Double-blocking siRNA (small interfering Ribonucleic Acid) pharmaceutical composition for inhibiting autoimmune diseases

Abstract

The invention provides a double-blocking siRNA (small interfering ribonucleic acid) pharmaceutical composition for inhibiting autoimmune diseases. The siRNA pharmaceutical composition comprises siRNA molecules and siRNA molecules, wherein the siRNA molecules can be combined to mRNA (messenger ribonucleic acid) for coding TNF-alpha (tumor necrosis factor-alpha) and inhibit expression of the mRNA, and the siRNA molecules can be combined to mRNA for coding COX-2 (tumor necrosis factor-alpha) and inhibit expression of the mRNA. The siRNA pharmaceutical composition provided by the invention can simultaneously inhibit expression of two important target genes TNF-alpha and COX-2 which are closely related to occurrence and development of autoimmune diseases, inhibit molecular activity of TNF-alpha and COX-2 in inflammation, and inhibit occurrence and development of autoimmune diseases such as ulcerative colitis, Crohn's disease, psoriasis, Alzheimer's disease and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology research and development and biomedicine development, and specifically relates to a double-blocking siRNA pharmaceutical composition for inhibiting autoimmune diseases. Background Art

[0002] Autoimmunity refers to the phenomenon that the body's immune system responds to its own antigens, producing autoantibodies and / or autosensitized lymphocytes. Autoimmune diseases are a type of inflammatory immune diseases characterized by local or systemic abnormal inflammatory immune responses, mainly including rheumatoid arthritis (RA), ankylosing spondylitis (AS), juvenile idiopathic arthritis (JIA), Crohn's disease (CD), ulcerative colitis (UC), non-radiographic axial spondyloarthritis (nr-AxSpA), psoriasis, psoriatic arthritis (PsA), multiple sclerosis (MS), systemic lupus erythematosus (SLE), lupus nephritis (LN), bronchial asthma (Asthma), etc. In addition, recent studies have shown that Alzheimer's disease, a type of neurodegenerative disease, may also be an autoimmune disease.

[0003] Data show that autoimmune diseases have become the third major disease after cardiovascular diseases and tumors. Due to different pathogenesis, they manifest as more than 100 different types of syndrome characteristics and clinical manifestations, and the proportion of affected people is as high as 3% to 5% of the population. Moreover, most autoimmune diseases are difficult to completely cure, and some of them develop into severe and dangerous diseases. Once they are sick, they cannot be completely cured. Patients need to take medication for a long time or even for life, which seriously affects the quality of life of patients and even threatens their lives. Therefore, patients with autoimmune diseases need a lot of treatment, and clinical needs are far from being met.

[0004] In the past two decades, no new biological mechanisms have been discovered in the field of autoimmune diseases. Early treatments for immune diseases mainly used small molecule anti-inflammatory drugs, antibody drugs, and immunosuppression, but the treatment effects were usually poor or the patients could not tolerate them. This situation has since improved, but the current autoimmune disease treatment drugs on the market (including large molecule antibody drugs and small molecule JAK inhibitors, etc.) are developed based on old biological theories and are affected by target selection, resulting in congenital problems such as severe toxic side effects and low patient response rates. Patients with autoimmune diseases are in urgent need of immunosuppressants with safer and more efficient mechanisms of action. Summary of the invention

[0005] In a first aspect, the present invention provides a dual-blocking siRNA pharmaceutical composition for inhibiting autoimmune diseases, the siRNA pharmaceutical composition comprising an siRNA molecule capable of binding to mRNA encoding TNF-α and inhibiting its expression and an siRNA molecule capable of binding to mRNA encoding COX-2 and inhibiting its expression.

[0006] Specifically, the sequence of the siRNA molecule capable of binding to the mRNA encoding TNF-α and inhibiting its expression is selected from any one or more of Tables 1 and 2. Preferably, the sequence of the siRNA molecule is selected from:

[0007] (1) A siRNA molecule targeting both human and mouse TNF-α genes, SEQ ID NO.1:

[0008] Sense strand: 5'-GUGACAAGCCUGUAGCCCAdTdT-3'

[0009] Antisense strand: 5′-UGGGCUACAGGCUUGUCACdTdT-3′;

[0010] (2) A siRNA molecule targeting human TNF-α gene, SEQ ID NO.2:

[0011] Sense strand: 5'-CUGGUAUGAGCCCAUCUAUCUGGGA-3'

[0012] Antisense strand: 5′-UCCCAGAUAGAUGGGCUCAUACCAG-3′;

[0013] (3) A siRNA molecule targeting mouse TNF-α gene, SEQ ID NO.3:

[0014] Justice Chain:

[0015] Antisense strand:

[0016] The underlined italic letters represent bases that are inconsistent with the human sequence and form mismatches.

[0017] (4) It can also be an asymmetric siRNA molecule targeting both human and mouse TNF-α genes:

[0018] Sense strand: 5'-GUGACAAGCCUGUAGCCCA-3'

[0019] Antisense strand: 5′-UGGGCUACAGGCUUGUCACUC-3′;

[0020] (5) It can also be a siRNA molecule targeting both human and rat TNF-α genes:

[0021] Sense strand: 5'-GGAAAGGACACCAUGAGCAdTdT-3'

[0022] Antisense strand: 5′-UGCUCAUGGUGUCCUUUCCdTdT-3′;

[0023] In the present invention, the siRNA molecule capable of binding to mRNA encoding TNF-α and inhibiting its expression may be a modified sequence, wherein the modification includes one or more of methoxy modification, fluoro modification, and thio modification.

[0024] Specifically, the sequence of the siRNA molecule capable of binding to the mRNA encoding COX-2 and inhibiting its expression is:

[0025] Sense strand: 5'-GGUCUGGUGCCUGGUCUGAUGAUGU-3'

[0026] Antisense strand: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′.

[0027] This siRNA molecule inhibitor has been used to treat diseases such as hypertrophic scars and non-melanoma skin cancer. In the present invention, in vivo and in vitro experiments have confirmed that this siRNA can effectively inhibit the development of autoimmune diseases such as ulcerative colitis and psoriasis, and it can be used in combination with siRNA molecules targeting other targets to form a dual-target siRNA composition, which has a significant synergistic effect.

[0028] According to one embodiment of the present invention, the siRNA pharmaceutical composition comprises siRNA molecules capable of binding to mRNA encoding TNF-α and inhibiting its expression and siRNA molecules capable of binding to mRNA encoding COX-2 and inhibiting its expression in a molar ratio of 1:2-2:1.

[0029] According to one embodiment of the present invention, the above-mentioned autoimmune diseases include one or more of ulcerative colitis, Crohn's disease, psoriasis, and Alzheimer's disease.

[0030] The second aspect of the present invention provides a siRNA pharmaceutical preparation, which comprises the above-mentioned siRNA molecule or the above-mentioned siRNA pharmaceutical composition, and a pharmaceutically acceptable carrier.

[0031] Specifically, the pharmaceutically acceptable carrier includes a histidine-lysine branched polypeptide polymer. The carrier carries a positive charge. When the siRNA and the carrier are mixed in a specific ratio, the two are self-assembled to form nanoparticles through electrostatic attraction, hydrogen bonding, etc., thereby achieving (1) protecting the siRNA from enzymatic degradation; (2) achieving target organ or target tissue delivery through a specific mechanism; (3) promoting the entry of nanoparticles into cells through endocytosis; (4) promoting the release of nanoparticles from endosomes through the proton sponge effect, etc.

[0032] Preferably, the above-mentioned histidine-lysine branched polypeptide polymer may be H3K4b or H3K(+H)4b.

[0033] According to one embodiment of the present invention, the siRNA pharmaceutical composition and the histidine-lysine polypeptide nano-introduction carrier H3K4b are mixed at a N / P mass ratio of 1:0.8-1:6 to self-assemble into a nano-drug.

[0034] Preferably, the above-mentioned siRNA pharmaceutical preparation is a nanopharmaceutical preparation, and / or, the above-mentioned siRNA pharmaceutical preparation is a lyophilized powder preparation.

[0035] The third aspect of the present invention provides a method for preparing the above-mentioned siRNA pharmaceutical preparation, which comprises mixing the siRNA pharmaceutical composition and the pharmaceutically acceptable carrier by vortex oscillation or microfluidics technology to form the siRNA pharmaceutical preparation.

[0036] The fourth aspect of the present invention provides a molecular conjugated drug, which is formed by coupling the above-mentioned siRNA molecule or the above-mentioned siRNA drug composition with a targeting ligand through a linker. When the conjugated drug enters the cell, it is uncoupled in the cytoplasm to release the siRNA molecule to exert nucleic acid interference, inhibit target gene expression, and improve the targeting of the siRNA drug composition in the treatment of autoimmune diseases such as ulcerative colitis or neurodegenerative diseases such as Alzheimer's disease.

[0037] Specifically, the above-mentioned targeting ligands may include proteins, polypeptides, antibodies, small molecule compounds, sugars, lipids and other polymer molecules with targeting functions.

[0038] Preferably, the targeting ligand may be a polypeptide consisting of less than 50 amino acids in length, and / or a polypeptide consisting of 15-30 amino acids.

[0039] The implementation of the present invention has at least the following beneficial effects:

[0040] The present invention adopts nucleic acid interference technology and uses siRNA molecules that completely match the mRNA transcribed from the target gene to simultaneously inhibit the expression of TNF-α and COX-2, two important target genes closely related to the occurrence and development of autoimmune diseases, inhibit the molecular activity of TNF-α and COX-2 in inflammation, and inhibit the occurrence and development of autoimmune diseases such as ulcerative colitis and psoriasis.

[0041] Compared with the prior art, the present invention has at least the following beneficial effects:

[0042] The present invention adopts nucleic acid interference technology and uses siRNA molecules that completely match the mRNA transcribed from the target gene to simultaneously inhibit the expression of TNF-α and COX-2, two important target genes closely related to the occurrence and development of autoimmune diseases, inhibit the molecular activity of TNF-α and COX-2 in inflammation, and inhibit the occurrence and development of autoimmune diseases such as ulcerative colitis, Crohn's disease, psoriasis, and Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 .Screen the inhibitory effects of different siRNA molecular sequences designed for TNF-α on the target gene in MCF-7 cells. After being treated with TNF-α siRNA of different sequences, the expression level of the target gene TNF-α in MCF-7 cells decreased to varying degrees.

[0044] Figure 2 .Screen the inhibitory effects of different siRNA molecular sequences designed for TNF-α on the target gene in HaCat cells. After being treated with TNF-α siRNA of different sequences, the expression level of the target gene TNF-α in HaCat cells decreased to varying degrees.

[0045] Figure 3 . Designed based on the principle of human-mouse homology, TNF-α siRNA#10 and TNF-α siRNA#6 were further screened.

[0046] Figure 4 .Inhibitory effects of candidate TNF-α siRNA and COX-2 siRNA sequences on target genes. It can be seen that after colon cancer cell Caco2 was treated with TNF-α siRNA and COX-2 siRNA, the expression level of target gene TNF-α decreased.

[0047] Figure 5 .Dose-effect curve of selected siRNA against TNF-α on target gene inhibition.

[0048] Figure 6 .The inhibitory effect of the pharmaceutical composition composed of TNF-α siRNA and COX-2 siRNA on proinflammatory cytokines. It can be seen that after treatment, the expression of proinflammatory cytokine IL-1β decreased significantly, and the inflammatory signal factor IL-8 also decreased significantly.

[0049] Figure 7 . The colon length change graph and animal activity score show that the therapeutic effects of the TNF-α and COX-2 siRNA combination (composition 1), COX-2 siRNA, TNF-α siRNA #10hm and TNF-α siRNA #6m are extremely different.

[0050] Figure 8 . Expression of inflammatory factors in the intestinal tract. It shows that the therapeutic effects of the TNF-α and COX-2 siRNA combination (composition 1), COX-2 siRNA, TNF-α siRNA #10hm and TNF-α siRNA #6m are extremely different.

[0051] Fig. 9 . Changes in colon length and pathological scores. The differences between the normal group, DSS-induced model group, negative control group and Composition 2 treatment group (mean ± standard deviation) are shown. In Figure C, arrows represent different pathological changes, including crypt abnormalities, inflammatory cell infiltration of the mucosal layer, epithelial cell shedding, submucosal edema or abscess cells.

[0052] Fig.10 . Changes in colon length and pathological scores. The differences between the normal group, the DSS-induced model group and the Composition 3 treatment group (mean ± standard deviation) are shown. In Figure C, arrows represent different pathological changes, including crypt abnormalities, inflammatory cells infiltrating the mucosal layer, epithelial cell shedding, submucosal edema or abscess cells. DETAILED DESCRIPTION

[0053] The present invention will be further described by the following non-limiting examples. It is well known to those skilled in the art that many modifications may be made to the present invention without departing from the spirit of the present invention, and such modifications also fall within the scope of the present invention.

[0054] The present invention adopts nucleic acid interference technology (RNAi) to design and develop active small interfering nucleotide (siRNA) molecules that inhibit a variety of autoimmune diseases. RNAi is a natural gene silencing technology. Double-stranded RNA is catalyzed by specific enzymes in cells to generate siRNA molecules. These siRNAs are combined with specific proteases to form RNA-induced silencing complexes (RISCs). One chain (sense chain) in the siRNA is separated from the complex, and the other RNA chain (antisense chain) remaining in the complex guides RISC to specifically bind to the target messenger RNA (mRNA) in the form of 100% base complementary pairing. The protease in the complex exerts degradation activity, degrades the target mRNA, and causes the target gene to be unable to express the corresponding protein, thereby achieving the effect of gene silencing (knockdown). The siRNA molecules obtained by chemical synthesis enter cells and can also exert an efficient gene expression inhibition effect. When some key targets for the occurrence and development of autoimmune diseases are selected as designed siRNA molecules, after the siRNA molecules are introduced into cells through a specific delivery system, the expression of the corresponding target genes can be inhibited, thereby inhibiting the occurrence and development of autoimmune diseases.

[0055] Tumor necrosis factor α (TNF-α) is a mediator of acute inflammatory response, mainly produced by macrophages, lymphocytes, dendritic cells and endothelial cells, and participates in the formation of some inflammatory and autoimmune diseases. It is overexpressed in the lamina propria and intestinal mucosa of patients with inflammatory bowel disease. Among the molecular targeted drugs for autoimmune diseases, TNF-α inhibitors targeting TNF-α are the most widely used. In 2002, the FDA approved the marketing of adalimumab (Humira), the world's first fully human TNF-α monoclonal antibody developed by AbbVie, for rheumatoid arthritis; in the following years, with significant clinical advantages, Humira was successively approved for the treatment of more than 10 autoimmune diseases such as psoriatic arthritis, ankylosing spondylitis, Crohn's disease, plaque psoriasis and juvenile idiopathic arthritis, with significant efficacy. However, the currently commonly used TNF-α inhibitors are limited in clinical application due to potential side effects, including injection site reactions (ISR), infusion reactions, neutropenia, infection, etc. Therefore, it is very important to develop new TNF-α inhibitors with less toxic side effects. RNAi technology provides a new path for the development of new TNF-α inhibitors.

[0056] Cyclooxygenase-2 (COX-2) is closely associated with autoimmune diseases, and the COX-2 inhibitor Celebrex has been approved for the treatment of symptoms of rheumatoid arthritis and osteoarthritis. It is well known that inflammation and overexpression of the COX-2 gene promote the development and progression of colorectal cancer (CRC), and COX-2 is also overexpressed in the colonic mucosa of patients with inflammatory bowel disease (IBD). In a clinical trial and in experimental UC rodents, the COX-2 inhibitors celecoxib and rofecoxib have beneficial effects on patients with UC. In recent years, based on the inflammatory theory of Alzheimer's disease (AD), it has been proposed that abnormally elevated expression of COX-2 in the AD brain is closely related to the characteristic pathological changes of the disease, and COX-2 is activated during the development of AD and may be involved in the pathogenesis of AD. Moreover, COX-2 may promote the diffusion and deposition of Aβ in APs in the cerebellum.

[0057] TNF-α is a proinflammatory cytokine that participates in normal inflammatory and immune responses. It can coordinate the homeostasis of tissues by regulating the production of other cytokines, cell survival and death. TNF-α is considered to be a proinflammatory cytokine in the pathogenesis of IBD. It can stimulate the response during the acute phase, promote the secretion of IL-1 and IL-6, and increase the expression of adhesion molecules. COX-2 plays an important role in the pathogenesis of UC (ulcerative colitis). COX-2 is a key enzyme that catalyzes AA to produce prostaglandin E2 (PGE2). PGE2 has the effects of vasodilation, increasing intestinal mucosal permeability and stimulating intestinal epithelial cell secretion, which may be related to the occurrence of abdominal pain and diarrhea in UC. TNF-α has multiple effects in inflammatory responses, including the activation of the NF-κB signaling pathway, the induction of adhesion molecules and prostaglandin synthases (such as COX-2), nitric oxide synthase (iNOS) and other factors, leading to the activation of endothelial cells and leukocytes. TNF-α stimulates the expression of COX-2 through downstream signals and specific transcription factors. In turn, the expression of COX-2 promotes the generation of PGE2, which is transported to the outside of the cell, stimulating multiple signal molecules on the cell surface including PI3K, promoting cell proliferation and inflammatory response. Since TNF-α and COX-2 have a mutually reinforcing positive feedback mechanism, and there are cross-shared molecules in signal transmission, as well as different signal transduction molecules, there is a synergistic effect between the two in theory, and inhibiting the expression of these two targets at the same time will have a better effect of treating inflammatory diseases compared to the inhibition of a single target. The present invention selects TNF-α and COX-2 as target genes, designs and screens effective siRNA molecules for the conservative sequences of the mRNA corresponding to the target genes, thereby achieving efficient and specific inhibition of these target genes, and the siRNA molecules that inhibit the expression of the two target genes of TNF-α and COX-2 are used in combination to exert a synergistic effect, and efficiently and specifically inhibit autoimmune diseases such as ulcerative colitis and psoriasis, and better inhibit autoimmune diseases.

[0058] The specific implementation of the present invention is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, but does not limit the present invention in any way.

[0059] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0060] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0061] Example 1. Design and screening of drug composition molecules

[0062] (1) Design of drug composition molecules

[0063] (2) siRNA targeting TNF-α mRNA (abbreviated as TNF-α siRNA or siTNF-α) includes human-mouse homologous siRNA and human-mouse heterologous siRNA (there are 2 base differences between humans and mice) and modified sequences. The specific sequences are shown in Tables 1 and 2.

[0064] Table 1. Sequences of siRNAs targeting TNF-α gene expression

[0065]

[0066]

[0067] Note: In the numbering, h indicates the mRNA sequence targeting humans, m indicates the mRNA sequence targeting mice, and r indicates the mRNA sequence targeting rats. dT stands for thymidine deoxyribonucleic acid, and the underlined letters indicate bases that are different from the siRNA targeting humans.

[0068] Table 2. Modified sequences of siRNA targeting TNF-α gene expression

[0069]

[0070] Note: m-methoxy (2'-Ome) modification (ribose modification); f-fluoro (2'-F) modification (ribose modification); s-phosphorothioate (PS) modification (backbone modification).

[0071] The sequence of the siRNA molecule targeting COX-2 mRNA (referred to as COX-2 siRNA or siCOX-2) is:

[0072] Sense strand: 5'-GGUCUGGUGCCUGGUCUGAUGAUGU-3'

[0073] Antisense strand: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′.

[0074] (2) Screening of siRNA targeting TNF-α mRNA

[0075] Suzhou Beixin Biotechnology Co., Ltd. was commissioned to synthesize TNF-α siRNA. Two cell lines, breast cancer cell MCF-7 and human immortalized keratinocyte HaCat, were used for screening.

[0076] ① The breast cancer MCF-7 cell line was used to conduct the first round of screening of the designed and synthesized siRNA molecules targeting the TNF-α target gene:

[0077] The human breast cancer cell line MCF-7 was inoculated in a 12-well plate with DMEM complete medium containing 10% fetal bovine serum at a density of 2-5×10 5 cells / well, 1 mL of culture medium per well, cultured overnight at 37°C.

[0078] Aspirate the cell culture medium in the 12-well plate and add 0.5 mL of serum-free DMEM medium to each well. Dilute 2 μL of 20 μM candidate siRNA with 200 μL of Opti-MEM serum-free medium; dilute 2 μL of Lipofectamine 2000 with 2 μL of Opti-MEM serum-free medium. TM (Lipo 2000, Invitrogen) was diluted in 200 μL Opti-MEM serum-free medium, mixed and incubated at room temperature for 5 minutes; the diluted siRNA and diluted Lipo 2000 were mixed, gently mixed, and placed at room temperature for 20 minutes to form a nanocomplex. The transfection groups were as follows: (1) TNF-α siRNA transfection experimental group; (2) siNC negative control transfection group; (3) blank control group with only Lipo 2000 added. Then, 400 μL of the final mixed solution was added to each well of a 12-well plate seeded with MCF-7 cells. The final concentration of siRNA was about 100 nM. The cells were cultured at 37°C for 4-6 hours, and 1 mL of DMEM complete medium containing 10% fetal bovine serum was added to each well, and the culture was continued at 37°C.

[0079] The expression level of TNF-α mRNA in MCF-7 cells transfected with Lipo, siNC, and different siTNF-α was detected by quantitative real-time PCR.

[0080] The specific steps are:

[0081] After culturing the transfected cells for 24-48 hours, the total RNA in the cells was extracted using the M5 Hiper Universal RNA Mini Kit (Tissue / Cell RNA Rapid Extraction Kit, Beijing Polymer Biotechnology Co., Ltd., Catalog No. MF036-01); 0.5 μg of total RNA was taken and reverse transcribed to obtain cDNA according to the method of the reverse transcription kit (Beijing Polymer Biotechnology Co., Ltd., Catalog No. MF166-plus-01). The 2x Hiper Realtime PCR Super mix (Beijing Polymer Biotechnology Co., Ltd., Catalog No. MF013-01) kit was used to detect the expression of TNF-α mRNA using cDNA as a template according to the steps in the instructions. Among them, the PCR primers used to amplify TNF-α and GADPH as an internal reference gene are shown in Table 3.

[0082] Table 3. Primers used for PCR amplification of TNF-α

[0083] Gene name Upstream primer (5'→3') Downstream primer (5'→3') Human TNF-α ACCTGCAGATCATCAGAGGAA GATCACACTTTTGGCCCTGT Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[0084] The expression of TNF-α mRNA in MCF-7 cells was Figure 1 As shown in the figure, it can be seen that after being treated with different sequences of TNF-α siRNA, the expression level of the target gene TNF-α in MCF-7 cells decreased to varying degrees. Figure 1 Labeled as TNF-α siRNA2) and siTNF-α-6 ( Figure 1 After the addition of siRNA (labeled as TNF-α siRNA6), the relative expression level of TNF-α mRNA was significantly reduced.

[0085] ②Using human immortalized keratinocytes HaCat to conduct a second round of screening of the designed and synthesized siRNA:

[0086] The difference from the first round of screening is that HaCat cells were used to replace the breast cancer MCF-7 cell line, and the expression of TNF-α mRNA in HaCat cells transfected with Lipo, siNC, and different siTNF-α was detected by real-time fluorescence quantitative PCR. Figure 2 As shown in the figure, it can be seen that after being treated with different sequences of TNF-α siRNA, the expression level of the target gene TNF-α in HaCat cells decreased to varying degrees. Figure 2 Labeled as TNF-α siRNA1) and siTNF-α-6 ( Figure 2 TNF-α siRNA6) has a significant inhibitory effect on the TNF-α gene.

[0087] Therefore, considering the inhibitory effect of siRNA on TNF-α gene in MCF-7 cells and HaCat cells, it can be seen that siTNF-α-6 has the best silencing effect on TNF-α gene.

[0088] ③The third round of screening of the designed siRNA was carried out using human cloned colon adenocarcinoma cells Caco2:

[0089] The difference from the first round of screening is that Caco2 cells were used to replace the MCF-7 cell line, and the expression of TNF-α mRNA in Caco2 cells transfected with Lipo and different siTNF-α was detected by real-time fluorescence quantitative PCR, and two siRNA concentrations of 10nM and 50nM were set. Figure 3 As shown in the figure, it can be seen that the siTNF-α-10 sequence has the best silencing effect on TNF-α mRNA.

[0090] Based on the various siRNA sequences of TNF-α screened out in the above experiments, and the siRNA sequences of COX-2, various different compositions are formed, including but not limited to composition 1 that can simultaneously inhibit the expression of human and mouse TNF-α and COX-2 genes, composition 2 that inhibits the expression of human TNF-α and COX-2 genes, and composition 3 that inhibits the expression of mouse TNF-α and COX-2 genes.

[0091] A siRNA pharmaceutical composition capable of simultaneously inhibiting the expression of TNF-α and COX-2 in humans and mice, composition 1, wherein the siRNA molecular sequence capable of inhibiting the activity of TNF-α is siTNF-α-10 in Table 1:

[0092] Sense strand: 5'-GUGACAAGCCUGUAGCCCAdTdT-3'

[0093] Antisense strand: 5′-UGGGCUACAGGCUUGUCACdTdT-3′.

[0094] The sequence of the siRNA molecule capable of inhibiting COX-2 activity is:

[0095] Sense strand: 5'-GGUCUGGUGCCUGGUCUGAUGAUGU-3'

[0096] Antisense strand: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′.

[0097] A siRNA pharmaceutical composition capable of inhibiting the expression of human TNF-α and COX-2, composition 2, wherein the siRNA molecular sequence capable of inhibiting the activity of TNF-α is siTNF-α-6 in Table 1:

[0098] Sense strand: 5'-CUGGUAUGAGCCCAUCUAUCUGGGA-3'

[0099] Antisense strand: 5′-UCCCAGAUAGAUGGGCUCAUACCAG-3′.

[0100] The sequence of the siRNA molecule capable of inhibiting COX-2 activity is:

[0101] Sense strand: 5'-GGUCUGGUGCCUGGUCUGAUGAUGU-3'

[0102] Antisense strand: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′.

[0103] A siRNA pharmaceutical composition capable of inhibiting the expression of TNF-α and COX-2 in mice, composition 3, wherein the siRNA molecular sequence capable of inhibiting the activity of TNF-α is siTNF-α-6' in Table 1:

[0104] Sense strand: 5'-CUGGUAUGAGCCCAUAUACCUGGGA-3'

[0105] Antisense strand: 5′-UCCCAGGUAUAUGGGCUCAUACCAG-3′.

[0106] The sequence of the siRNA molecule capable of inhibiting COX-2 activity is:

[0107] Sense strand: 5'-GGUCUGGUGCCUGGUCUGAUGAUGU-3'

[0108] Antisense strand: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′.

[0109] Example 2. Inhibitory effect of the pharmaceutical composition on the activity of human colon cancer cells

[0110] Human colon cancer cell line Caco2 was inoculated in 12-well plates with DMEM complete medium containing 10% fetal bovine serum at a density of 2-5×10 5 cells / well, 1 mL of culture medium per well, cultured overnight at 37°C.

[0111] The cell culture medium in the 12-well plate was discarded, and 0.5 mL of serum-free DMEM medium was added to each well. 1 μL of the drug composition with a concentration of 20 μM (in this example, siTNF-α-10 and siCOX-2 were combined at a molar ratio of 1:1) was taken and diluted with 200 μL Opti-MEM serum-free medium; 2 μL of Lipo 2000 (Invitrogen) was diluted in 200 μL Opti-MEM serum-free medium, mixed and incubated at room temperature for 5 minutes; the diluted siRNA and diluted Lipo 2000 were mixed, gently mixed, and placed at room temperature for 20 minutes to form a nanocomplex. The transfection groups are as follows: (1) siTNF-α-10 & siCOX-2 transfection experimental group; (2) blank control group with only Lipo 2000 added; (3) positive control group (GFP); (4) siTNF-α-10 transfection experimental group; (5) siCOX-2 transfection experimental group. Then, 400 μL of the final mixed solution was added to each well of a 12-well plate seeded with Caco2 cells. The final concentration of siRNA was about 100 nM, of which the concentrations of siTNF-α-10 and siCOX-2 were both 50 nM. The cells were cultured at 37°C for 4-6 hours, 100 ug / mL of lipopolysaccharide LPS was prepared with DMEM complete medium containing 10% fetal bovine serum, 1 mL of lipopolysaccharide DMEM complete medium was added to each well (except for the blank control group with only Lipo 2000 added, which was cultured with normal DMEM complete medium), and cultured at 37°C.

[0112] Real-time fluorescence quantitative PCR was used to detect the expression of TNF-α mRNA in the Lipo group, siTNF-α-10 & siCOX-2 group, positive control group, siTNF-α-10 group, and siCOX-2 group. The specific steps are as follows:

[0113] After culturing the transfected cells for 24-48 hours, the total RNA in the cells was extracted using the M5 Hiper Universal RNA Mini Kit (Tissue / Cell RNA Rapid Extraction Kit, Beijing Polymer Biotech Co., Ltd., Catalog No. MF036-01); 0.5 μg of total RNA was taken and reverse transcribed to obtain cDNA according to the method of the reverse transcription kit (Beijing Polymer Biotech Co., Ltd., Catalog No. MF166-plus-01). The expression of TNF-α mRNA was detected using the 2x Hiper Realtime PCR Super mix (Beijing Polymer Biotech Co., Ltd., Catalog No. MF166-01) kit with cDNA as a template according to the steps in the instructions. The PCR primers used to amplify TNF-α and GADPH as an internal reference gene are shown in Table 4.

[0114] Table 4. Primers used for PCR amplification of TNF-α

[0115] Gene name Upstream primer (5'→3') Downstream primer (5'→3') Human TNF-α CTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[0116] The results are as follows Figure 4 As shown in the figure, it can be seen that compared with the inhibitory effects of siTNF-α-10 and siCOX-2 alone, the expression of TNF-α mRNA was significantly inhibited after treatment with siTNF-α-10&siCOX-2.

[0117] Example 3. Concentration Effect of Pharmaceutical Composition

[0118] Human colon cancer cell line Caco2 was inoculated in 12-well plates with DMEM complete medium containing 10% fetal bovine serum at a density of 2-5×10 5 cells / well, 1 mL of culture medium per well, cultured overnight at 37°C.

[0119] 3 μL of a 20 μM drug composition (in this example, siTNF-α-10 and siCOX-2 are combined at a molar ratio of 1:1) was diluted to 400 nM with 300 μL of Opti-MEM serum-free medium, 100 μL was taken from the 400 nM mixture and diluted to 200 nM with 100 μL of Opti-MEM serum-free medium, 50 μL was taken from the 200 nM mixture and diluted to 20 nM with 200 ul of Opti-MEM serum-free medium, 50 ul was taken from the 20 nM mixture and diluted to 4 nM with 200 μL of Opti-MEM serum-free medium, 2 μL of a 20 μM candidate siRNA was diluted with 200 μL of Opti-MEM serum-free medium; 2 μL of Lipo 2000 (Invitrogen) was diluted in 200 μL of Opti-MEM serum-free medium, mixed and incubated at room temperature for 5 minutes; the diluted siRNA and the diluted Lipo 2000, mix gently, and leave at room temperature for 20 minutes to form nanocomplexes. The transfection groups are as follows: (1) 200nM TNF-αsiRNA & COX-2 siRNA transfection experimental group; (2) 100nM TNF-αsiRNA & COX-2 siRNA transfection experimental group; (3) 20nM TNF-αsiRNA & COX-2 siRNA transfection experimental group; (4) 4nM TNF-αsiRNA & COX-2 siRNA transfection experimental group; (5) positive control group (GFP); (6) blank control group normal group with only Lipo 2000 added. Then add the above final mixed solution to a 12-well plate seeded with Caco2 cells. The final concentrations of the TNF-αsiRNA & COX-2 siRNA experimental group are approximately 200nM, 100nM, 20nM, and 4nM, and the siRNA concentration of the other groups is 100nM. The cells were cultured at 37°C for 4-6 hours, and 100 μg / mL lipopolysaccharide (LPS) was prepared with DMEM complete medium containing 10% fetal bovine serum. 1 mL of LPS DMEM complete medium was added to each well, and the cells were cultured at 37°C.

[0120] Quantitative Real-Time PCR was used to detect the expression levels of TNF-α mRNA in Caco2 cells in 200nM TNF-αsiRNA&COX-2 siRNA group, 100nM TNF-αsiRNA&COX-2 siRNA group, 20nM TNF-αsiRNA&COX-2siRNA group, 4nM TNF-αsiRNA&COX-2 siRNA group, GFP group and Lipo group.

[0121] The specific steps are:

[0122] After culturing the transfected cells for 24-48 hours, the total RNA in the cells was extracted using the M5 Hiper Universal RNA Mini Kit (Tissue / Cell RNA Rapid Extraction Kit, Beijing Polymer Biotechnology Co., Ltd., Catalog No. MF036-01); 0.5 μg of total RNA was taken and reverse transcribed to obtain cDNA according to the method of the reverse transcription kit (Beijing Polymer Biotechnology Co., Ltd., Catalog No. MF166-plus-01). The expression level of TNF-α mRNA was detected using the 2x Hiper Realtime PCR Super mix (Beijing Polymer Biotechnology Co., Ltd., Catalog No. MF166-01) kit with cDNA as a template according to the steps in the instructions. Among them, the PCR primers used to amplify TNF-α and GADPH as an internal reference gene are shown in Table 5.

[0123] Table 5. Primers used for PCR amplification of TNF-α

[0124] Gene name Upstream primer (5'→3') Downstream primer (5'→3') Human TNF-α CTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[0125] The results are as follows Figure 5 As shown in the figure, it can be seen that the high concentration of the pharmaceutical composition has a better inhibitory effect on TNF-α mRNA than the low concentration, showing a good dose-dependent effect.

[0126] Example 4. Inhibitory effect of the pharmaceutical composition on intracellular proinflammatory factor genes

[0127] IL-1βmRNA is a proinflammatory cytokine of human colorectal adenocarcinoma cell line Caco2, and IL-8mRNA is an inflammatory signaling factor of human colorectal adenocarcinoma cell line Caco2. Genetic defects or inhibition of IL-1β and IL-8 signals can alleviate experimental colitis. Human colon cancer cell line Caco-2 was seeded in 12-well plates with DMEM complete medium containing 10% fetal bovine serum at a seeding density of 2-5×10 5 cells / well, 1 mL of culture medium per well, cultured overnight at 37°C.

[0128] The cell culture medium in the 12-well plate was discarded, and 0.5 mL of serum-free DMEM medium was added to each well. 1 μL of the drug composition with a concentration of 20 μM (in this example, siTNF-α-10 and siCOX-2 were combined at a molar ratio of 1:1) was taken and diluted with 200 μL Opti-MEM serum-free medium; 2 μL of Lipo 2000 (Invitrogen) was diluted in 200 μL Opti-MEM serum-free medium, mixed and incubated at room temperature for 5 minutes; the diluted siRNA and the diluted LipofectamineTM2000 were mixed, gently mixed, and placed at room temperature for 20 minutes to form a nanocomplex. The transfection groups were as follows: (1) siTNF-α-10 & siCOX-2 transfection experimental group; (2) siGFP & Sco29 negative control transfection group; (3) blank control group with only Lipo2000 added. Then, 400 μL of the above final mixed solution was added to each well of the 12-well plate inoculated with Caco2 cells. The final concentration of siRNA is about 100 nM. The cells were cultured at 37°C for 4-6 hours, and 100 μg / mL of lipopolysaccharide (LPS) was prepared with DMEM complete medium containing 10% fetal bovine serum. 1 mL of lipopolysaccharide DMEM complete medium was added to each well (except for the blank control group with only Lipo2000, which was cultured with normal DMEM complete medium), and the cells were cultured at 37°C.

[0129] Real-time fluorescence quantitative PCR was used to detect the expression levels of IL-1β mRNA and IL-8 mRNA in Caco2 cells transfected with Lipo, siGFP&Sco29, siTNF-α-10&siCOX-2, respectively. The specific steps are:

[0130] After culturing the transfected cells for 24-48 hours, the total RNA in the cells was extracted using the M5 Hiper Universal RNA Mini Kit (Tissue / Cell RNA Rapid Extraction Kit, Beijing Polymer Biotech Co., Ltd., Catalog No. MF036-01); 0.5 μg of total RNA was taken and reverse transcribed to obtain cDNA according to the method of the reverse transcription kit (Beijing Polymer Biotech Co., Ltd., Catalog No. MF166-plus-01). The expression of TNF-α mRNA was detected using the 2x Hiper Realtime PCR Super mix (Beijing Polymer Biotech Co., Ltd., Catalog No. MF166-01) kit with cDNA as a template according to the steps in the instructions. The PCR primers used to amplify IL-1β, IL-8 and GADPH as an internal reference gene are shown in Table 6.

[0131] Table 6. Primers used for PCR amplification of IL-1β and IL-8

[0132] Gene name Upstream primer (5'→3') Downstream primer (5'→3') Human IL-8 TTTTGCCAAGGAGTGCTAAAGA AACCCTCTGCACCCAGTTTTC Human IL-1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[0133] The results are as follows Figure 6 As shown in the figure, it can be seen that after treatment with siTNF-α-10&siCOX-2, the relative expression levels of proinflammatory cytokine IL-1β mRNA and inflammatory signal factor IL-8 mRNA decreased to varying degrees, indicating that the drug composition can effectively inhibit the expression of proinflammatory cytokine genes, inhibit the occurrence and development of inflammation, and relieve colitis.

[0134] Example 5. Determination of the therapeutic effect of composition 1 on ulcerative colitis through animal experiments

[0135] In this example, the drug composition 1, as well as individual siTNF-α-6 (siRNA#6m), siTNF-α-10 (siRNA#10hm) and COX-2 siRNA molecules, were prepared into the nanocomposition by the cationic polypeptide nanointroduction carrier HKP of the present invention, and the therapeutic effect of the drug on mice was detected in the DSS-induced mouse inflammation model in vivo. The DSS ulcerative colitis model is widely used to study the etiology and pathogenesis of inflammatory bowel disease and test the efficacy of newly developed drugs. This model is extremely similar to the symptoms and histological changes of human UC.

[0136] Mouse membrane

[0137] Weigh and label the C57 mice in each group. Add DSS (dextran sulfate sodium) to the drinking water of the mice to be modeled to a final concentration of 3.5%, and replace the 3.5% DSS aqueous solution every two days for 8 consecutive days. The mice in the untreated group drink normal water.

[0138] Drug preparation

[0139] Histidine-lysine polypeptide polymer (HKP+H) was used as the introduction system (delivery carrier) to self-assemble with siRNA molecules to form nanoparticles. Take 3 mg of one or two siRNAs, add 3 mL of injection water to fully dissolve, and take another 7.5 mg of HKP+H, add 3 mL of injection water to fully dissolve. Subsequently, 3 mL of siRNA and 3 mL of HKP+H solutions were quickly mixed in a microfluidic chip (flow rate 14 mL / min) through a small microfluidic mixer to form nanoparticles. The particle size of the nanodrug in the mixed solution was measured by a particle size analyzer. The particle sizes of the four prepared nanodrug particles siTNF-α-10&siCOX-2, siTNF-α-10, siCOX-2, and siTNF-α-6 were approximately 68.5, 76, 67, and 52 nm, respectively.

[0140] Drug administration in mice

[0141] C57 mice were randomly divided into six groups, 8 mice in each group, as follows: (1) normal group (normal water); (2) model group (3.5% DSS aqueous solution); (3) TC treatment group (siTNF-α-10 and COX-2 siRNA combination); (4) C treatment group (COX-2 siRNA); (5) T1 treatment group (TNF-α siRNA #10hm); (6) T2 group (TNF-α siRNA #6m). All groups except the normal group were modeled with DSS. All animals were intraperitoneally injected with the nano drug preparation at a dose of 2 mg / kg / day, of which the siRNA dose was 0.5 mg / kg / day, and the administration volume was about 80 μL per mouse. The administration began at the same time as the film was formed and continued for 7 days.

[0142] The weight, fecal characteristics and occult blood of mice were observed at a fixed time every day starting from the day before DSS administration. The mice were scored according to the following criteria. The sum of the scores of the weight, fecal characteristics and occult blood of mice was the DAI score of mice to evaluate the severity of enteritis. The scoring criteria are as follows: (1) Weight change scoring criteria (0–4 points): a 0%–1% decrease in mouse weight was scored as 0 points; a 1%–5% decrease was scored as 1 point; a 5%–10% decrease was scored as 2 points; a 10%–20% decrease was scored as 3 points; and a decrease of more than 20% was scored as 4 points. (2) Fecal characteristics scoring criteria (0–4 points): normal feces 0 points; soft feces 1 point; loose feces 2 points; diarrhea 4 points. (3) Fecal occult blood scoring criteria (0–4 points): normal feces 0 points; blood on the feces surface 2 points; severe bleeding 4 points. The sum of the above three scores and then divided by 3 is the DAI score.

[0143] At the end of the experiment, the experimental mice were killed by cervical dislocation, fixed and dissected, and the ileocecal to anus segment was taken and measured directly with a ruler. About 0.5 cm long terminal ileum was taken 2-3 cm away from the cecal part and stored in liquid nitrogen. RNA was extracted (M5 Hiper Universal RNA Mini Kit), reverse transcribed, and fluorescent quantitative PCR analysis was performed as described above to detect the expression of relevant genes.

[0144] Tissue sections and pathological evaluation

[0145] About 0.5 cm long terminal ileum was obtained at 3 cm away from the blind part, and the intestinal contents were removed and fixed in 4% paraformaldehyde, and then paraffin sectioned and stained with hematoxylin-eosin (H&E): following the steps of gradient dehydration, transparency, wax immersion, embedding, sectioning, baking, dewaxing, hydration, hematoxylin nuclear staining, 1% hydrochloric acid differentiation, 0.5% ammonia anti-blueing, eosin staining, gradient dehydration, transparency, sealing, etc. Finally, pathological tissue changes such as intestinal mucosal congestion, epithelial cell desquamation and necrosis, and inflammatory cell infiltration were observed under a light microscope.

[0146] The results showed that siRNA of TNF-α and COX-2, or the combination of the two, could improve the symptoms of ulcerative colitis to varying degrees and increase the length of the colon ( Figure 7 ), there was no significant difference between the combination of siTNF-α-10 and COX-2 siRNA, COX-2 siRNA, and TNF-α siRNA#10hm, and the therapeutic effect of TNF-α siRNA#6m was not as good as the other groups. The animal activity score also showed a similar trend ( Figure 7 PCR analysis was used to determine the expression of inflammatory factors in the intestine ( Figure 8 ), indicating that each treatment group can inhibit the expression of inflammatory factors in the intestine to varying degrees, among which the siRNA combination of siTNF-α-10 and COX-2 has the best effect, which is significantly better than the COX-2 siRNA and TNF-α siRNA#10hm groups, indicating that the combination of the two siRNA molecules has a synergistic effect.

[0147] Example 6. Determination of the therapeutic effect of composition 2 on ulcerative colitis through animal experiments

[0148] In this example, the drug composition 2 was prepared into the nanocomposition by the cationic polypeptide nano-introduction carrier HKP of the present invention, and the therapeutic effect of the drug on mice was detected in the DSS-induced mouse inflammation model in vivo. The DSS ulcerative colitis model is widely used to study the etiology and pathogenesis of inflammatory bowel disease and test the efficacy of newly developed drugs. This model is extremely similar to the symptoms and histological changes of human UC.

[0149] Mouse membrane

[0150] Weigh and label the C57 mice in each group. Add DSS to the drinking water of the mice to be modeled to a final concentration of 3%, and replace the 3% DSS aqueous solution every two days for 8 consecutive days. The mice in the untreated group drink normal water.

[0151] Drug administration in mice

[0152] C57 mice were randomly divided into six groups, 8 mice in each group, as follows: (1) normal group (normal water); (2) model group (3% DSS aqueous solution); (3) negative siRNA treatment group (negative control siRNA); (4) siTNF-α+siCOX-2 treatment group. All animals were intraperitoneally injected with 2 mg / kg per mouse, 0.5 mg / kg siRNA dosage, and 80 uL per mouse. The administration started on the first day of membrane formation and continued for 7 days. The rest of the tests were the same as in Example 5.

[0153] from Fig. 9 It can be seen that the composition 2 composed of TNF-α and COX-2 siRNA molecules can significantly increase the colon length ( Fig. 9 AB), pathological scores were significantly reduced ( Fig. 9 CD).

[0154] Example 7. Determination of the therapeutic effect of composition 3 on ulcerative colitis through animal experiments

[0155] In this example, the drug composition 3 was prepared into the nanocomposition by the cationic polypeptide nano-introduction carrier HKP of the present invention, and the therapeutic effect of the drug on mice was tested in the DSS-induced mouse inflammation model in vivo. The DSS ulcerative colitis model is widely used to study the etiology and pathogenesis of inflammatory bowel disease and test the efficacy of newly developed drugs. This model is extremely similar to the symptoms and histological changes of human UC.

[0156] Mouse membrane

[0157] Weigh and label the C57 mice in each group. Add DSS to the drinking water of the mice to be modeled to a final concentration of 3%, and replace the 3% DSS aqueous solution every two days for 8 consecutive days. The mice in the untreated group drink normal water.

[0158] Drug administration in mice

[0159] C57 mice were randomly divided into six groups, 8 mice in each group, as follows: (1) normal group (normal water); (2) model group (3% DSS aqueous solution); (3) siTNF-α+siCOX-2 treatment group. All animals were intraperitoneally injected with 2 mg / kg per mouse, 0.5 mg / kg siRNA, and 80 uL per mouse. The administration started on the second day of membrane formation and continued for 5 days. The rest of the tests were the same as in Example 5.

[0160] from Fig.10 It can be seen that the composition 3 composed of TNF-α and COX-2 siRNA molecules can significantly increase the colon length ( Fig.10 A-B), the pathological score was significantly reduced ( Fig.10 C-D).

[0161] Although certain embodiments of the above-described compositions and methods have been described in the present invention and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that these compositions and methods are susceptible to other embodiments and that certain details may be changed in light of the embodiments described herein without departing from the basic principles of the invention.

Claims

1. A double-blocking siRNA pharmaceutical composition for inhibiting autoimmune diseases, It is characterized in that The siRNA pharmaceutical composition comprises a siRNA molecule capable of binding to mRNA encoding TNF-α and inhibiting its expression and a siRNA molecule capable of binding to mRNA encoding COX-2 and inhibiting its expression.

2. The siRNA pharmaceutical composition according to claim 1, It is characterized in that The sequence of the siRNA molecule capable of binding to the mRNA encoding TNF-α and inhibiting its expression is selected from any one or more of Tables 1 and 2.

3. The siRNA pharmaceutical composition according to claim 1, It is characterized in that The sequence of the siRNA molecule capable of binding to mRNA encoding TNF-α and inhibiting its expression is selected from: (1) SEQ ID NO.1: Sense strand: 5'-GUGACAAGCCUGUAGCCCAdTdT-3' Antisense strand: 5′-UGGGCUACAGGCUUGUCACdTdT-3′; (2) SEQ ID NO.2: Sense strand: 5'-CUGGUAUGAGCCCAUCUAUCUGGGA-3' Antisense strand: 5′-UCCCAGAUAGAUGGGCUCAUACCAG-3′; (3) SEQ ID NO.3: Sense strand: 5'-CUGGUAUGAGCCCAU A UA C CUGGGA-3' Antisense strand: 5'-UCCCAG G UA U AUGGGCUCAUACCAG-3', The underlined italic letters represent bases that are inconsistent with the human sequence and form mismatches; And / or, the siRNA molecule capable of binding to mRNA encoding TNF-α and inhibiting its expression is a modified sequence, wherein the modification includes one or more of methoxy modification, fluoro modification, and thio modification.

4. The siRNA pharmaceutical composition according to claim 3, It is characterized in that The sequence of the siRNA molecule capable of binding to the mRNA encoding COX-2 and inhibiting its expression is: Sense strand: 5'-GGUCUGGUGCCUGGUCUGAUGAUGU-3' Antisense strand: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′.

5. The siRNA pharmaceutical composition according to claim 1, It is characterized in that The siRNA pharmaceutical composition comprises a siRNA molecule capable of binding to mRNA encoding TNF-α and inhibiting its expression and a siRNA molecule capable of binding to mRNA encoding COX-2 and inhibiting its expression in a molar ratio of 1:2-2:1 and / or the autoimmune disease comprises one or more of ulcerative colitis, Crohn's disease, psoriasis, and Alzheimer's disease.

6. A siRNA pharmaceutical preparation, It is characterized in that The pharmaceutical preparation comprises the siRNA molecule or siRNA pharmaceutical composition according to any one of claims 1 to 5, and a pharmaceutically acceptable carrier.

7. The pharmaceutical preparation according to claim 6, It is characterized in that The pharmaceutically acceptable carrier includes a histidine-lysine branched polypeptide polymer; And / or, the siRNA pharmaceutical preparation is a nanopharmaceutical preparation, And / or, the siRNA pharmaceutical preparation is a lyophilized powder preparation, And / or, the preparation method of the siRNA pharmaceutical preparation is to mix the siRNA pharmaceutical composition and the pharmaceutically acceptable carrier by vortex oscillation or microfluidics technology to form the siRNA pharmaceutical preparation.

8. The pharmaceutical preparation according to claim 7, It is characterized in that The histidine-lysine branched polypeptide polymer is H3K4b or H3K(+H)4b; and / or, the siRNA drug composition and the histidine-lysine polypeptide nano-introduction carrier H3K4b are mixed at an N / P mass ratio of 1:0.8-1:6 to self-assemble into a nano-drug.

9. A molecular conjugate drug, It is characterized in that The molecular conjugated drug is formed by coupling the siRNA molecule or siRNA drug composition described in any one of claims 1 to 5 with a targeting ligand via a linker.

10. The molecular conjugate drug according to claim 9, It is characterized in that The targeting ligand includes proteins, polypeptides, antibodies, small molecule compounds, carbohydrates, lipids and other polymer molecules with targeting function. The targeting ligand is preferably a polypeptide consisting of less than 50 amino acids in length and / or a polypeptide consisting of 15-30 amino acids.

Images