination thereof.

[0040] In another preferred example, the inflammatory factor regulator includes but is not limited to: the main factors of the NFKB pathway, the main factors of the MAPK pathway, or a combination thereof.

[0041] In another preferred example, the main factors of the NFKB pathway include but are not limited to: NF-κB2p52 / p100, NF-κB1p50 / p105, c-Rel, RelA / p65, RelB, or a combination thereof.

[0042] In another preferred example, the main factors of the MAPK pathway include but are not limited to: extracellular signal-regulated protein kinases (ERK1 / 2), c-Jun N-terminal kinases / stress-activated protein kinases (JNK / SAPK), p38MAPK, ERK5, or a combination thereof.

[0043] In another preferred example, the interferon-stimulated genes include but are not limited to: OAS, PKR, interferon regulatory factor (IRF), zinc finger antiviral protein (ZAP), IFIT family proteins, STAT1, STAT2, ISG15, ISG20, ISG56, CXCL10, MX1, interferon-induced transmembrane proteins (IFITM), bone marrow stromal cell antigen 2 (Tetherin), viperin protein, APOBEC1, or a combination thereof.

[0044] In another preferred example, the interferon regulatory factor (IRF) is selected from the group consisting of: IRF1, IRF2, IRF3, IRF4, IRF5, IRF6, IRF7, IRF8, IRF9, IRF10, IRF11, or a combination thereof.

[0045] In another preferred example, the IFIT family proteins are selected from the group consisting of: IFIT1, IFIT2, IFIT3, IFIT5, or a combination thereof.

[0046] In another preferred example, the interferon-induced transmembrane protein (IFITM) is selected from the group consisting of: IFITM1, IFITM2, IFITM3, or a combination thereof.

[0047] In another preferred example, the interferon-stimulated gene is selected from the group consisting of: ISG56, CXCL10, or a combination thereof.

[0048] In another preferred example, the desired subject is a human or non-human mammal.

[0049] In another preferred example, the desired subject is a cell.

[0050] In another preferred example, the non-human mammal includes rodents (such as mice, rats).

[0051] In another preferred example, the ERGIC1 regulator is used to upregulate (or increase) the mRNA or protein content and / or activity of ERGIC1; or to downregulate (or decrease) the mRNA or protein content and / or activity of ERGIC1.

[0052] In another preferred example, the ERGIC1 regulator is selected from the group consisting of:

[0053] i) An active ingredient that targets and inhibits the activity of ERGIC1 (ERGIC1 inhibitor or antagonist) selected from the group consisting of: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or a combination thereof;

[0054] ii) An active ingredient that targets and activates the activity of ERGIC1 (ERGIC1 agonist or promoter) selected from the group consisting of: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or a combination thereof.

[0055] In another preferred example, the active ingredient that targets and inhibits the activity of ERGIC1 is used to inhibit the immune response and / or inflammatory response of the desired subject.

[0056] In another preferred example, the active ingredient that targets and inhibits the activity of ERGIC1 is used to promote the immune response and / or inflammatory response of the desired subject.

[0057] In another preferred example, the active ingredient that targets and activates the activity of ERGIC1 is used to promote the immune response and / or inflammatory response of the desired subject.

[0058] In another preferred example, the active ingredient that targets and activates the activity of ERGIC1 is used to inhibit the immune response and / or inflammatory response of the desired subject.

[0059] In another preferred example, the active ingredient that targets and inhibits the activity of ERGIC1 is a small molecule compound.

[0060] In another preferred example, the active ingredient targeting and activating ERGIC1 is a small molecule compound.

[0061] In another preferred example, the active ingredient targeting and inhibiting ERGIC1 is an antibody.

[0062] In another preferred example, the active ingredient targeting and activating ERGIC1 is an antibody.

[0063] In another preferred example, the ERGIC1 regulator includes but is not limited to: miRNA, siRNA, dsRNA, shRNA, circular RNA, or a combination thereof.

[0064] In another preferred example, the gene editing reagent includes sgRNA and Cas9 protein.

[0065] In another preferred example, the sgRNA has the sequence shown in SEQ ID NO:1.

[0066] In another preferred example, the preparation is selected from the group consisting of: topical preparations, oral preparations, and injections.

[0067] In another preferred example, the topical preparation is selected from the group consisting of: creams, ointments, and emulsions.

[0068] In another preferred example, the preparation is selected from the group consisting of: powders, granules, capsules, injections, tinctures, oral liquids, tablets, lozenges, or dripping pills.

[0069] In another preferred example, the composition further includes:

[0070] (a) TLR regulator;

[0071] (b) TLR ligand regulator; and / or

[0072] (c) Promoter for the ERGIC1 regulator.

[0073] In another preferred example, the composition or preparation is used to inhibit the immune response and / or inflammatory response of a desired subject; the subject has an autoimmune disease caused by excessive immunity.

[0074] In another preferred example, the autoimmune disease includes but is not limited to: autoimmune urticaria, chronic lymphocytic thyroiditis (Hashimoto's thyroiditis), myasthenia gravis, ulcerative colitis, pemphigus vulgaris, pemphigoid, primary biliary cirrhosis, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, systemic vasculitis, scleroderma, dermatomyositis, mixed connective tissue disease, autoimmune hemolysis, type I diabetes, or a combination thereof.

[0075] In another preferred embodiment, the composition or formulation is used to promote the immune response and / or inflammatory response of a desired subject; the subject has a disease caused by low or reduced immunity.

[0076] In another preferred embodiment, the diseases caused by low or reduced immunity include: pathogen infection diseases, congenital immunodeficiency diseases.

[0077] In another preferred embodiment, the pathogen infection diseases include, but are not limited to: viral colds (such as influenza (caused by influenza virus), common cold (caused by viruses such as rhinovirus, adenovirus, respiratory syncytial virus, parainfluenza virus, etc.)), respiratory tract infections (such as cough, expectoration, bronchiolitis, bronchitis, chronic obstructive pulmonary disease (COPD), asthma), fever, muscle soreness, lung infections (such as pneumonia), intestinal infections (such as abdominal pain, diarrhea), eye infections (such as conjunctivitis), myocarditis, kidney function impairment (such as acute kidney injury), central nervous system infections (such as convulsions, stroke, aphasia, epilepsy, encephalitis and other central nervous system diseases), acquired immunodeficiency, adult T-cell leukemia / lymphoma, hairy cell leukemia, tropical spastic paraparesis, HTLV-associated myelopathy, rabies, measles, mumps, rubella, aseptic meningitis, hand, foot and mouth disease, acute gastroenteritis, herpangina, astrovirus, hepatitis A, hepatitis C, hepatitis E, Japanese encephalitis, Ebola virus disease, Marburg virus disease, Lassa fever, lymphocytic choriomeningitis, epidemic hemorrhagic fever, yellow fever, dengue fever, neonatal microcephaly, chlamydia infection (such as trachoma), urogenital infections, lymphogranuloma venereum, rickettsial diseases (such as epidemic typhus, murine typhus, Rocky Mountain spotted fever, rickettsialpox, scrub typhus, tick-borne typhus, trench fever), skin infections, intracranial infections, cardiovascular system infections, leptospirosis, syphilis, relapsing fever, Vincent's angina, Lyme disease, mycosis, protozoal diseases (such as malaria, amebiasis, toxoplasmosis), helminth diseases (such as ascariasis, hookworm disease, taeniasis, enterobiasis, clonorchiasis), or combinations thereof.

[0078] In another preferred embodiment, the congenital immunodeficiency diseases include, but are not limited to: primary B-cell immunodeficiency diseases, primary T-cell immunodeficiency diseases, primary B-cell deficiency diseases, primary combined immunodeficiency diseases, primary phagocyte deficiency diseases, primary complement deficiencies, or combinations thereof.

[0079] In a second aspect of the present invention, there is provided an ERGIC1 regulator, and the ERGIC1 regulator is selected from the following group:

[0080] i) Active ingredients (ERGIC1 inhibitors or antagonists) that target and inhibit the activity of ERGIC1 selected from the following group: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or combinations thereof;

[0081] (ii) An active ingredient that targets and activates ERGIC1 (ERGIC1 agonist or promoter) selected from the group consisting of: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or combinations thereof.

[0082] In another preferred embodiment, the ERGIC1 modulator is used to upregulate (or increase) the mRNA or protein content and / or activity of ERGIC1; or to downregulate (or decrease) the mRNA or protein content and / or activity of ERGIC1.

[0083] In another preferred embodiment, the active ingredient that targets and inhibits ERGIC1 is a small molecule compound.

[0084] In another preferred embodiment, the active ingredient that targets and activates ERGIC1 is a small molecule compound.

[0085] In another preferred embodiment, the active ingredient that targets and inhibits ERGIC1 is an antibody.

[0086] In another preferred embodiment, the active ingredient that targets and activates ERGIC1 is an antibody.

[0087] In another preferred embodiment, the ERGIC1 modulator includes, but is not limited to: miRNAs, siRNAs, dsRNAs, shRNAs, circular RNAs, or combinations thereof.

[0088] In another preferred embodiment, the gene editing reagent includes sgRNA and Cas9 protein.

[0089] In another preferred embodiment, the sgRNA has the sequence shown in SEQ ID NO:1.

[0090] In a third aspect of the present invention, there is provided a pharmaceutical composition comprising:

[0091] (Z1) An ERGIC1 modulator as described in the second aspect of the present invention; and

[0092] (Z2) A pharmaceutically acceptable carrier or excipient.

[0093] In another preferred embodiment, the ERGIC1 modulator is selected from the group consisting of:

[0094] i) An active ingredient that targets and inhibits ERGIC1 (ERGIC1 inhibitor or antagonist) selected from the group consisting of: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or combinations thereof;

[0095] (ii) An active ingredient that targets and activates ERGIC1 (ERGIC1 agonist or promoter), selected from the following group: small molecule compounds, miRNA, antisense nucleic acids, non-coding RNA, antibodies, gene editing reagents, or combinations thereof.

[0096] In another preferred embodiment, the active ingredient that targets and inhibits ERGIC1 is a small molecule compound.

[0097] In another preferred embodiment, the active ingredient that targets and activates ERGIC1 is a small molecule compound.

[0098] In another preferred embodiment, the active ingredient that targets and inhibits ERGIC1 is an antibody.

[0099] In another preferred embodiment, the active ingredient that targets and activates ERGIC1 is an antibody.

[0100] In another preferred embodiment, the ERGIC1 regulator includes but is not limited to: miRNA, siRNA, dsRNA, shRNA, or combinations thereof.

[0101] In another preferred embodiment, the gene editing reagent includes sgRNA and Cas9 protein.

[0102] In another preferred embodiment, the sgRNA has the sequence shown in SEQ ID NO:1.

[0103] In another preferred embodiment, the pharmaceutical composition further comprises:

[0104] (a) A TLR regulator;

[0105] (b) A TLR ligand regulator; and / or

[0106] (c) A promoter for the ERGIC1 regulator.

[0107] In another preferred embodiment, the TLR includes: members of the TLR receptor family proteins that recognize nucleic acid molecules, members of the TLR receptor family proteins that recognize non-nucleic acid molecules.

[0108] In another preferred embodiment, the members of the TLR receptor family proteins that recognize nucleic acid molecules include but are not limited to: TLR3, TLR7, TLR8, TLR9, TLR11, TLR12, TLR13, or combinations thereof; preferably, the members of the TLR receptor family proteins that recognize nucleic acid molecules are: TLR7, TLR8, TLR9 and / or TLR3.

[0109] In another preferred example, the members of the TLR receptor family proteins that recognize non-nucleic acid molecules include, but are not limited to: TLR1, TLR2, TLR4, TLR5, TLR6, or a combination thereof.

[0110] In another preferred example, the TLR ligands include: TLR1 ligand, TLR2 ligand, TLR3 ligand, TLR4 ligand, TLR5 ligand, TLR6 ligand, TLR7 ligand, TLR8 ligand, TLR9 ligand, TLR11 ligand, TLR12 ligand, TLR13 ligand, or a combination thereof;

[0111] Preferably, the TLR ligands are selected from the group consisting of: TLR3 ligand, TLR7 ligand, TLR8 ligand, TLR9 ligand, TLR11 ligand, TLR13 ligand, or a combination thereof; More preferably, the TLR ligands are: TLR3 ligand, TLR7 ligand, TLR8 ligand, and / or TLR9 ligand.

[0112] In another preferred example, the TLR modulators are selected from the group consisting of:

[0113] i) Active ingredients that target and inhibit the activity of TLR (TLR inhibitors or antagonists) selected from the group consisting of: small molecule compounds, miRNA, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or a combination thereof;

[0114] ii) Active ingredients that target and activate TLR (TLR agonists or promoters) selected from the group consisting of: small molecule compounds, miRNA, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or a combination thereof.

[0115] In another preferred example, the TLR inhibitors or antagonists include, but are not limited to: Chloroquinediphosphate, E6446 (TLR7, TLR9 inhibitor), Enpatoran (M5049) hydrochloride (TLR7 / 8 inhibitor), or a combination thereof.

[0116] In another preferred example, the TLR agonists or promoters include, but are not limited to: Pam3CSK4 (TLR2 agonist), MPLA, LPS (TLR4 agonist), imiquimod (TLR7 / 8 agonist), ZG0895 hydrochloride (TLR8 agonist), CpG (TLR9 agonist), or a combination thereof.

[0117] In another preferred example, the TLR ligand modulators are selected from the group consisting of:

[0118] i) An active ingredient that targets and inhibits the activity of TLR ligands (TLR ligand inhibitor or antagonist), selected from the group consisting of: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or combinations thereof;

[0119] ii) An active ingredient that targets and activates TLR ligands (TLR ligand agonist or promoter), selected from the group consisting of: small molecule compounds, miRNAs, antisense nucleic acids, non-coding RNAs, antibodies, gene editing reagents, or combinations thereof.

[0120] In another preferred embodiment, the TLR ligand inhibitor or antagonist includes, but is not limited to: Chloroquinediphosphate, E6446 (TLR7, TLR9 inhibitor), Enpatoran (M5049) hydrochloride (TLR7 / 8 inhibitor), or combinations thereof.

[0121] In another preferred embodiment, the TLR ligand agonist or promoter includes, but is not limited to: Pam3CSK4 (TLR2 agonist), MPLA, LPS (TLR4 agonist), imiquimod (TLR7 / 8 agonist), ZG0895 hydrochloride (TLR8 agonist), CpG (TLR9 agonist), or combinations thereof.

[0122] In another preferred embodiment, the formulation of the pharmaceutical composition is selected from the group consisting of: topical formulations, oral formulations, injections.

[0123] In another preferred embodiment, the topical formulation is selected from the group consisting of: creams, ointments, lotions.

[0124] In another preferred embodiment, the formulation of the pharmaceutical composition is selected from the group consisting of: powders, granules, capsules, injections, tinctures, oral liquids, tablets, lozenges, or dripping pills.

[0125] In a fourth aspect of the present invention, a method for modulating the intensity of an immune response and / or an inflammatory response in a desired subject is provided, the method comprising the step of: administering to the desired subject an effective amount of an ERGIC1 modulator as described in the second aspect of the present invention and / or a pharmaceutical composition as described in the third aspect of the present invention.

[0126] In another preferred embodiment, the method is an in vitro method.

[0127] In another preferred embodiment, the method is a method for non-therapeutic and non-diagnostic purposes.

[0128] In another preferred embodiment, the desired subject is a human or non-human mammal.

[0129] In another preferred embodiment, the desired subject is a cell.

[0130] In another preferred example, the non-human mammal includes rodents (such as mice, rats).

[0131] In another preferred example, the regulating the immune response and / or inflammatory response of a desired subject includes:

[0132] (a) Promoting the immune response and / or inflammatory response of the desired subject; and / or

[0133] (b) Inhibiting the immune response and / or inflammatory response of the desired subject.

[0134] In another preferred example, the promoting the immune response and / or inflammatory response of the desired subject includes: increasing the level of inflammatory factors, increasing the level of interferon, or a combination thereof.

[0135] In another preferred example, the inhibiting the immune response and / or inflammatory response of the desired subject includes: decreasing the level of inflammatory factors, decreasing the level of interferon, or a combination thereof.

[0136] In a fifth aspect of the present invention, there is provided a method for regulating TLR function, the method comprising the step of administering to a desired subject an effective amount of an ERGIC1 regulator as described in the second aspect of the present invention and / or a pharmaceutical composition as described in the third aspect of the present invention.

[0137] In another preferred example, the method is an in vitro method.

[0138] In another preferred example, the method is a method for non-therapeutic and non-diagnostic purposes.

[0139] In another preferred example, the desired subject is a human or a non-human mammal.

[0140] In another preferred example, the desired subject is a cell.

[0141] In another preferred example, the non-human mammal includes rodents (such as mice, rats).

[0142] In another preferred example, the TLR function includes but is not limited to: mediating antiviral immune response, regulating the occurrence of inflammation (including excessive inflammation), activating adaptive immunity, promoting innate immune cells to release various inflammatory factors or interferon, recognizing nucleic acid molecules, self-nucleic acid response, or a combination thereof.

[0143] In another preferred example, the nucleic acid molecule is selected from: DNA, RNA, or a combination thereof.

[0144] In another preferred example, the regulating TLR function includes: regulating the interaction between TLR and its molecular chaperone.

[0145] In another preferred example, the TLRs include: members of the TLR receptor family proteins that recognize nucleic acid-like molecules, and members of the TLR receptor family proteins that recognize non-nucleic acid-like molecules.

[0146] In another preferred example, the members of the TLR receptor family proteins that recognize nucleic acid-like molecules include, but are not limited to: TLR3, TLR7, TLR8, TLR9, TLR11, TLR12, TLR13, or combinations thereof; preferably, the members of the TLR receptor family proteins that recognize nucleic acid-like molecules are: TLR3, TLR7, TLR8, and / or TLR9.

[0147] In another preferred example, the members of the TLR receptor family proteins that recognize non-nucleic acid-like molecules include, but are not limited to: TLR1, TLR2, TLR4, TLR5, TLR6, or combinations thereof.

[0148] In another preferred example, the molecular chaperone is UNC93B1.

[0149] In the sixth aspect of the present invention, a kit is provided, and the kit includes:

[0150] (Z1) A first container, and an ERGIC1 regulator placed inside the first container.

[0151] In another preferred example, the kit further includes:

[0152] (Z2) A second container, and a TLR regulator and / or a TLR ligand regulator placed inside the second container.

[0153] In another preferred example, the kit further includes:

[0154] (Z3) A third container, and a promoter for the ERGIC1 regulator placed inside the third container.

[0155] In another preferred example, the first container and the second container can be the same or different containers.

[0156] In another preferred example, any two or all three of the first container, the second container, and the third container can be the same or different containers.

[0157] It should be understood that within the scope of the present invention, the above-mentioned various technical features of the present invention and the various technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. Brief Description of the Drawings

[0158] Figure 1 Shows the knockout identification of endoplasmic reticulum-Golgi intermediate compartment protein 1 in mouse peritoneal macrophages.Figure 1 The upper sequence is the guide RNA required for ERGIC1 knockout designed using the CRISPR-Cas9 technology, and the lower sequence is the gene sequence of the misfolded ERGIC1 protein (GTACGTTGCCTACAGCACA, SEQ ID NO:2; GTACGTTGCCTACACA, SEQ ID NO:3) caused by frameshift mutation after ERGIC1 knockout. The gene sequences of the two misfolded proteins prove that frameshift mutations have occurred in both alleles of the ERGIC1 protein. Figure 1 B shows that after knocking out ERGIC1, Western blot was used to confirm the successful knockout of the ERGIC1 protein at the protein level, and tubulin was used as an internal reference control protein in the cell.

[0159] Figure 2 It shows that the intracellular cytokine staining (ICS) technique was used to identify at the level of the produced protein factors that the deletion of ERGIC1 would cause a weakened antiviral response mediated by Toll-like receptor, including the peak graph shown in the ICS flow cytometry results ( Figure 2 A) and the quantitative statistical graph of the mean fluorescence intensity analysis ( Figure 2 B). NS is the non-stimulated group; R848 is single-stranded RNA, which is a ligand agonist of TLR7 in the TLR family; CpG-B is double-stranded DNA, which is an agonist of TLR9; Poly(I:C) is double-stranded RNA, which is an agonist of TLR3; LPS is lipopolysaccharide, one of the components of the bacterial cell wall, which is an agonist of TLR4.

[0160] Figure 3 It shows that real-time fluorescence quantitative technology (qPCR) was used to identify at the mRNA level that the deletion of ERGIC1 would cause a weakened antiviral response mediated by Toll-like receptor.

[0161] Figure 4 It shows an exploration of the mechanism by which endoplasmic reticulum-Golgi intermediate compartment protein 1 regulates TLR-mediated immune responses. The protein immunoprecipitation technique (CO-IP) was used to verify that in the case of ERGIC1 deletion, the function of TLR itself would be affected.

[0162] Figure 5 It shows an exploration of the regulation of the inflammatory process during virus infection by endoplasmic reticulum-Golgi intermediate compartment protein 1. Detailed implementation manners

[0163] After extensive and in-depth research and a large number of screenings, the present inventor unexpectedly discovered for the first time the function and application of endoplasmic reticulum-Golgi intermediate compartment protein 1 (ERGIC1) in regulating immunity and inflammation in mammals (including humans). The deletion of ERGIC1 results in a weakened TLR-mediated antiviral response (especially a significant down-regulation of the antiviral responses mediated by TLR7 and TLR9), and down-regulates the mRNA levels of various inflammatory factors and various interferon-related factors (especially significantly down-regulating the mRNA levels of interferon factors such as IFN-β, ISG56, CXCL10, and inflammatory factors such as TNF-α, IL-1β). In addition, through techniques such as co-immunoprecipitation (Co-IP), it was verified that in the case of ERGIC1 deletion, the normal functions of multiple TLRs were significantly affected, especially weakening the interaction between TLRs and molecular chaperones, revealing the immune, cellular, and molecular mechanisms by which ERGIC1 regulates the levels of immune and inflammatory responses, and confirming that ERGIC1 and its related factors can be used as therapeutic targets for diseases related to immune and inflammatory disorders. On this basis, the present invention was completed.

[0164] Term

[0165] To more easily understand the present disclosure, certain terms are first defined. As used in this application, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below.

[0166] The term "about" may refer to a value or a composition within an acceptable error range of a specific value or composition determined by a person of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

[0167] The term "administer" refers to physically introducing the product of the present invention into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including intravenous, intratumoral, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral administration routes, such as by injection or infusion.

[0168] As used herein, the term "Toll-like receptor(s)" refers to Toll-like receptors (TLRs), which are a class of pattern recognition receptors in innate immunity.

[0169] As used herein, the term "CRISPR-Cas9" refers to the third generation of gene editing technology following the introduction of gene editing technologies such as ZFN and TALENs.

[0170] As used in this article, the term "nonspecific immune response" can be used interchangeably with terms such as "natural immunity", "innate immunity" or "innate immunity", which refers to a series of natural defense functions formed by organisms during long-term phylogenetic development and evolution. The components of nonspecific immunity include: tissue barriers (skin and mucosal systems, blood-brain barriers, placental barriers, etc.); innate immune cells (phagocytes, killer cells, dendritic cells, etc.); innate immune molecules (complement, cytokines, enzymes, etc.).

[0171] As used herein, the term "specific immune response" can be used interchangeably with terms such as "acquired immunity" or "adaptive immunity", and refers to the ability of the body to resist infection acquired through acquired infection (recovery or asymptomatic infection) or artificial vaccination (bacterial vaccine, vaccine, toxoid, immunoglobulin, etc.). This immunity is only directed against one pathogen, and is generally formed after stimulation by antigenic substances such as microorganisms (i.e. pathogens) (immunoglobulins, immune lymphocytes), and can react specifically to the antigen. The response to antigen stimulation is mainly T cells and B cells, but in the process of completing specific immunity, the participation of some other cells (macrophages, granulocytes, etc.) is also required.

[0172] ERGIC1

[0173] As used herein, the term "ERGIC1" refers to ER-Golgi intermediate compartment protein 1, which is a type of protein molecule found on the ER-Golgi intermediate compartment organelle. The prior art mainly introduces that ERGIC1 mutations can cause certain non-infectious, non-inflammatory or non-immune diseases, such as neurogenic arthrogryposis and gastric cancer, through screening and research based on clinical samples. These existing reports on ERGIC1 do not involve immune-related and inflammation-related research, and this application explains for the first time the function of ERGIC1 in immune-related and inflammation-related reactions.

[0174] In addition, existing studies are based on statistics and analysis of clinical samples, and have not conducted in-depth research on related mechanisms. This application conducts a deeper exploration of mechanisms based on the phenotypes that have been obtained.

[0175] It was unexpectedly discovered for the first time in this application that the deletion of ERGIC1 would cause a weakened TLR-mediated antiviral response (especially a significant downregulation of the antiviral responses mediated by TLR7 and TLR9), and downregulate the mRNA levels of various inflammatory factors and various interferon factors (especially significantly downregulating the mRNA levels of interferon factors such as IFN-β, ISG56, CXCL10, and inflammatory factors such as TNF-α, IL-1β). In addition, based on the protein co-immunoprecipitation technique (CO-IP), it was verified that in the case of ERGIC1 deletion, the normal function of TLR itself would be affected, especially weakening the interaction between TLR and molecular chaperones, revealing the immune, cellular, and molecular mechanisms by which ERGIC1 regulates the levels of immune and inflammatory responses.

[0176] TLR

[0177] Toll-like receptor (TLR) belongs to the membrane protein receptor family and can recognize various pathogen-associated molecular patterns (PAMPs). After activation, TLR can promote innate immune cells to release various inflammatory factors or interferons, and further activate adaptive immunity, playing a crucial role in immune recognition and response.

[0178] Among the members of the TLR family, those that can recognize nucleic acid molecules such as DNA and RNA are collectively called nucleic acid-sensing TLR, such as TLR9 (recognizing DNA), TLR7 / 8 (recognizing single-stranded RNA), TLR3 (recognizing double-stranded RNA), TLR13 (recognizing bacterial ribosomal RNA fragments), etc. Nucleic acid-sensing TLR functions in endosomes or lysosomes. When pathogens invade through endocytosis, TLR can recognize viral nucleic acid molecules and initiate corresponding intracellular immune responses and signal transduction. At the same time, nucleic acids are also one of the main components of the host organism, and nucleic acid-sensing TLR needs to accurately distinguish endogenous and exogenous nucleic acid molecules present in the intracellular endocytic system. The appearance of host own nucleic acids in the wrong organelles or extracellular release can also be recognized by TLR as damage-associated molecular patterns (DAMPs). Multiple studies have suggested that abnormal functions of nucleic acid-sensing TLR can lead to out-of-control responses to self-nucleic acids, causing autoimmune over-inflammatory reactions and ultimately resulting in autoimmune diseases.

[0179] Immunity and Inflammation

[0180] Immune response (or immune response) is a concept in immunology. The activation of innate immunity or acquired immunity is an immune response. The four types of immune responses include type I hypersensitivity, type II hypersensitivity, type III hypersensitivity, and type IV hypersensitivity.

[0181] Type I allergic reaction (IgE-mediated): The IgE antibody adsorbed on the surface of mast cells / basophils binds to the corresponding antigen, causing the cells to release histamine, leukotrienes and other bioactive mediators, causing smooth muscle contraction, increased glandular secretion, dilation of small blood vessels and capillaries, increased permeability, eosinophilia, infiltration, etc. The reaction process generally does not destroy tissue cells. The main lesion sites are the skin, respiratory tract, digestive tract and cardiovascular system. Therefore, clinical manifestations are often urticaria (skin), asthma, allergic rhinitis (respiratory tract), nausea and vomiting, abdominal pain and diarrhea (digestive tract) and anaphylactic shock.

[0182] Type II hypersensitivity (antibody-mediated cytotoxicity): Target cell surface antigens or haptens combine with target cells to form complete antigens, stimulating the body to produce antibodies (IgG / IgM / IgA), and then encountering the same target cell antigen or hapten adsorbed on the cell membrane, activating complement to dissolve the cells. The most common affected are red blood cells, causing diseases such as autoimmune hemolytic anemia and hemolytic disease of the newborn; followed by granulocytes / platelets, causing granulocytopenia caused by aminopyrine, thrombocytopenic purpura caused by sedatives (haptens), etc.

[0183] Type III hypersensitivity (immune complex type): non-cellular antigens in the blood circulation neutralize antibodies (IgG / IgM) to form soluble immune complexes, which are deposited on the blood vessel wall or basement membrane to cause complement activation, attract neutrophils to aggregate and release lysosomes, causing vascular inflammation and tissue damage at the site of complex deposition. The lesions are mainly edema, cell infiltration, hemorrhage and necrosis. The pathogenesis of acute glomerulonephritis, systemic lupus erythematosus, and rheumatoid arthritis belongs to this category.

[0184] Type IV (cellular reaction type or delayed type): This type is different from the first three types and has nothing to do with antibodies. It is the release of various lymphokines (transfer factor, macrophage migration inhibitory factor, etc.) after sensitized lymphocytes (TD) bind to the corresponding antigens. Cytotoxic T cells (TC) can also directly kill target cells, causing allergic inflammation characterized by mononuclear cell infiltration and cell degeneration and necrosis. This type of reaction occurs slowly, generally 12 to 24 hours after re-exposure to the antigen, and the reaction reaches a peak in 48 to 72 hours, such as contact dermatitis, transplant rejection, tissue damage caused by Mycobacterium tuberculosis, BCG vaccination, etc.

[0185] Inflammatory response is a pathological concept, manifested as subjective sensations such as redness, swelling, heat, and pain, elevated molecular levels of inflammatory factors, interferons, etc., and pathological index changes such as infiltration of immune cells and structural / functional damage in tissues / organs.

[0186] An immune response does not necessarily lead to an inflammatory response, but an inflammatory response is always accompanied by an immune response. Excessive immune responses can cause inflammatory responses, such as those caused by pathogenic microorganism infections, autoimmune diseases, inflammation associated with tumors, and inflammatory responses induced by physical or chemical substances causing tissue damage, etc.

[0187] Immune cells and factors play important roles in the occurrence and resolution of inflammatory responses: during the occurrence of an inflammatory response, a large number of immune cells (such as macrophages, neutrophils, etc.) infiltrate the inflammatory site, and the activated immune cells release inflammatory factors (such as TNF-α, IL-6, IL-12, IL-18, IL-1, etc.), leading to an exacerbation of the inflammatory response; on the other hand, the resolution of the inflammatory response requires anti-inflammatory factors (such as IL-10, etc.) released by immune cells.

[0188] Common diseases caused by excessive immunity leading to excessive inflammation, such as rheumatoid arthritis, systemic lupus erythematosus, etc.

[0189] The main advantages of the present invention

[0190] 1. Based on the in vivo functions of important immune regulatory proteins, the present invention conducts research from animal individuals and tissue pathology, immune cell functions to the protein molecular level, with systematicness and integrity.

[0191] 2. The present invention for the first time reveals the functions and related regulatory mechanisms of the ERGIC1 molecule in maintaining and regulating host immune responses and inflammatory responses.

[0192] 3. The present invention provides new targets for host immunity and inflammation treatment, so the results have significant translational potential.

[0193] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0194] Example 1: Conditional knockout of ERGIC1 protein in major immune cell types

[0195] In this example, conditional knockout of the ERGIC1 protein in major immune cell types was performed.

[0196] For example: Using Raw264.7 wild-type cells (mouse peritoneal macrophages), the sgRNA (GTACGTTGCCTACAGCCACA, SEQ ID NO:1) of the target protein was transiently transfected into Raw264.7 cells through the plasmid vector PX330 using the CRISPR-Cas9 technology, resulting in specific knockout of the target protein.

[0197] As Figure 1 shown, Figure 1 A shows two incorrect protein sequences, demonstrating that frameshift mutations have occurred in both alleles on the ERGIC1 protein; Figure 1 B shows that after knockout of ERGIC1, western blot experiments were used to confirm successful knockout of the ERGIC1 protein at the protein level.

[0198] Thus, Raw264.7 ERGIC1 - / - cells with knocked-out ERGIC1 protein were constructed and verified.

[0199] Example 2: Verification of the function of ERGIC1 at the protein level in regulating TLR-mediated immune responses and inflammation

[0200] Raw264.7 wild-type cells and the Raw264.7 ERGIC1 - / - cells constructed in Example 1 were separately counted and cultured in 24-well plates. After being stimulated with TLR3, TLR7, TLR9, or TLR4 ligands for half an hour, BFA was added and the cells were cultured for another 6.5 h. After perforating the cells and performing antibody staining, flow cytometry was used to analyze the intracellular TNF-α level. Using these exogenous stimulations of TLR ligands can simulate the invasion process of pathogens.

[0201] As Figure 2 shown, compared with Raw264.7 wild-type cells, in Raw264.7 ERGIC1 - / - cells:

[0202] (1) The levels of TNF-α induced by TLR7 ligand (R848) and TLR9 ligand (CpG-B) showed a significant decrease, suggesting that the deletion of ERGIC1 would cause a weakening of the antiviral responses mediated by TLR7 and TLR9;

[0203] (2) There was no significant difference in the TNF-α levels induced by TLR4 ligand (LPS). TLR4 is a non-nucleic acid TLR that does not recognize nucleic acid molecules, and the function of TLR4 does not require the assistance of the nucleic acid TLR molecular chaperone Unc93b1. Therefore, it is used as a positive control group here to judge the specificity for nucleic acid TLRs.

[0204] In addition, in Raw264.7 wild-type cells and Raw264.7 ERGIC1 - / - cells, there was no significant difference in the TNF-α levels induced by TLR3 ligand (Poly(I:C)) compared with the non-stimulated NS group. First, although TLR3 is also a nucleic acid TLR, it does not share the same downstream signaling pathway as TLR7 and TLR9. Second, the ligand recognized by TLR3 is double-stranded RNA, an uncommon ligand, and the usual in vitro simulation cannot well activate the TLR3 signaling pathway, which may be the reason for the non-significant difference in the results.

[0205] Therefore, in this example, intracellular cytokine staining technology (ICS) was used to identify at the level of protein factors produced that the deletion of ERGIC1 would cause a weakened TLR-mediated antiviral response, especially a significant downregulation of the antiviral responses mediated by TLR7 and TLR9.

[0206] Example 3: Verification of the function of ERGIC1 at the mRNA level in regulating TLR-mediated immune responses and inflammation

[0207] The Raw264.7 wild-type cells and the Raw264.7 ERGIC1 - / - cells constructed in Example 1 were respectively counted and cultured in 6-well plates. After being stimulated with TLR3, TLR7, TLR9 or TLR4 ligand for 48 hours, the RNA of the cells was extracted, then reverse-transcribed into cDNA, and then real-time fluorescence quantitative PCR (Realtime-qPCR) experiments were carried out using primers for various inflammatory factors and interferon factors to analyze the levels of various inflammatory factors and interferon factors. IFN-b and IL-1b are both effector factors produced downstream during the activation of the TLR signaling pathway, where IL-1b is an inflammatory factor and IFN-b is an interferon factor.

[0208] As Figure 3 shown, after stimulation with TLR ligands, compared with Raw264.7 wild-type cells, the mRNA levels of each effector factor in Raw264.7 ERGIC1 - / - cells decreased, especially the interferon factor IFN-b and the inflammatory factor IL-1b decreased significantly. The decrease in the mRNA levels of inflammatory factors and interferon factors indicates a weakened TLR signal and explains the weakened antiviral immune response mediated by TLR.

[0209] Therefore, in this embodiment, real-time fluorescence quantitative technology was used to identify that the deletion of ERGIC1 would weaken the TLR-mediated antiviral response at the mRNA levels of inflammatory factors and interferon factors, downregulating the mRNA levels of IL-1b inflammatory factor and IFN-b interferon factor, especially significantly downregulating the mRNA levels of IFN-b interferon factor and IL-1b inflammatory factor.

[0210] Example 4: Exploration of the mechanism by which ERGIC1 regulates TLR-mediated immune responses

[0211] (1) Sucrose density gradient centrifugation and separation of cell membrane fractions: Raw264.7 wild-type cells and Raw264.7 ERGIC1 cells were scraped off in a solution containing sucrose and imidazole respectively. - / - After that, a homogenizer was used to disrupt the cell membrane, and low-speed centrifugation was used to remove the cell nuclei. The supernatant was added to the top of a continuous sucrose density gradient and then ultracentrifuged for 2 hours. The solution in the obtained tube was divided into 24 fractions. The distribution of the target protein in each fraction could be analyzed by western blot, or the fractions enriched with specific organelle marker molecules could be combined for immunoprecipitation experiments.

[0212] (2) Co-Immunoprecipitation (Co-IP): The harvested cells were lysed using cell lysis buffer, and then the supernatant was obtained by centrifugation. A small portion of the supernatant was used as the input control group (Input). The corresponding protein magnetic beads were added to the remaining supernatant, and the mixture was incubated with gentle rotation at 4°C overnight. Then, the magnetic beads were washed 5 times with cell lysis buffer, and the target protein on the magnetic beads was eluted for western blot detection.

[0213] As Figure 4 shown, magnetic beads coupled with Flag tags were used to enrich Unc93b1-Flag protein. Through western blot experiments, it could be seen that the amount of enriched Unc93b1 protein remained consistent in each sample; while the protein content of TLR indicated a change in its affinity with Unc93b1.

[0214] Especially under the condition of CpG-B stimulation and ERGIC1 deletion (where CpG-B stimulation was used to activate TLR in in vitro experiments to activate the interaction between TLR and UNC93b1), it could be seen that the amount of TLR protein co-immunoprecipitated based on UNC93b1 was significantly reduced compared to the condition without ERGIC1 deletion. In other words, under the condition of ERGIC1 deletion, the interaction between TLR and UNC93b1 was significantly weakened.

[0215] Unc93b1 is an essential molecular chaperone for the function of a class of nucleic acid TLRs (i.e., TLRs that can recognize nucleic acid molecules). Nucleic acid TLRs must interact with it to function properly. The aforementionedFigure 4 The results showed that when ERGIC1 was absent, the interaction between TLR and UNC93b1 was weakened, thereby affecting the normal function of TLR itself.

[0216] Therefore, in this example, the protein immunoprecipitation technique (CO-IP) was used to verify that in the case of ERGIC1 deficiency, the normal function of TLR itself would be affected, especially the interaction between TLR and molecular chaperones was weakened.

[0217] Example 5: Exploration of the process by which ERGIC1 regulates immune responses and inflammation during virus infection

[0218] Raw264.7 WT and Raw264.7 ERGIC1 cells were infected with the RNA virus IBV and the DNA virus HSV-1 respectively, and the effects of ERGIC1 deficiency on the mRNA levels of various effector factors (such as inflammatory factors, interferon factors, etc.) were detected during the virus infection process. - / - As shown in the figure, for the RNA virus IBV:

[0219] As Figure 5 shown, for the RNA virus IBV:

[0220] Under the condition of ERGIC1 deficiency, the mRNA levels of the inflammatory factors TNF-α and IL-1b decreased significantly, and the mRNA levels of the interferon factors IFN-β, ISG56, and CXCL10 also decreased significantly. Compared with the condition without ERGIC1 deficiency, the decrease in the mRNA levels of the above factors all reached statistically significant differences or even extremely significant differences. The above results were consistent with those in Example 3;

[0221] For the DNA virus HSV-1:

[0222] Under the condition of ERGIC1 deficiency, the mRNA levels of the inflammatory factors TNF-α and IL-1b increased slightly, but neither reached statistically significant differences. The mRNA levels of the interferon factors IFN-β, ISG56, and CXCL10 increased significantly and reached statistically significant differences.

[0223] The possible reason for the different results (upregulation of the mRNA levels of inflammatory factors and interferon factors) shown after HSV-1 infected the cells is that during the infection of live viruses, other signaling pathways different from TLR may be triggered, and these signaling pathways have a stronger response to the stimulation of HSV-1, resulting in an increase in the levels of downstream different cytokines.

[0224] In contrast to HSV-1, during the IBV infection process, the TLR signaling pathway shows a stronger response to the stimulation of IBV. Moreover, since the activation of the TLR signaling pathway is significantly downregulated by the deletion of ERGIC1, it ultimately leads to a decrease in the levels of different downstream cytokines.

[0225] Example 6: Intracellular molecular co-localization

[0226] In this example, an intracellular immunofluorescence experiment was used to determine the co-localization of intracellular molecules under different conditions by comparing the ERGIC1 deletion group or the group treated with an ERGIC1 regulator with the normal control group.

[0227] Example 7: Distribution of molecules in various intracellular organelles

[0228] In this example, a Fraction experiment was used to verify the distribution of molecules in various cell organelles under different conditions by comparing the ERGIC1 deletion group or the group treated with an ERGIC1 regulator with the normal control group.

[0229] Example 8: Verification of the function of ERGIC1 modulators at the protein level in regulating TLR-mediated immune responses and inflammation

[0230] In this example, using an experimental method similar to that in Example 2, the protein level verification of the function of the ERGIC1 regulator in regulating TLR-mediated immune responses and inflammation was carried out by comparing the group treated with the ERGIC1 regulator with the normal control group.

[0231] Example 9: Verification of the function of ERGIC1 modulators at the mRNA level in regulating TLR-mediated immune responses and inflammation

[0232] In this example, using an experimental method similar to that in Example 3, the mRNA level verification of the function of the ERGIC1 regulator in regulating TLR-mediated immune responses and inflammation was carried out by comparing the group treated with the ERGIC1 regulator with the normal control group.

[0233] Example 10: Regulation of the interaction between TLR and molecular chaperones by ERGIC1 modulators

[0234] In this example, using an experimental method similar to that in Example 4, the function of the ERGIC1 regulator in regulating the interaction between TLR and molecular chaperones was verified by comparing the group treated with the ERGIC1 regulator with the normal control group.

[0235] Example 11: Verification of the regulation of immune responses and inflammation during virus infection by ERGIC1 modulators

[0236] In this example, using an experimental method similar to that in Example 5, the function of the ERGIC1 regulator in regulating the immune response and the process of inflammation during virus infection was verified by comparing the group treated with the ERGIC1 regulator with the normal control group.

[0237] All documents mentioned in this invention are cited herein by reference as if each individual document was cited by reference. In addition, it should be understood that after reading the above teachings of this invention, those skilled in the art can make various changes or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

Claims

1. A use of an ERGIC1 (ER-Golgi intermediate compartment protein 1) regulator, characterized in that: Used to prepare a composition or preparation for regulating the immune response and / or inflammatory response level of a subject in need.

2. The use according to claim 1, characterized in that The immune response and / or inflammatory response of the target subject to be regulated includes: (a) promoting an immune response and / or inflammatory response in a subject in need thereof; and / or (b) suppressing the immune response and / or inflammatory response of a subject in need thereof.

3. The use according to claim 1, characterized in that The immune response and / or inflammatory response of the target subject to be regulated includes: (a) upregulating (or increasing) the transcription and / or protein level of proinflammatory cytokines (preferably, TNF-α); or downregulating (or decreasing) the transcription and / or protein level of proinflammatory cytokines; (b) upregulating (or increasing) the transcription and / or protein level of interferon (IFN) (preferably IFN-β); or downregulating (or decreasing) the transcription and / or protein level of interferon; (c) upregulating (or increasing) the transcription and / or protein level of interleukin (IL) (preferably IL-1β); or downregulating (or decreasing) the transcription and / or protein level of interleukin; (d) upregulating (or increasing) the transcription and / or protein level of an interferon-stimulated gene (ISG); or downregulating (or decreasing) the transcription and / or protein level of an interferon-stimulated gene; and / or (e) Upregulating (or increasing) the transcription and / or protein level of an inflammatory factor regulatory factor; or downregulating (or decreasing) the transcription and / or protein level of an inflammatory factor regulatory factor.

4. An ERGIC1 regulator, characterized in that The ERGIC1 regulator is selected from the following group: i) an active ingredient (ERGIC1 inhibitor or antagonist) that targets and inhibits ERGIC1 and is selected from the group consisting of a small molecule compound, miRNA, antisense nucleic acid, non-coding RNA, antibody, gene editing agent, or a combination thereof; ii) an active ingredient (ERGIC1 agonist or promoter) targeting and stimulating ERGIC1 selected from the following group: small molecule compounds, miRNA, antisense nucleic acid, non-coding RNA, antibodies, gene editing agents, or a combination thereof.

5. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: (Z1) the ERGIC1 modulator as described in claim 4; and (Z2) a pharmaceutically acceptable carrier or excipient.

6. The pharmaceutical composition according to claim 5, characterized in that The pharmaceutical composition further comprises: (a) TLR (Toll-like receptor) modulators; and / or (b) TLR ligand modulator; and / or (c) Promoters targeting ERGIC1 regulators.

7. A method for regulating the intensity of immune response and / or inflammatory response of a desired subject, characterized in that: The method comprises the step of administering an effective amount of the ERGIC1 modulator according to claim 4 and / or the pharmaceutical composition according to claim 5 or 6 to a subject in need thereof.

8. A method for regulating TLR (Toll-like receptor) function, characterized in that: The method comprises the step of administering an effective amount of the ERGIC1 modulator according to claim 4 and / or the pharmaceutical composition according to claim 5 or 6 to a subject in need thereof.

9. The method according to claim 8, characterized in that The TLR includes: TLR receptor family protein members that recognize nucleic acid molecules and TLR receptor family protein members that recognize non-nucleic acid molecules.

10. A kit, characterized in that: The kit comprises: (Z1) a first container, and an ERGIC1 modulator placed in the first container.

Images