Method for rapidly identifying male and female plants of salix tamariski based on specific DNA (deoxyribonucleic acid) molecular marker

Abstract

The invention provides a male specific DNA (deoxyribonucleic acid) molecular marker for identifying sex of salix tamariski and a detection primer of the male specific DNA molecular marker. According to the invention, the salix tamariski is identified as a male alien ligand (XX / XY) by utilizing a high-quality haplotype genome and re-sequencing data of the salix tamariski and using methods such as CQ and Fst, the sex chromosome of the salix tamariski is positioned in the No.15, the Y sex linkage region is 5.83-7.16 Mb, and four Y specific gene sequences are finally identified as the male specific DNA molecular marker of the salix tamariski through blastp comparative analysis. Primers are designed for the male specific DNA molecular marker, and PCR amplification is carried out, so that the male and female plants of the salix tamariski can be rapidly identified. The method can be used for rapidly identifying male and female plants of the salix triangularis in the seedling stage, saves cost for screening target sex in the breeding period, provides convenience, and has wide application prospects in production practice of sex identification of salix.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology, bioinformatics and molecular breeding, and particularly relates to a DNA molecular marker of male Salix triandra and a method for rapid identification of male and female plants of Salix triandra. Technical Background

[0002] Salix triandra is a dioecious shrub or tree of the Salicaceae family. It is native to West Asia, Central Asia and Europe and is now widely distributed from Japan to Western Europe. Salix triandra has characteristics such as high reproductive efficiency and easy cultivation and is widely used, for example, it is widely planted in the United States where it is not native. Salix triandra is one of the important parent tree species in the breeding fields of the genus Salix in Europe, China, the United States and other places. In recent years, hybrid varieties such as Salix purpurea×Salix triandra×Salix viminalis, Salix triandra×Salix dasyclados, and Salix triandra×Salix viminalis with Salix triandra as the parent have been successively obtained. Sweden has even used Salix triandra as a parent to cultivate fast-growing bioenergy willows. To better realize its production value, targetedly adjust the male-female ratio, identify the genotypes of hybrid varieties, etc., sex-specific molecular markers are particularly important. At present, researchers generally use three methods to identify the sex of willows. First, observe and dissect the reproductive organs. Second, detect isozymes of seeds or plants. Third, before the reproductive organs mature, use techniques such as AFLP and RFLP to develop molecular markers to achieve the purpose of early identification of male and female plants.

[0003] However, there are very few reports on the methods for sex identification of Salix triandra. Therefore, it is of great significance to invent a method that can quickly and accurately identify the sex of Salix triandra in Salix triandra. Summary of the Invention

[0004] The present invention identifies the sex of Salix triandra at the molecular level. On the basis of genome assembly, the male-specific region of Salix triandra is determined, and male-specific DNA molecular markers and primers are developed according to the male-specific sequences for efficient, stable and rapid identification of male and female plants of Salix triandra.

[0005] The purpose of the present invention is to discover the male-specific sequences of Salix triandra and develop corresponding molecular markers and detection primers for rapid, accurate and efficient identification of the sex of Salix triandra, which is beneficial to the selection of the target sex at the seedling stage and can also provide sequence information for the genotype identification of the offspring hybridized with Salix triandra as the parent.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] Twenty female and nineteen male individuals of Salix triandra were resequenced. Using the assembled haploid genome sequence of male Salix triandra as a reference, the method of chromosome quotient (CQ) was used to identify Salix triandra as male heterogametic, and the sex chromosomes were mapped to 15X and 15Y. According to the analysis of the population differentiation index F st among male individuals, the sex-linked region of chromosome 15Y was determined to be 5.83 - 7.16 Mb. The protein sequences of all genes on 15Y were aligned with the protein sequences of 15X by blastp, and the genes without alignment results in the sex-linked region of 15Y were selected as male-specific genes of Salix triandra, and the nucleotide sequences corresponding to these genes were male-specific DNA sequences. Finally, the male-specific genes were determined to be Satri15bG0039800, Satri15bG0039500, Satri15bG0039900, and Satri15bG0040000 respectively, and the names of male-specific DNA molecular markers were: 1-Satri15bG0039800, 2-Satri15bG0039500, 3-Satri15bG0039900, 4-Satri15bG0040000, and their nucleotide sequences were shown as SEQ ID NO.1 - 4 respectively.

[0008] The present invention provides a male-specific sequence molecular marker of Salix triandra, and its nucleotide sequence is shown as any one of SEQ ID NO.1 - 4.

[0009] The present invention further provides the application of the said molecular marker in identifying male and female plants of Salix triandra.

[0010] Specifically, the genomic DNA of the plant to be tested is amplified by PCR to determine whether the said molecular marker exists, or nucleic acid hybridization of the genomic DNA of the plant to be tested with a probe is used to determine whether the said molecular marker exists, or the genomic DNA of the plant to be tested is sequenced to determine whether the said molecular marker exists. If the said molecular marker exists, it is a male plant, otherwise it is a female plant.

[0011] The present invention correspondingly provides specific PCR primers for identifying male and female plants of Salix triandra based on the said molecular marker.

[0012] Preferably, it is any one of the following 4 pairs of primers: the forward primer is as shown in SEQ ID NO.5, and the reverse primer is as shown in SEQ ID NO.6;

[0013] the forward primer is as shown in SEQ ID NO.7, and the reverse primer is as shown in SEQ ID NO.8;

[0014] the forward primer is as shown in SEQ ID NO.9, and the reverse primer is as shown in SEQ ID NO.10;

[0015] The forward primer is as shown in SEQ ID NO.11, and the reverse primer is as shown in SEQ ID NO.12.

[0016] The present invention particularly provides a method for identifying male and female plants of Salix triandra, which is characterized in that specific PCR primers for identifying male and female plants of Salix triandra based on the above-mentioned molecular markers are used to perform PCR amplification on the genomic template of the plant to be tested. If there are corresponding bands in the amplification product, it indicates that the sample is male; if the corresponding bands are not obtained, it indicates that the sample is female.

[0017] Preferably, the PCR primer is any one of the following 4 pairs of primers:

[0018] The forward primer is as shown in SEQ ID NO.5, and the reverse primer is as shown in SEQ ID NO.6;

[0019] The forward primer is as shown in SEQ ID NO.7, and the reverse primer is as shown in SEQ ID NO.8;

[0020] The forward primer is as shown in SEQ ID NO.9, and the reverse primer is as shown in SEQ ID NO.10;

[0021] The forward primer is as shown in SEQ ID NO.11, and the reverse primer is as shown in SEQ ID NO.12

[0022] Specifically, the PCR amplification system adopted is as follows:

[0023]

[0024]

[0025] The PCR amplification conditions are as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 sec, annealing at 68°C for 15 sec, with 35 cycles; extension at 72°C for 5 min.

[0026] Specifically, when the 4 pairs of primers are amplified respectively, if the corresponding specific amplification bands are 256 bp, 264 bp, 256 bp and 264 bp respectively, it indicates that the sample is male; if the corresponding bands are not obtained, it indicates that the sample is female.

[0027] In the specific implementation manner, the PCR amplification product is detected by agarose gel electrophoresis.

[0028] The advantages of the present invention are as follows: By screening specific DNA sequences linked to the gender of Salix triandra, 4 male-specific DNA molecular markers of Salix triandra are obtained. Primers for detecting these molecular markers are designed, and gender identification experiments of Salix triandra are carried out, verifying the reliability of the developed molecular markers and primers. The method provided by the present invention for identifying the gender of Salix triandra is accurate, simple to operate, and highly accurate, effectively overcoming the drawback that it is difficult to distinguish male and female plants during the breeding period and non-flowering period of the plants. By using the method of the present invention, the target gender can be screened during the breeding period, which can save production and management costs and has broad application prospects in breeding production practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is a schematic diagram for identifying gender-specific sequences in Salix triandra in Example 1, where (a) is the CQ result diagram, and (b) is the F st result diagram.

[0030] Figure 2 It is a diagram of male and female inflorescences of Salix triandra samples collected in Example 2, where (a) is the male inflorescence diagram and (b) is the female inflorescence diagram.

[0031] Figure 3 It is a result diagram for identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 1-Satri15bG0039800 in Example 2.

[0032] Figure 4 It is a result diagram for identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 2-Satri15bG0039500 in Example 2.

[0033] Figure 5 It is a result diagram for identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 3-Satri15bG0039900 in Example 2.

[0034] Figure 6 It is a result diagram for identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 4-Satri15bG0040000 in Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0035] The following examples are used to illustrate the research discovery process and results of the male-specific sequence DNA molecular markers and detection primers of the present invention for Salix triandra, but are not used to limit the scope of the present invention. Without departing from the spirit and essence of the invention, any modification or replacement of the invention method, steps, or conditions belongs to the scope of the present invention. If not specifically specified, the technical means used in the examples are conventional means well-known to those skilled in the art, and the reagents or materials are from commercial or public channels.

[0036] Example 1: Genomic sequencing analysis of Salix triandra, development of male-specific sequence DNA molecular markers and primer design

[0037] First, software such as fastp, hifisam, and Juicer were used to filter the sequencing data and assemble the haplotypes of the Salix triandra genome. For example, hifisam was used to assemble the genome based on Hifi data, fastp was used to filter Hi-C reads, Juicer was used to align the filtered reads to the assembled genome, and 3d-DNA was used to mount the chromosomes. Using the assembled haplotype genome sequence as a reference, according to the literature reports, 20 female and 19 male individuals of Salix triandra were selected for resequencing to ensure the reliability and repeatability of the data. The data was analyzed, and the CQ-calculate.pl software was used to map the reads of female and male individuals into the haplotype genome respectively to calculate the CQ value of each 50-kb non-overlapping window. The sex determination system and chromosomes of Salix triandra were identified based on the DNA coverage in the two sexes. The analysis showed that Salix triandra is male heterogametic (XX / XY), and the sex chromosome is located on chromosome 15. The window with a CQ value close to 2 is 15X, while the window with a CQ value close to 0 is 15Y.

[0038] Based on the resequencing data and the genome, calculate the F st value between female and male individuals, and use changepoint to detect the F st differences in different regions on 15Y. Regions with significantly higher Fst are considered candidate sex-linked regions. The analysis determined that the sex-linked region of chromosome 15Y in Salix triandra is 5.83 - 7.16 Mb. As Figure 1 shown, a schematic diagram for identifying sex-specific sequences in Salix triandra is presented, where (a) is the CQ result diagram, showing that male plants of Salix triandra are heterogametic, that is, the 15XY system, and (b) is the F st result diagram, showing that the F st value in the Y sex-linked region is significantly higher than the remaining regions of this chromosome.

[0039] Subsequently, the protein sequences of 15Y were subjected to blastp alignment analysis with the protein sequences of 15X. Genes without alignment results in the Y sex-linked region were screened as male-specific genes of Salix triandra, which are Satri15bG0039800, Satri15bG0039500, Satri15bG0039900, and Satri15bG0040000 respectively. Their nucleotide sequences are shown as SEQ ID NO: 1 to 4 respectively, which are male-specific DNA sequences and can be used as male-specific sequence DNA molecular markers for Salix triandra.

[0040] SEQ ID NO.1:

[0041] TTAGTATTTGGGGTTGTGCACGACCTTCTTGTTGAAGATTGCTGTATTCTTGCAAGTGCA

[0042] CAAACATTTGTTTAACTATCATGTTGCATACACTATTGATAAACAAATTGCAGAATCATGT

[0043] ACCTCTCTAATAAGTAGTTCAAAGCCCATGTCAAGCATTCTACCAGCTTCATCCAAGACG

[0044] ATAGATGAAATACTAGAAAGGGAAGTGTTTCCCTGCTGTAAATGATCAATGAATCTTGTA

[0045] GGAGTAGCAACAATTCCATCTACTCCTGCTCGTAACTCAGATCTCTATCACAGGATGCAA

[0046] CATCAAAAATAAAACAAACAAGTATTAGTAAACTCAATGAAAACGATATATCACCATAAT

[0047] ATTACAAGAGCACAAGGATGCAAGAGACATTCTCACTTGCTGGCAAAGAAAATTAAAC

[0048] AGTGTAAAAGAGTACAGACATGCATTGCTAAGAATTCAATTCTCATAAGGATACAGAATT

[0049] TCAGTTAAATTCCAAATACATGACAATTTTGCTTTATTCTATTTGACCACATGCAGACAAT

[0050] TTGAAGTGTAACGTCACATACACATGAATCCATAGTTTCTTTTCTTTCTTCACACCTAGAA

[0051] ACTACAATCAAACATTAGAAAGCCAAGTAATCACAACATTACTTACCTGGTCAGCAATAT

[0052] TTGTTCCACCCACCGCGATGGCAGTTCTGAAGGACTCGAGATCTACTGATTTGACTGAA

[0053] AGATGAGACAAAGTAACTCAAGGCTGGTGCTTAAGAAGTATGCCAATAATTTGTTTTTCC

[0054] TCTTCTATAACGACTTCTAACACCGATCCCTGTATCATAGGAATGGTAAATGCTGGAGTTT

[0055] TTCCACTAAAGGTTTCAGCACAACCCAACAAATATCTTCCACTAAGCGCAACTGTCATTG

[0056] CCTGAGCCTGAATCAATGTCGGCCACGTATATTCATGATAAGCAATAGCCTTCATGATACT

[0057] TCGATGTTAACACTAACATATTCACCAGATAAAGAAATAAAATATCACTATACATAGCAAT

[0058] TTCAAAACATAATTGCTACAAAAAAACTAAAGAGACTGAATTTAACTTAGCTTCAAATAA

[0059] TTCAAGTGCAGGTGCAGGACGTGAACCCGCAGCAACACTAACATCTATTTGGAGAGGAGAACGAATTTCTTCAATCTGCAT。

[0060] SEQ ID NO.2:

[0061] AAAAAAATGATTTCTATTATCAGAAGTTAGCTAGAACATAATTAAAGTTATCCAAGTAAC

[0062] AATGTATGAAGAACTCATTACCAGAATGGAGATTAACAAAGACTAGACCCCACATCTTTT

[0063] GTTTTTATTTTTTTCAATTCAAGGAGAGAAAAAATTGTTATCATTTATTCTTGTACTTTTTT

[0064] GTTAGAGATGACAATGGATTAGATTAAACAAAATAAGTCACGCCATTATAAATCGATAGT

[0065] TTTTAACGGAATCTCAATTATAATAAGTATAGAAAAAAAAATATTTGAATTCTAAAGGCTT

[0066] GATTAGAGTTTTTATGATTTCTAATTTAGTTCCTAGAGTGGCAAAAAGGGCTAGCTGATA

[0067] GACAACAACATCTCAATCATAGTGCAAGTACAATAACTATACAATGAAGAATCAATTCTT

[0068] ACTTTTATGAATTCAACTCCATTAGTATTTGGGGTTGTGCACGACCTTCTTGTTGAAGATT

[0069] GCTGTAATTCTTGCAAGTGCACAAACATTTGTTTAACTATCATGTTGCATACACTATTGAT

[0070] CAACAAATTGCAGAATCATGTACCTCTCTAATAAGTAGTTCAAAGCCCATGTCAAGCATT

[0071] CTACCAGCTTCATCCAAGACGATAAATGAAATTCTAGAAAGGGAAGTGTTTCCCTGATGT

[0072] AAATGATCAATGAATCTTGTAGGAGTAGCAACAATTACATCTACTCCTGCTCGTAACTCA

[0073] GATCTCTATCACAGGATGCAACATCAAAAATAAAACAAACAAGTATTAGTAAACTCAATG

[0074] AAAACGATATATCACCATAATATTACAAGAGCACAAGGATGCAAGAGACATTCTCACTTG

[0075] CTGGCAAAGAAAATTAAACAGTGTAAAAGAGTACAGACATGCATTGCTAAGAATTCAAT

[0076] TCTCATAAGGATACAGAATTTCAGTTAAATTCCAAATACATGACAATTTTGCTTTATTCTA

[0077] CTTGACCACATGCAGACAATTTGAAGTGTAACGTCACATACACATGAATCCATAGTTTCT

[0078] TTTCTTTCTTCACACCTAGAAACTACAATCAAGCATTAGAAAGCCAAGTAATCACAACAA

[0079] TACTTACCTGGTCAGCAATATTTGTTCCGCCCACCGCGATGGCAGTTCTGAAGGACTCGA

[0080] GATCTACTGATTTGACTGAAAGATGAGACAAAGTAACTAAAGGCTGGTGCTTAAAAAGT

[0081] ATGCCAATAATTTGTTTTTCCTCTTCTATAACGACTTCTAACACCGATCCCTGTATCATAGG

[0082] AATGGTAAATGCTGGAGTTTTTCCACTAAAGGTTTCAGCACAACCCAACAAATATCTTCC

[0083] ACTAAGCGCAACTGTCATTGCCTGAGCCTGAATCGATGTCGGCCACGTATATTCATGATA

[0084] AGCAATAGCCTTCATGATACTTCGATGTTAACACTAACATATTCACCAGATAAAGAAATA

[0085] AAATATCACTATACATAGCAATTTCAAAACATAATTGCTACAAAAAAACTAAAGAGACTG

[0086] AATTTAACTTAGCTTCAAATAATTCAAGTGCAGGTGCAGGACGTGAACCCGCAGCAACA

[0087] CTAACATCTATTTGGAGAGGAGAACGAATTTCTTCAATCTGCATTTATTATCAAAATTTTA

[0088] ATCCTTGCTAAATAATTATTTTAAATAATAAATTCAATATCGTTTTCTTTTTCCTTTCCTTTT

[0089] TTATTTTGAGAACAGATTACTGATAAATGAAGCAATTTAGTACAATAATCATTTCAAATAT

[0090] AAAAACAGAAAAAACAAAATTGGAAAACTTGGAAAGGAAGTGAATCTAGTTGGGAGT

[0091] GAAGCGAAGGACGCAGTCGGATGGCATCCACCGAGGAAAGAAACATGTTTAGGAACGA

[0092] AGATAGTTCGCGCGACGGAGGCGGACGTCCGACGGGAGAGATAGTTGAATGGGGAGGA

[0093] AGAAGAAGTGGCGGAGGACGTGGAATTTGAAGAGGAATGGGAGAGTTTAGTGTCTTTT

[0094] AAAGGCGGTGAGTGAGTTCTGGGAGGAGTAACGGTGGTGGTTGAGCTTGAGTTTCCCA

[0095] GGCGAGGAGGATATACGACATCGTTTTTAGGAATGAAGGGAGAGTGCATCAGTGAAAGTTGAGATGAAAGTGGC。

[0096] SEQ ID NO.3:

[0097] CTAGCTGATAGACAACAACATCTCAATCATAGTGCAAGTACAATAATTGTACAATGAAGA

[0098] ATCGATTCTTACTTTTATGAATTCAACTCCATTAGTATTTGGGGTTGTGCACGACCTTCTT

[0099] GTTGAAGATTGCTGTATTCTTGCAAGTGCACAAACATTTGTTTAACTATCATGTTGCATAC

[0100] ACTATTGATAAACAAATTGCAGAATCATGTACCTCTCTAATAAGTAGTTCAAAGCCCATGT

[0101] CAAGCATTCTACCAGCTTCATCCAAGACGATAGATGAAATACTAGAAAGGGAAGTGTTT

[0102] CCCTGCTGTAAATGATCAATGAATCTTGTAGGAGTAGCAACAATTCCATCTACTCCTGCT

[0103] CGTAACTCAGATCTCTATCACAGGATGCAACATCAAAAATAAAACAAACAAGTATTAGTA

[0104] AACTCAATGAAAACGATATATCACCATAATATTACAAGAGCACAAGGATGCAAGAGACAT

[0105] TCTCACTTGCTGGCAAAGAAAATTAAACAGTGTAAAAGAGTACAGACATGCATTGCTAA

[0106] GAATTCAATTCTCATAAGGATACAGAATTTCAGTTAAATTCCAAATACATGACAATTTTGC

[0107] TTTATTCTATTTGACCACATGCAGACAATTTGAAGTGTAACGTCACATACACATGAATCCA

[0108] TAGTTTCTTTTCTTTCTTCACACCTAGAAACTACAATCAAACATTAGAAAGCCAAGTAAT

[0109] CACAACATTACTTACCTGGTCAGCAATATTTGTTCCACCCACCGCGATGGCAGTTCTGAA

[0110] GGACTCGAGATCTACTGATTTGACTGAAAGATGAGACAAAGTAACTCAAGGCTGGTGCT

[0111] TAAGAAGTATGCCAATAATTTGTTTTTCCTCTTCTATAACGACTTCTAACACCGATCCCTG

[0112] TATCATAGGAATGGTAAATGCTGGAGTTTTTCCACTAAAGGTTTCAGCACAACCCAACAA

[0113] ATATCTTCCACTAAGCGCAACTGTCATTGCCTGAGCCTGAATCAATGTCGGCCACGTATAT

[0114] TCATGATAAGCAATAGCCTTCATGATACTTCGATGTTAACACTAACATATTCACCAGATAA

[0115] AGAAATAAAATATCACTATACATAGCAATTTCAAAACATAATTGCTACAAAAAAACTAAA

[0116] GAGACTGAATTTAACTTAGCTTCAAATAATTCAAGTGCAGGTGCAGGACGTGAACCCGCAGCAACACTAACATCTATTTGGAGAGGAGAACGAATTTCTTCAATCTGCAT。

[0117] SEQ ID NO.4:

[0118] TTATGAATTCAACTCCATTAGTATTTGGGGTTGTGCACGACCTTCTTGTTGAAGATTGCTG

[0119] TAATTCTTGCAAGTGCACAAACATTTGTTTAACTATCATGTTGCATACACTATTGATCAAC

[0120] AAATTGCAGAATCATGTACCTCTCTAATAAGTAGTTCAAAGCCCATGTCAAGCATTCTAC

[0121] CAGCTTCATCCAAGACGATAAATGAAATTCTAGAAAGGGAAGTGTTTCCCTGCTGTAAAT

[0122] GATCAATGAATCTTGTAGGAGTAGCAACAATTACATCTACTCCTGCTCGTAACTCAGATC

[0123] TCTATCACAGGATGCAACATCAGAAATAAAACAAACAAGTATTAGTAAACTCAATGAAA

[0124] GACAATTTGAAGTGTAACGTCACATACACATGAATCCATAGTTTCTTTTCTTTCTTCACAC

[0125] CTAGAAACTACAATCAAACATTAGAAAGCCAAGTAATCACACCATTACTTACCTGGTCAG

[0126] CAATATTTGTTCAGCCCACCGCGATGGCAGTTCTGAAGGACTCGAGATCTACTGATTTGA

[0127] CTGAAAGATGAGACAAAGTAACTAAAGGCTGGTGCTTAAGAAGTATGCCAATAATTTGT

[0128] TTTTCCTCTTCTATAACGACTTCTAACACCGATCCCTGTATCATAGGAATGGTAAATGCTG

[0129] GAGTTTTTCCACTAAAGGTTTCAGCACAACCCAACAAATATCTTCCACTAAGCGCAACT

[0130] GTCATTGCCTGAGCCTGAATCGATGTCGGCCACGTATATTCATGATAAGCAATAGCCTTCA

[0131] TGATACTTCGATGTTAACACTAACATATTCACCAGATAAAGAAATAAAATATCACTATACA

[0132] TAGCAATTTCAAAACATAATTGCTACAAAAAAACTAAAGAGGCTGAATTTAACTTAGCTT

[0133] CAAATAATTCAAGTGCAGGTGCAGGACGTGAACCCGCAGCAACACTAACATCTATTTGGAGAGGAGAACGAATTTCTTCAATCTGCAT。

[0134] Example 2: Design of primers for detecting molecular markers

[0135] According to the nucleotide sequence of the male-specific DNA molecular marker obtained in Example 1, specific sequence primers were designed in the software Primer Premier 6.0 based on the DNA sequence of the gene. Among them, the primer length was set to 18 - 22 bp, the GC content was 45% - 55%, the Tm value was 50 ± 5 °C, the product length was 200 - 300 bp. The primers with the highest score were selected, and then the Primer Check plugin of TBtools v2.003 was used to detect the specificity of the primers. Finally, 4 pairs of specific primers SEQ ID NO.5 - 12 for identifying male and female plants of Salix triandra were developed, and the primer information is shown in Table 1.

[0136] Table 1 Molecular markers of male-specific sequences and primer sequences of Salix triandra

[0137]

[0138] Example 3: Identification of male and female plants of Salix triandra

[0139] 1. Extraction of genomic DNA from Salix triandra

[0140] According to Figure 2 the inflorescences shown, male and female plants of Salix triandra were determined. At the flowering stage, young leaves of 20 Salix triandra plants were collected, including 10 female plants and 10 male plants. The genomic DNA of the above samples was extracted using a plant DNA extraction kit, the DNA concentration was detected using a NanoDrop micro-spectrophotometer, and the DNA solution was diluted with sterile water into a template DNA solution with a concentration of 20 ng / μl for standby.

[0141] 2. PCR amplification reaction

[0142] The following PCR amplification system was adopted:

[0143] Reagent (50 μl system) Dosage Genomic DNA 2 μl Primer F (10 μM) 2.5 μl Primer R (10 μM) 2.5 μl 2×Taq Master Mix 25 μl <![CDATA[ddH 2 O]]> 18 μl

[0144] The PCR amplification conditions are as follows: set for pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 sec; annealing at 68°C for 15 sec; extension at 72°C for 5 min, and the number of cycles for the second and third reactions is set to 35 times.

[0145] Using the previously extracted DNA as a template, respectively, amplify using the 4 pairs of specific primers designed in Example 2 according to the above PCR amplification system and procedure, and detect the obtained PCR products using 1.2% agarose gel electrophoresis. The electrophoresis results are respectively as Figures 3 - 6 shown. That is Figure 3 It is the result diagram of identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 1 - Satri15bG0039800 in Example 2. Figure 4 It is the result diagram of identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 2 - Satri15bG0039500 in Example 2. Figure 5 It is the result diagram of identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 3 - Satri15bG0039900 in Example 2. Figure 6 It is the result diagram of identifying 10 male and 10 female samples of known Salix triandra gender using the primer pair of molecular marker 4 - Satri15bG0040000 in Example 2.

[0146] The results show that the 4 developed molecular markers all produced a band that met the target band size in 10 male Salix triandra samples, and no specific band was produced in 10 female individuals. This result indicates that the result of identifying male and female plants by this method is consistent with the inflorescence identification method. This detection method is reliable and the accuracy rate can reach 100%.

[0147] The above is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope covered by the present invention.

Claims

1. A male-specific sequence molecular marker of Salix trifoliata, the nucleotide sequence of which is shown in any one of SEQ ID NO.1-4.

2. Use of the molecular marker as described in claim 1 in identifying male and female plants of Salix trifoliata.

3. The use as claimed in claim 2, wherein the presence of the molecular marker is determined by amplifying the genomic DNA of the plant to be tested by PCR, or by nucleic acid hybridization of the genomic DNA of the plant to be tested with a probe to determine the presence of the molecular marker, or by sequencing the genomic DNA of the plant to be tested to determine the presence of the molecular marker. If the molecular marker is present, the plant is a male, otherwise it is a female.

4. Specific PCR primers for identifying male and female plants of Salix trifoliata based on the molecular markers described in claim 1.

5. The PCR primer according to claim 4, characterized in that It is any one of the following four pairs of primers: the forward primer is shown in SEQ ID NO.5, and the reverse primer is shown in SEQ ID NO.6; The forward primer is shown in SEQ ID NO.7, and the reverse primer is shown in SEQ ID NO.8; The forward primer is shown in SEQ ID NO.9, and the reverse primer is shown in SEQ ID NO.10; The forward primer is shown as SEQ ID NO.11, and the reverse primer is shown as SEQ ID NO.

12.

6. A method for identifying male and female plants of Salix trifoliata, characterized in that: The method uses specific PCR primers for identifying male and female plants of Salix trifoliata based on the molecular markers described in claim 1 to perform PCR amplification on the genome template of the plant to be tested. If there are corresponding bands in the amplified product, it indicates that the sample is male. If no corresponding bands are obtained, it indicates that the sample is female.

7. The method according to claim 6, characterized in that The PCR primer is any one of the following 4 pairs of primers: The forward primer is shown in SEQ ID NO.5, and the reverse primer is shown in SEQ ID NO.6; The forward primer is shown in SEQ ID NO.7, and the reverse primer is shown in SEQ ID NO.8; The forward primer is shown in SEQ ID NO.9, and the reverse primer is shown in SEQ ID NO.10; The forward primer is shown as SEQ ID NO.11, and the reverse primer is shown as SEQ ID NO.

12.

8. The method according to claim 7, characterized in that The PCR amplification system adopted is as follows: ； The PCR amplification conditions were as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 sec, annealing at 68°C for 15 sec, and 35 cycles; and extension at 72°C for 5 min.

9. The method according to claim 7, characterized in that When the four pairs of primers are used for amplification respectively, if corresponding specific bands of 256 bp, 264 bp, 256 bp and 264 bp are obtained, it indicates that the sample is male; if no corresponding bands are obtained, it indicates that the sample is female.

10. The method according to claim 7, characterized in that The PCR amplification products were detected by agarose gel electrophoresis.

Images