Application of PAFAH2 protein in preparation of product for preventing and / or treating ischemia-reperfusion injury

Abstract

The invention discloses an application of a PAFAH2 protein in preparation of a product for preventing and / or treating ischemia reperfusion injury. The invention reveals that the platelet activating factor and the similar phospholipids thereof can induce cells to generate ferroptosis for the first time. In one aspect, they can directly result in an increase in cell membrane permeability; on the other hand, the compounds can be secreted out of the cells and serve as propagation factors of ferroptosis, and propagation of ferroptosis in cell populations is promoted. The PAFAH2 is used as specific hydrolase for platelet activating factors and similar phospholipids thereof in cells, and the resistance effect on ferroptosis is achieved by removing oxidized substrates. Ischemia reperfusion can cause ferroptosis of tissue cells, and oxidized and intercepted phospholipids generated by reperfusion are removed by injecting human-derived recombinant PAFAH2 protein, so that the tissue cells are protected from occurrence, propagation and diffusion of ferroptosis caused by lipid peroxidation, and large-area tissue damage caused by ischemia reperfusion is inhibited.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the use of PAFAH2 protein in preparing products for preventing and / or treating ischemia-reperfusion injury, and particularly relates to a method for preventing and / or treating ischemia-reperfusion injury by intravenous injection of human recombinant PAFAH2 protein. Background Art

[0002] Ferroptosis is a programmed cell death caused by the accumulation of iron-dependent lipid peroxidation. Initially, Erastin and RSL3 were found to specifically kill tumor cells with RAS oncogenic mutations, and were therefore collectively referred to as RAS-selective lethal compounds (RSLs). In 2012, Brent R. Stockwell named the characteristic cell death caused by this RSLs ferroptosis. Ferroptosis is different from reported cell deaths such as apoptosis, necrosis, and pyroptosis in terms of cell morphology, biochemistry, and genetic levels. During ferroptosis, apoptotic bodies or autophagosomes are not formed, and there are no phenomena such as cell shrinkage, chromatin aggregation, cytoplasm or organelle swelling. Instead, it exhibits the characteristics of mitochondrial fragmentation and increased membrane density, loss of membrane structural integrity, and increased intracellular lipid peroxides. Ferroptosis has been reported to be involved in the progression of many diseases, including tumors, ischemia-reperfusion injury, and neurodegenerative diseases. To date, the mechanism of ferroptosis and the molecular regulatory network of cells resisting ferroptosis have been basically formed, but there are still more scientific problems related to the spread of ferroptosis and the clinical application of drugs that need to be solved. The specific mechanism of ferroptosis caused by lipid peroxidation is a major unresolved problem in this field.

[0003] Ischemia-reperfusion (I / R) injury is tissue damage caused by the restoration of arterial blood supply to an organ after a brief blockage. During the ischemic period, tissues are subjected to hypoxic stress, and mitochondrial anaerobic metabolism causes a decrease in ATP production; during the reperfusion period, reactive oxygen species suddenly increase, leading to a cascade effect of reoxidation of the ischemic site and inflammation of multiple organs, ultimately leading to organ failure. Ischemia-reperfusion injury occurs in a variety of diseases such as organ transplantation, sepsis, ischemic stroke, and sleep apnea. Ischemia-reperfusion activates programmed cell death such as apoptosis, necroptosis, and autophagic cell death. Alleviating ischemia-reperfusion injury by inhibiting cell death is a new therapeutic strategy. In animal models, inhibitors of ferroptosis have been used to alleviate a variety of ischemia-reperfusion injuries.

[0004] The kidney is an important organ responsible for excretion and endocrine secretion. The outer layer of the kidney is the renal cortex, which is mainly composed of glomeruli and renal tubules. The renal tubules can be divided into three parts: the proximal tubules (including the proximal convoluted tubules and the thick descending limb of the loop of Henle), the thin segments of the loop of Henle and the distal tubules (including the thick ascending limb of the loop of Henle and the distal convoluted tubules). The inside of the kidney is the renal medulla composed of renal pyramids. Acute kidney injury is also known as acute renal failure. Acute kidney injury has direct damage to the renal tubules and glomeruli, which leads to rapid renal insufficiency, a sudden drop in glomerular filtration rate and renal output, and impaired water and electrolyte balance. It is the main cause of high morbidity and mortality of many related diseases. Tamoxifen-induced ferroptosis key protein GPX4 is knocked out throughout the body except for the brain, which leads to acute kidney injury and individual death, indicating that renal tubular cells are the cells most susceptible to ferroptosis damage outside the brain area, among which the damage to the renal proximal tubular epithelial cells is the most significant.

[0005] The main cause of acute kidney injury is renal ischemia-reperfusion injury. During the renal reperfusion period, a large number of reactive oxygen free radicals are generated, the iron ion level increases, the level of secondary oxidation product malondialdehyde increases, the level of glutathione decreases, and the lipid peroxidation of the membrane system increases, which promotes the occurrence of tubular cell death, which has similar characteristics to ferroptosis. Supplementation of free radical scavenger melatonin can resist renal damage caused by ischemia-reperfusion injury, indicating that the antioxidant system that scavenges free radicals has a protective effect on ischemia-reperfusion injury. Ferrostatins and lipoxstatins, inhibitors of ferroptosis, are lipophilic antioxidants. Pretreatment can alleviate severe renal ischemia-reperfusion injury, indicating that ferroptosis is involved in renal ischemia-reperfusion injury. After tamoxifen-induced ferroptosis key protein GPX4 knockout, the mouse kidneys swelled, became pale, non-selective proteinuria, proximal tubular epithelial cell death and other characteristics of acute renal failure. Analysis of the oxidized lipidome of GPX4 knockout kidneys showed increased oxidative modification of phosphatidylethanolamine, phosphatidylcholine and cardiolipin. Lipophilic antioxidant Liproxstatin-1 can reduce ferroptosis of renal tubular cells in mice induced by GPX4 knockout and prolong their lifespan, indicating that ferroptosis contributes to acute kidney injury. In addition, knockout of ferroptosis inhibitory protein FSP1 exacerbates ferroptosis of renal tubular cells induced by ischemia-reperfusion injury, indicating that non-glutathione-dependent antioxidant systems can also protect the kidneys against ischemia-reperfusion injury. On the seventh day after organ transplantation, biopsy specimens of patients with acute tubular injury showed a significant increase in the expression level of ferroptosis marker protein ACSL4, accompanied by severe thrombotic microangiopathy, which also indicates that ferroptosis occurs during ischemia-reperfusion injury.

[0006] Ferroptosis-related diseases often involve large, continuous areas of damage, which is consistent with the characteristics of Erastin-induced ferroptosis spreading in waves between adjacent cells. Similar to pyroptosis and necroptosis, nanometer-diameter pores formed on the cell membrane mediate the swelling and rupture of ferroptotic cells. Polyethylene glycol of 1,450 and 3,350 Da can inhibit the rupture of cell membranes during ferroptosis as osmotic substances. In addition, the propagation of ferroptosis signals occurs before cell rupture, but the propagation factors of ferroptosis are still unknown. Injection of arachidonic acid into the caudal fin of zebrafish larvae induces a gradient of lipid peroxides from the edge of the caudal fin wound, which causes ferroptosis in the caudal fin cells to spread in a wave-like manner. Ferroptosis also exhibits a wave-like spatiotemporal propagation pattern in isolated renal tubules. Erastin induces the death of primary tubular cells, and the more stable and potent third-generation Ferrosatin 16-86 can inhibit tubular death, while the necroptosis inhibitor Necrostatin-1 (Nec-1) cannot resist tubular death, indicating that ferroptosis rather than necroptosis causes synchronized tubular cell death.

[0007] In summary, ferroptosis is involved in the occurrence and development of ischemia-reperfusion injury, and such diseases can be treated or alleviated by inhibiting ferroptosis. Summary of the invention

[0008] The technical problem to be solved by the present invention is how to prevent and / or treat and / or inhibit ischemia-reperfusion injury.

[0009] In order to solve the above technical problems, the present invention first provides a new use of PAFAH2 protein or a substance that promotes the expression of PAFAH2 protein.

[0010] The present invention provides the use of PAFAH2 protein or a substance promoting the expression of PAFAH2 protein in preparing a product for preventing and / or treating and / or inhibiting ischemia-reperfusion injury.

[0011] In the above application, the PAFAH2 protein is the protein shown in R1)-R4) below:

[0012] R1) The amino acid sequence is the protein shown in SEQ ID No. 1;

[0013] R2) A fusion protein having the same function obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1);

[0014] R3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in R1) or R2);

[0015] R4) A protein having 90% or more identity with the amino acid sequence represented by R1) or R2) or R3) and having the same function.

[0016] In the above R2), the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0017] In the above R3), the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0018] In the above R4), the identity includes an amino acid sequence having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity with the amino acid sequence shown in SEQ ID No.1 of the present invention.

[0019] The proteins described in R1)-R4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0020] In a specific embodiment of the present invention, the PAFAH2 protein is obtained by biological expression, and the specific preparation method includes the following steps: introducing the coding gene of PAFAH2 into biological cells to obtain recombinant cells; culturing the cells and purifying the PAFAH2 protein from the culture product.

[0021] The PAFAH2 coding gene is introduced into biological cells via an expression vector, wherein the expression vector may be pcDNA3.1, and the PAFAH2 coding gene may be a DNA molecule shown in SEQ ID No.2.

[0022] The biological cells may specifically be HEK 293F cells.

[0023] The culture conditions may specifically be 37°C, 120 rpm, 5% CO 2 The cells were cultured for 48 h under the conditions of

[0024] The culture further includes the following steps: centrifugation (18,000 rpm, 4°C for 40 min), discarding the supernatant, and collecting the cell precipitate; resuspending the cell precipitate and then lysing it to obtain a lysate; centrifuging the lysate and collecting the supernatant; first affinity adsorbing the supernatant and then eluting it to obtain the human recombinant PAFAH2 protein.

[0025] The human recombinant PAFAH2 protein prepared according to the method of the present invention can be used immediately after purification and sterilization, or can be frozen and stored in a -80 degree Celsius refrigerator, and repeated freezing and thawing should be avoided.

[0026] In the above application, the PAFAH2 protein can inhibit ischemia-reperfusion injury by inhibiting ferroptosis caused by lipid peroxidation. Specifically, it can clear platelet-activating factor and its similar phospholipids caused by ischemia-reperfusion, block the spread of ferroptosis among cell populations, and thus prevent and / or treat and / or inhibit ischemia-reperfusion injury.

[0027] In the above application, the PAFAH2 protein can be injected intravenously to prevent and / or treat and / or inhibit ischemia-reperfusion injury. The dosage of the intravenous injection can be 20 mg / kg.

[0028] In order to solve the above technical problems, the present invention also provides a product for preventing and / or treating and / or inhibiting ischemia-reperfusion injury.

[0029] The active ingredient of the product for preventing and / or treating and / or inhibiting ischemia-reperfusion injury provided by the present invention is any of the above-mentioned PAFAH2 proteins or a substance that promotes the expression of PAFAH2 protein.

[0030] Furthermore, the product is a PAFAH2 protein solution.

[0031] Furthermore, the concentration of the PAFAH2 protein solution may be 2 mg / mL.

[0032] Furthermore, the solvent of the PAFAH2 protein solution may be a buffer solution containing 300 mM NaCl and 50 mM Tris (pH 8.5).

[0033] Any of the above products can be a medicine or a preparation.

[0034] When preparing the medicine or preparation in practical application, a carrier material may be added, including but not limited to water-soluble carrier materials (such as polyethylene glycol, polyvinyl pyrrolidone, organic acid, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.).

[0035] These materials can be used to make a variety of dosage forms, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, lozenges, suppositories, freeze-dried powder injections, etc. It can be a conventional preparation, a sustained-release preparation, a controlled-release preparation, and various microparticle delivery systems. In order to make unit dosage forms into tablets, various carriers known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and adhesives, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch slurry, dextrin, syrup, honey, glucose solution, acacia slurry, gelatin slurry, sodium carboxymethyl cellulose, shellac, methylcellulose, potassium phosphate, polyvinyl pyrrolidone, etc.; disintegrants , such as dry starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid esters, sodium lauryl sulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters, such as quaternary ammonium salts, sodium lauryl sulfate, etc.; lubricants, such as talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. The tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer tablets and multi-layer tablets. In order to make the unit dosage form into a pill, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinyl pyrrolidone, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or flour paste, etc.; disintegrants such as agar powder, dry starch, alginate, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc. In order to prepare the unit dosage form into a suppository, various carriers known in the art can be widely used. Examples of carriers include, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. In order to prepare the unit dosage form into an injectable preparation, such as a solution, emulsion, freeze-dried powder injection and suspension, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol fatty acid esters, etc. In addition, in order to prepare isotonic injections, an appropriate amount of sodium chloride, glucose or glycerol may be added to the injection preparations, and conventional cosolvents, buffers, pH adjusters, etc. may also be added. In addition, colorants, preservatives, spices, flavoring agents, sweeteners or other materials may also be added to the pharmaceutical preparations as needed.

[0036] The above dosage form can be administered by injection, preferably intravenous injection. The above product can be administered to a subject by intravenous injection to prevent and / or treat and / or inhibit ischemia-reperfusion injury.

[0037] In order to solve the above technical problems, the present invention finally provides a method for inhibiting ischemia-reperfusion injury.

[0038] The method for inhibiting ischemia-reperfusion injury provided by the present invention comprises the step of intravenously injecting PAFAH2 protein into a subject.

[0039] The intravenous injection dose may specifically be 20 mg / kg.

[0040] The intravenous injection may be performed after ischemia occurs and before tissue reperfusion occurs.

[0041] In any of the above-mentioned applications, products or methods, the ischemia-reperfusion injury may be myocardial ischemia-reperfusion injury, cerebral ischemia-reperfusion injury or renal ischemia-reperfusion injury (such as acute kidney injury caused by renal ischemia-reperfusion).

[0042] In any of the above-mentioned applications, products or methods, the ischemia-reperfusion injury includes not only the damage caused by blood circulation obstruction requiring blood reperfusion during clinical treatment, but also the damage caused by similar reperfusion therapy under ischemic conditions of tissues or organs.

[0043] The diseases requiring blood reperfusion during clinical treatment due to obstructed blood circulation include, but are not limited to, organ transplantation, sepsis, myocardial infarction, and atherosclerosis.

[0044] The conditions similar to reperfusion therapy performed under the ischemic state of tissues or organs include, but are not limited to, unblocking microcirculation during shock, relieving coronary artery spasm, and cardiocerebral pulmonary resuscitation after cardiac arrest.

[0045] The beneficial effects of the present invention are as follows: since platelet activating factor and various types of oxidized truncated phospholipids are produced during ischemia-reperfusion, and platelet activating factor acetylhydrolase PAFAH2 is a phospholipase that is specific to the above-mentioned special phospholipids in cells, it promotes the oxidized phospholipids to enter the phospholipid cycle by hydrolyzing the short chain at the sn-2 position of the phospholipids, and is used for the synthesis of new phospholipids, thereby achieving the removal of harmful phospholipids. Based on this, the present invention provides a method for inhibiting ischemia-reperfusion injury by intravenous injection of PAFAH2 protein, which is performed by intravenously injecting in vitro purified human recombinant PAFAH2 protein after ischemia occurs and before tissue reperfusion, and using PAFAH2 to remove the oxidized truncated phospholipids produced by reperfusion, thereby protecting tissue cells from the occurrence and spread of ferroptosis caused by lipid peroxidation, and inhibiting large-area tissue damage caused by ischemia-reperfusion. The method of the present invention is applicable to a variety of clinical situations, including various organ transplant operations, unblocking of blood vessel blockages and sepsis, etc. It only requires intravenous injection of PAFAH2 protein before the operation, which is simple, convenient and effective.

[0046] The present invention provides a method for inhibiting ischemia-reperfusion by intravenous injection of PAFAH2 protein. The present invention reveals for the first time that platelet-activating factor and its similar phospholipids can induce cell ferroptosis. On the one hand, they can directly lead to increased cell membrane permeability; on the other hand, they can be secreted outside the cell as a propagation factor of ferroptosis, promoting the propagation of ferroptosis in the cell population. PAFAH2, as a specific hydrolase for platelet-activating factor and its similar phospholipids in the cell, achieves resistance to ferroptosis by removing these oxidized substrates. Ischemia-reperfusion can cause ferroptosis in tissue cells. The present invention removes the oxidized truncated phospholipids produced by reperfusion by injecting human recombinant PAFAH2 protein, thereby protecting tissue cells from the occurrence and spread of ferroptosis caused by lipid peroxidation, and inhibiting large-area tissue damage caused by ischemia-reperfusion. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Platelet-activating factor and its similar phospholipids cause cell ferroptosis. Figure 1 AC is the changes in cell survival rate detected by CCK8 after treatment of HK2, HT1080 and HUVEC cell lines with platelet-activating factor and its similar phospholipids. Figure 1 D shows the changes in cell survival rate detected by CCK8 after pretreatment with ferroptosis inhibitors Fer-1 or DFO, apoptosis inhibitor Z-VAD-FMK, necrosis inhibitor Nec-1 and autophagy inhibitor 3-MA, followed by treatment with platelet-activating factor C16. Figure 1E: After cells were treated with DMSO, platelet-activating factor C16 or RSL3, the changes in mitochondrial membrane density were detected using electron microscopy. Figure 1 FG: After platelet-activating factor C16 treatment, the changes in the fluorescence intensity of BODIPY 581 / 591C11 in cells were detected by flow cytometry FL1 channel. Figure 1 H is the changes of ferroptosis marker genes detected by qRT-PCR after treatment with platelet-activating factor C16 for different time periods. Figure 1 I shows the changes in cell survival rate detected by CCK8 after pretreatment with the ferroptosis inhibitor Fer-1 and then treatment with platelet-activating factor-like phospholipid PGPC. Figure 1 J shows the changes in cell survival rate detected by CCK8 after pretreatment with the ferroptosis inhibitor Fer-1 and then treatment with platelet-activating factor-like phospholipid POVPC. Figure 1 KL isolated renal tubules from C57 / BL6J mouse kidneys, pretreated with inhibitors of different death types, and then treated with platelet-activating factor C16. Calcein (green) indicates live cells, and propidium iodide (red) indicates dead cells.

[0048] Figure 2 Platelet-activating factor and its similar phospholipids cause increased liposome membrane permeability. Figure 2 A is POPC liposomes containing 2% NBD-DPPE fluorescence. After adding the strong reducing agent sodium dithionite, only the NBD fluorescence on the outer leaflet of the liposome was quenched. Figure 2 B is POPC liposomes containing 2% NBD-DPPE fluorescence and a certain proportion of platelet activating factor C16 or PGPC. After adding sodium dithionite, the NBD fluorescence on the inner and outer leaflets of the liposomes was quenched. Figure 2 C represents POPC liposomes without or with a certain proportion of platelet activating factor C16. After adding sodium dithionite, the change in fluorescence intensity of the liposomes was detected using a multifunctional microplate reader. Figure 2 D is POPC liposomes without or with a certain proportion of PGPC. After adding sodium dithionite, the change in fluorescence intensity of the liposomes was detected using a multifunctional microplate reader.

[0049] Figure 3 Platelet-activating factor is a propagating factor of ferroptosis. Figure 3 A: After treatment with ferroptosis inducer RSL3 for different time periods, platelet activating factor ELISA was used to detect changes in the content of platelet activating factor in the cell culture medium. Figure 3 B: After knocking down the platelet-activating factor receptor by transfecting SiRNA, the platelet-activating factor C16 concentration gradient was treated and the changes in cell survival rate were detected using CCK8. Figure 3C: After pretreatment with platelet-activating factor receptor antagonist WEB2086 or Ginkgolide B, cells were treated with platelet-activating factor C16 and CCK8 was used to detect cell survival. Figure 3 D: After pretreatment with α-acid sphingomyelinase and imipramine, the cells were treated with platelet-activating factor C16 and CCK8 was used to detect cell survival. Figure 3 E: After pre-treatment with Dynasore, an inhibitor of dynamin, cells were treated with platelet-activating factor C16 and CCK8 was used to detect cell survival. Figure 3 FG: Platelet activating factor C16 was injected into the cells (black dotted box) by microinjection, and then the cell death was observed using a confocal microscope. Propidium iodide staining (red) was used to indicate cell death. The number of newly added propidium iodide-positive cells was counted. Figure 3 HI means adding IgG or platelet activating factor antibody to the culture medium of cells. After RSL3 treatment, the state of cells was observed using an optical microscope (H), and the cell survival rate was detected using CCK8 (I). Figure 3 JK isolated renal tubules from the kidneys of C57 / BL6J mice, and injected IgG or platelet-activating factor antibodies (with Dextran-Cascade Blue, blue) into one end of the renal tubule using microinjection technology, and injected 1% BSA or platelet-activating factor C16 (with Dextran-488, green) into the other end of the renal tubule. After changing the medium and adding culture medium containing propidium iodide, live cell imaging was performed to observe the death of renal tubular cells (red).

[0050] Figure 4 To inhibit platelet-activating factor acetylhydrolase 2 and promote cell ferroptosis. Figure 4 A: After knocking down platelet-activating factor acetylhydrolase 2 by transfection of siRNA, RSL3 concentration gradient was treated and CCK8 was used to detect changes in cell survival rate. Figure 4 B: Cas9 knockout control or PAFAH2 knockout cells were treated with DMSO or RSL3, and the proportion of propidium iodide-positive cells was detected by flow cytometry. Figure 4 C shows cells with Cas9 knockout control or PAFAH2 knockout treated with DMSO or RSL3, and cell death was observed by confocal microscopy. Propidium iodide staining (red) indicates cell death. Figure 4 D: Cas9 knockout control or PAFAH2 knockout cells were treated with DMSO or RSL3 concentration gradient, and CCK8 was used to detect changes in cell survival rate. Figure 4 E: Cas9 knockout control or PAFAH2 knockout cells were treated with DMSO or Erastin concentration gradient, and CCK8 was used to detect changes in cell survival rate. Figure 4 F: Cas9 knockout control or PAFAH2 knockout cells were treated with DMSO or sorafenib concentration gradient, and CCK8 was used to detect changes in cell survival rate. Figure 4 G: Cas9 knockout control or PAFAH2 knockout cells were treated with DMSO or staurosporine concentration gradient, and CCK8 was used to detect changes in cell survival rate. Figure 4 H: PAFAH2 knockout monoclonal cells were pretreated with ferroptosis inhibitors Fer-1 or DFO, apoptosis inhibitor Z-VAD-FMK, necrosis inhibitor Nec-1 and autophagy inhibitor 3-MA, and then treated with RSL3 concentration gradient. The changes in cell survival rate were detected using CCK8. Figure 4 I represents cells with Cas9 knockout control or PAFAH2 knockout treated with DMSO or RSL3, and the changes in the fluorescence intensity of BODIPY 581 / 591C11 in the cells were detected by the FL1 channel of the flow cytometer. Figure 4 J: HT1080 cells were pre-treated with the Fer-1 and PAFAH2 inhibitor ML225, and then treated with RSL3, and cell death was observed by confocal microscopy. Propidium iodide staining (red) indicated cell death. Figure 4 K is HT1080 cells pretreated with the Fer-1 and PAFAH2 inhibitor ML225, then treated with RSL3, and CCK8 was used to detect changes in cell survival rate. Figure 4 L: HUVEC cells were pretreated with DMSO or ML225 and then treated with RSL3 concentration gradients. CCK8 was used to detect changes in cell survival rate. Figure 4 M represents HUVEC cells pretreated with Fer-1 and ML225, and then treated with RSL3, and the changes in the fluorescence intensity of BODIPY 581 / 591C11 in the cells were detected by the FL1 channel of the flow cytometer.

[0051] Figure 5 Renal ischemia-reperfusion can lead to ferroptosis of renal tubular cells. Figure 5 AB was C57 / BL6J mice. After 30 minutes of renal ischemia, the above time gradient was reperfused, and the renal cortex of the mice was collected for qRT-PCR to detect the changes of ferroptosis marker genes PTGST2 and CHAC1. Figure 5 C shows that after 30 minutes of ischemia, the kidney of a C57 / BL6J mouse was reperfused with the above time gradient. The renal cortex of the mouse was collected for polyacrylamide gel electrophoresis to detect changes in the levels of ferroptosis-related proteins. Figure 5 DE was C57 / BL6J mice injected intraperitoneally with Vehicle or Fer-1, and the renal ischemia was 30 minutes and then reperfused for 24 hours. The serum of the mice was collected to detect the level of urea nitrogen, and the kidneys were collected to detect the degree of renal damage and the changes in ferroptosis markers. Figure 5 FH: After 30 minutes of renal ischemia in C57 / BL6J mice, the above time gradient was reperfused. The changes in PAFAH2 protein levels in the kidney were detected by immunohistochemistry (F, G), and the changes in PAFAH2 protein levels in the renal cortex were detected by polyacrylamide gel electrophoresis (H).

[0052] Figure 6 Inhibition of PAFAH2 can significantly promote ischemia-reperfusion injury and ferroptosis of renal tubular cells. Figure 6 AG is C57 / BL6J mice pretreated with Fer-1 and ML225, then underwent ischemia-reperfusion surgery, and the degree of tubular damage was detected by hematoxylin and eosin staining (A, first row), the changes in ferroptosis markers were analyzed by immunohistochemistry (A, second to fourth rows), and the changes in mitochondrial morphology in the proximal tubules were detected by electron microscopy (A, sixth row). The degree of tubular damage was statistically analyzed (B). Statistical analysis was performed on tubules positive for 4-hydroxyarbutyric acid, transferrin receptor, and lipoxygenase staining (CE). Statistics on the length of mitochondria (G). Figure 6 After pretreatment of Fer-1 and ML225, HI C57 / BL6J mice underwent ischemia-reperfusion surgery, and the death of renal tubular cells in mice was detected in vivo by two-photon microscopy (H). The proportion of renal tubules positive for propidium iodide staining was statistically analyzed (I).

[0053] Figure 7 Mice knocked out for PAFAH2 are more susceptible to renal tubular cell ferroptosis and renal injury caused by ischemia-reperfusion. 7A-E After bilateral renal ischemia-reperfusion in wild-type mice of C57 / BL6J and mice knocked out for PAFAH2, the degree of renal tubular injury was detected by hematoxylin and eosin staining (A, first row), and the changes in platelet-activating factor levels were analyzed by immunohistochemistry (A, second row). The degree of renal tubular injury was statistically analyzed (B). The content of urea nitrogen in the serum of mice after 24 hours of reperfusion was detected (C, D). Statistical analysis was performed on renal tubules that were positive for platelet-activating factor staining (E). Figure 7 FH shows the death of renal tubular cells in C57 / BL6J wild-type mice and PAFAH2 knockout mice after ischemia-reperfusion in the left kidney. Two-photon microscopy was used to detect the death of renal tubular cells in vivo (F). In vivo imaging model of mouse kidney (G). Statistical analysis of the proportion of renal tubules positive for propidium iodide staining (H). Figure 7IM: After ischemia-reperfusion in wild-type C57 / BL6J mice and PAFAH2 knockout mice, the changes in the levels of ferroptosis markers 4-hydroxyarbutate, transferrin receptor, and lipoxygenase were analyzed by immunohistochemistry (I). Statistical analysis of renal tubules positive for 4-hydroxyarbutate, transferrin receptor, and lipoxygenase staining was performed (JL). Real-time fluorescence quantitative PCR was used to detect changes in PTGS2 transcription levels in the renal cortex (M).

[0054] Figure 8 Intravenous injection of recombinant human PAFAH2 protein can significantly alleviate renal tubular cell ferroptosis and renal damage caused by ischemia-reperfusion. Figure 8 AB: BSA, purified PAFAH2 protein (0.08 mg / mL) or its enzyme active site mutant (0.08 mg / mL) were mixed into the cell culture medium, and DMSO or RSL3 was added for treatment for 12 hours. Then, photos were taken under a microscope (A), and CCK8 was used to detect changes in cell viability (B). Figure 8 CD was C57 / BL6J mice whose left kidneys were ischemic for 30 minutes. 15 minutes before reperfusion, BSA, purified PAFAH2 protein (20 mg / kg) or its enzyme active site mutant (20 mg / kg) were intravenously injected, and the death of mouse renal tubular cells was detected at the living level by two-photon microscopy (C). The proportion of renal tubules positive for propidium iodide staining was statistically analyzed (D). Figure 8 EK is that the two kidneys of C57 / BL6J mice were ischemic for 30 minutes. 15 minutes before reperfusion, BSA, purified PAFAH2 protein (20 mg / kg) or its enzyme active site mutant (20 mg / kg) were intravenously injected, and the urea nitrogen content in the mouse serum was detected 24 hours after reperfusion (E, F). The degree of tubular damage was analyzed by hematoxylin and eosin staining, and the changes in the content of ferroptosis markers 4-HNE, COX2 and TfR1 were detected by immunohistochemistry (G). The degree of tubular damage, 4-HNE, TfR1 and COX2 positive renal tubules were statistically analyzed (HK). DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0056] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0057] The specific preparation methods of the PAFAH2 knockdown cells and control cells used in the present invention are as follows:

[0058] 1. Plant the cells in a six-well plate, adhere to the wall for 24 hours and perform siRNA transfection after the cell confluence reaches 50%. Since RNA is easily degraded, use a nuclease-free pipette tip and Eppendorf tube for transfection. The siRNA transfection system takes a six-well plate as an example, as shown in Table 1. The siRNA sequence is shown in Table 2, and Negative control (AATTCTCCGCGTGTCCGT) is used as a control.

[0059] Table 1. siRNA transfection system

[0060]

[0061] Table 2. siRNA sequences

[0062] name Target-#1 Target-#2 Target-#3 PAFAH2 CTGGCAACTTGATTGGTAA GAACAGTCTAGGATCATAA GGAGCTTCTTTCGACTCTT

[0063] 2. Replace with fresh complete medium 8 hours after transfection. Cells can be passaged 24 hours after transfection and plated into the wells required for the experiment. Subsequent experiments such as drug addition or staining can be performed 48-72 hours after transfection. The knockdown efficiency of the target gene can be detected by real-time fluorescence quantitative PCR or protein immunoblotting.

[0064] The specific preparation methods of the PAFAH2 knockout cell line and its control cells used in the present invention are as follows:

[0065] 1. Construction of gene knockout plasmid

[0066] 1.1) Design of sgRNA target sequence and PCR primers: For gene knockout plasmids, select a specific 20 bp target sequence before the NGG sequence of the target gene, and add the bases required for enzyme cutting to the 5' end of the plasmid. The sgRNA target sequence is shown in Table 3.

[0067] Table 3. sgRNA target sequences

[0068] name Target-#1 Target-#2 Target-#3 PAFAH2 GCTGGCCTCACGTGGCTTTG GTCATCAGATCCAAGCCACC GCCCAGCAGTGACCTCTTGC

[0069] The PCR primer sequences designed for each target site are as follows:

[0070] Target-#1: FP: CACCGGCTGGCCTCACGTGGCTTTG; RP: AAACCAAAGCCACGTGAGGCCAGC.

[0071] Target-#2: FP: CACCGGTCATCAGATCCAAGCCACC; RP: AAACGGTGGCTTGGATCTGATGAC.

[0072] Target-#3: FP: CACCGGCCCAGCAGTGACCTCTTGC; RP: AAACGCAAGAGGTCACTGCTGGGC.

[0073] 1.2) Primer annealing: Anneal the above synthesized oligonucleotides to obtain annealing products. The targeting primer annealing system is shown in Table 4, and the targeting primer annealing program is shown in Table 5.

[0074] Table 4. Targeting primer annealing system

[0075] Reagents Volume (10 μL) Primer FP targeting target gene (100 μM) 1μL Primer RP targeting target gene (100 μM) 1μL 10×T4 Buffer 1μL <![CDATA[ddH 2 The]]> 7μL

[0076] Table 5. Targeting primer annealing program

[0077] temperature time 37℃ 30min 95℃ 5min ↓ Continue to cool down at a rate of 5°C per minute 25℃ hold

[0078] 1.3) Vector digestion: Perform single digestion on the empty vector of lentiCRISPR to obtain sticky ends that can complement the above annealing products. The digestion system is shown in Table 6. After digestion at 37°C overnight, perform agarose gel electrophoresis and gel recovery to obtain linear lentiCRISPR empty vector fragments that have been successfully digested.

[0079] Table 6. LentiCRISPR vector restriction enzyme digestion system

[0080] Reagents Volume (40μL system) lentiCRISPR empty vector 2μg Restriction endonuclease BbsⅠ 2μL 10×NEB cut Buffer 4μL <![CDATA[ddH 2 The]]> Fill volume to 40 μL

[0081] 1.4) Ligation: The annealed product was connected to the linear lentiCRISPR empty fragment. The ligation system is shown in Table 7.

[0082] Table 7. Gene knockout plasmid connection system

[0083] Reagents Volume (10μL system) lentiCRISPR empty linear fragment 50ng Oligonucleotide annealing product (1 μM) 1μL 10×T4 ligase Buffer 1μL T4 ligase 1μL <![CDATA[ddH 2 The]]> Fill volume to 10 μL

[0084] 1.5) Transformation and identification are the same as above.

[0085] 2. Lentivirus packaging

[0086] 2.1) Knockout of target gene using lentiviral vector lentiCRISPR (Addgene, 52961): In 293T cells, the target gene and viral packaging plasmid were co-transfected. The transfection system was taken as an example of a six-centimeter dish, as shown in Table 8.

[0087] Table 8. Lentivirus packaging system

[0088]

[0089]

[0090] 2.2) Obtaining the virus solution: Gently add the above transfection system to 293T cells and replace with fresh complete medium after 8 hours. Start timing from this time. After 24 hours, collect the cell culture solution once and replace with fresh complete medium. After 48 hours, collect the cell culture solution for the second time. The cell supernatant collected twice is the virus solution. It can be used after filtering with a filter membrane with a pore size of 0.22 microns.

[0091] 3. Lentivirus infection of cells

[0092] 3.1) Infect cells: HT1080 cells that need to knock out PAFAH2 are planted in the corresponding well plates, cultured for 24 hours and when the cell confluency reaches 40%, use the virus solution for infection. During infection, the ratio of virus solution to complete culture medium is 1:1, and Polybrene (10μg / mL) is added to improve the infection efficiency. After the virus solution infects the cells for 12 hours, replace the cells with fresh complete culture medium.

[0093] 3.2) Screening: After 48 hours of infection, the culture medium was replaced with complete culture medium containing 1 μg / mL puromycin and continued to be cultured. After two passages, the cells that still survived were polyclonal cells expressing the puromycin resistance gene.

[0094] 4. Construction of monoclonal cell lines

[0095] The cell lines that have puromycin resistance after screening in the above steps are digested and counted. Take 50 cells and evenly plant them in 96 wells of a 96-well plate. On average, every two wells contain a cell with puromycin resistance. One week later, when the cells grow clones, the wells with more than one clone in each well of the 96-well plate are excluded, and the wells with only one cell clone are monoclonal cell lines. After the clones grow to a certain size, they are expanded to 24-well plates, six-well plates, and 10 cm large dishes. Puromycin needs to be used to maintain the culture during the expansion process. The amplified monoclonal cells are subjected to immunoblotting experiments to determine the efficiency of cell overexpression or knockout.

[0096] The specific method for preparing the PAFAH2 knockout mice used in the present invention is as follows:

[0097] 1. Obtain the sequence information of mouse PAFAH2 gene according to NCBI Gene ID: 100163, and design the target of sgRNA according to NM_133880.3. In this experiment, the entire sequence of exon 3 was selected for shearing, and the two designed sgRNA target sequences were: CCTAGGCTCCGTGCGAACGA and TGCCAGCGTTTGTAGAACTG. Perform in vitro transcription, detect the activity of the transcription product, and prepare Cas9 mRNA.

[0098] 2. Prepare 4-week-old C57BL / 6J female mice and 8-12-week-old C57BL / 6J male mice. Intraperitoneally inject PMSG 0.1mL (5U) / mouse into female mice, and then intraperitoneally inject hCG 0.1mL (5U) / mouse 48h later. Take the eggs for later use after 18h. Take the male mouse epididymis, and then take out the sperm from the epididymis. Select sperm with good vitality and oocytes to obtain fertilized eggs after 3-4h in vitro fertilization. Prepare sgRNA & Cas9mRNA mixture (sgRNA 25ng / μL, Cas9 mRNA 50ng / μL) with RNA-free water, and inject it into the fertilized eggs using a microinjection system. Transplant the injected fertilized eggs into the oviducts of pseudo-pregnant female mice anesthetized by intraperitoneal injection of 12.5mg / mL tribromoethanol, place them in independent ventilation cages for breeding, and identify the genotype after the mice are born.

[0099] 3. The offspring born by the surrogate female mice were named as founders and F0 generation. One week after the F0 generation was born, the toes were cut and numbered, and the mouse genome was extracted by alkaline lysis method. PCR amplification was performed using forward primer F: CCTGATGTAGGGGGACAGGA and reverse primer R: AGACTCTCTGGCTGCCCATA. Reaction conditions: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 58℃ annealing for 35s, 72℃ extension for 1min 30s, a total of 35 cycles; 72℃ extension for 5min; 4℃ maintenance. Take 5μL of PCR product for agarose gel electrophoresis. The length of the wild-type amplified fragment is 1596bp. PCR products that are significantly smaller than this length are sequenced for verification.

[0100] 4. The F0 generation that was verified as positive heterozygotes by genome sequencing was mated with C57BL / 6J WT mice to obtain the F1 generation. After genome identification and sequencing of the F1 generation mice, PAFAH2 + / - The mice were self-fertilized to produce the F2 generation, and then the PAFAH2 gene was finally obtained after identification and sequencing. - / -Mice were cultured and RT-PCR and Western Blotting were used to detect the gene and protein expression of PAFAH2 in PAFAH2 KO mice.

[0101] The C57BL / 6J mice used in the present invention are products of Vital River Company.

[0102] The cell lines and main reagents used in the present invention are as follows: human renal cortical proximal tubule epithelial cells HK2 (CRL-2190), human fibrosarcoma cell line HT1080 (CCL-121), human umbilical vein endothelial cells HUVEC (CRL-1730) and human osteosarcoma cell line U-2OS (HTB-96) are all products of ATCC. All cell lines were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (SORFA, SX5112) at 5% CO 2 , cultured in a 37°C incubator.

[0103] The main reagents used in the present invention and their sources are: RSL3 (B6095) and Deferoxamine mesylate (B6068) are both products of APExBIO. Bovine serum albumin (pH7.0, A602448-0050) is a product of BBI lifesciences. BODIPY 581 / 591C11 (D3861), dextran-488 (10,000 MW) (D22910), dextran-Cascade-blue (10,000 MW) (D1976) and transferrin receptor TfR1 antibody (Invitrogen, 13-6800) are all products of Invitrogen. Erastin (HY-15763), platelet activating factor (HY108635), Ginkgolide B (HY-N0784), 3-Methyladenine (3-MA) ​​(HY-19312), Necrostatin-1 (Nec-1) (HY-15760), Ferrostatin-1 (HY-100579) and Z-VAD-FMK (HY-16658B) are all products of MCE. WEB2086 (SML0233-5 mg), imipramine (I0899-5 g), propidium iodide (PI) (P4170-10 mg) and sodium dithionite (71699-50 g) are all products of Sigma. Calcein (C8950) and corn oil (C7030-500 ml) are all products of Solarbio LifeScience. DDD85646(13839), IMP-1088(25336), Erastin2(27087), Azelaoyl platelet activating factor(60924), Butanoyl platelet activating factor(60928), Butenoyl platelet activating factor(60929), Arachidonoyl platelet activating factor C-16(60904), Platelet activating factor C-18(60910), 2-thio-platelet activating factor(60945), 2-O-methyl platelet activating factor C-16(60902), 2-O-ethyl platelet activating factor C-16(60925), Pyrrolidino platelet activating factor C-16(60909), Docosahexaenoyl platelet activating factor C-16(60903), Hexanolamino platelet activating factor C-16(60905), Methylcarbamyl platelet activating factor C16(60908) and Methylcarbamyl platelet activating factor C8(9000332) are all products of Cayman chemical.PGPC (870602P-5mg), POVPC (870606P-1mg), lysoPC (855675), POPC (850457), POPE (850757), DOPS (840035) and NBD-DPPE (810144) are all products of Avanti Polar Lipids. Antibodies to actin β-actin (ab8226), glutathione peroxidase 4 (GPX4) (ab16739) and SLC7A11 (ab37185) are all products of Abcam. Antibody to PAFAH2 (abx128175) is a product of Abbexa. All other reagents were of domestic analytical grade unless otherwise specified.

[0104] The main experimental methods and specific steps used in the present invention are as follows:

[0105] 1. Detection of mRNA abundance

[0106] The total RNA of the cells was extracted and used as a template for reverse transcription into a cDNA library. The corresponding primers of the target gene were then used for amplification. The abundance of the target gene relative to the internal reference gene Actin was calculated based on the number of amplifications when the SYBR Green fluorescence intensity increased to the set threshold.

[0107] 2. Flow cytometry

[0108] The cells were plated in a 12-well plate, and ferroptosis was induced after the cells grew to the logarithmic phase and the density reached 80%. RSL3, Erastin or Sorafenib was used to induce cell ferroptosis. The cells were collected for flow cytometry analysis before the drug treatment until the cell morphology changed significantly but not before the cells broke. First, the cells were collected into Ep tubes through washing, slight digestion, termination, resuspension and centrifugation. Then, the cells were washed with 1×PBS and centrifuged, and the cells were resuspended in 1×PBS containing propidium iodide (PI, 1μg / mL), filtered into single cells, and transferred to the flow tube for loading.

[0109] Propidium iodide can only penetrate the cell membrane of dead cells, and its fluorescence signal increases sharply after binding to DNA. When using a flow cytometer to detect the fluorescence of propidium iodide using FACS Calibur (BD), use a 488nm laser to excite and collect the fluorescence signal of the FL2 channel (FL2 channel can accept emission light in the range of 564 to 606nm). The experiment uses a cell sample without propidium iodide dye as a negative control to exclude the influence of autofluorescence. 12,000 cells were collected for each sample to calculate the total fluorescence intensity.

[0110] 3. Microscope imaging

[0111] The cells were seeded in a small dish with a glass bottom. When the cells showed significant morphological changes after drug treatment, propidium iodide staining was used to analyze the cell death ratio. First, the cells were washed with 1×PBS. Then, PBS containing propidium iodide (1μg / mL) was replaced and stained for ten minutes. Finally, imaging was performed using a microscope (Zeiss LSM 900). The detection of propidium iodide fluorescence was excited by a 555nm laser, and the red fluorescence signal was collected, while bright field imaging was performed using ESID.

[0112] 4. Detection of cell viability

[0113] When the cells grown in the 96-well plate reach 80% confluency, ferroptosis is induced. Drugs that require pretreatment should be treated in advance according to the required time before the cell death inducer treatment. The prepared drugs are added by replacing the cell culture medium (100 μL / well). During the test, the CCK8 stock solution (10 μL / well) is added, shaken and mixed, and placed in 5% CO 2 Incubate at 37°C in an incubator for about 1.5 hours until the culture solution has an appropriate depth of orange-yellow color, and use a Multiskan Sky microplate reader to detect spontaneous luminescence. Calculate the relative cell survival rate based on the absorbance value (OD = 450nm). Each sample has at least three replicate wells.

[0114] 5. BODIPY 581 / 591C11 detection

[0115] The increase in lipid peroxidation is the most important feature of ferroptosis. Among them, BODIPY 581 / 591C11 fluorescent dye is the most widely used and most reliable indicator in ferroptosis detection. After BODIPY 581 / 591C11 is oxidized in living cells, its emission peak changes from about 590nm to about 510nm, and the fluorescence signal changes from red to green. Therefore, the green fluorescence signal is used to indicate peroxidized lipids. The specific detection steps are as follows: 1) The cells inoculated in a 12-well plate are treated with RSL3, and BODIPY 581 / 591C11 staining analysis is performed 30 minutes after RSL3 treatment. 2) BODIPY 581 / 591C11 (working concentration is 5μM) is mixed into the original culture medium and cultured for another 25 minutes. Then, the cells can be loaded after washing with pre-cooled 1×PBS. 3) Use the 488nm laser of the flow cytometer FACS Calibur (BD) to collect the fluorescence signal of the FL1 channel (FL1 channel can accept emission light in the range of 515-545nm). The experiment used a cell sample without BODIPY 581 / 591C11 as a negative control. 12,000 cells were collected from each sample to calculate the total fluorescence intensity. The green fluorescence intensity of all cells was displayed in a peak graph, and the average value of the total fluorescence intensity was displayed in a statistical graph. The cells can also be inoculated in a small dish with a glass bottom, and the fluorescence changes of BODIPY 581 / 591C11 can be detected using a fluorescence confocal microscope (Zeiss LSM 900). After staining for 25 minutes and washing with 1×PBS, imaging can be performed.

[0116] 6. Liposome-related experiments

[0117] According to the composition of biological membrane phospholipids and experimental requirements, 500 μL of liposomes with a final concentration of 2 mM were constructed in vitro. According to the proportion of various phospholipid components in Table 9, liposomes containing platelet activating factors in different proportions were constructed. The steps are as follows: 1) Mix the components: Since the mother liquor concentrations of various phospholipids are different, the required volumes of various phospholipids need to be calculated based on the molar amount and mixed together in proportion. 2) Nitrogen blowing: Use nitrogen to accelerate the volatilization of the organic solvent used to dissolve the phospholipids and blow it dry as much as possible. 3) Vacuum centrifugation: In order to ensure the complete volatilization of the organic solvent, vacuum centrifuge for 60 minutes. 4) Repeated freezing and thawing: Add 500 μL PBS to the sample with the above organic solvent evaporated clean. Place it on a float, freeze it quickly with liquid nitrogen, and then transfer it to a room temperature water bath to completely melt it. Repeat this process ten times. After the first three meltings, the dissolution can be promoted by shaking. As the number of freeze-thaw times increases, you can gradually see that the liposomes are becoming clearer. 5) Filter membrane: The liposomes obtained above are squeezed and repeatedly passed through a filter membrane with a pore size of 50nm. The purpose is to squeeze the liposomes into similar sizes to eliminate the influence of size on their performance. 6) Electron microscopy observation: Use negative staining electron microscopy or cryo-electron microscopy to observe the morphological structure of the liposomes. 7) Functional detection: Use PBS to dilute the liposomes obtained above to a concentration of 1mM. Take 100μL of liposomes and add them to a black ELISA plate. Use a multifunctional ELISA reader to dynamically monitor the changes in the fluorescence intensity of NBD in real time (Ex=460nm, Em=538nm). Detect once every 30 seconds for a total of 10 minutes. After adding 2μL of sodium dithionite (100mM) to each well using a spray gun, immediately start the detection of NBD fluorescence. Detect once every 30 seconds for a total of 10 minutes. Repeat the addition of 2μL of sodium dithionite and detection until the NBD fluorescence signal remains basically unchanged. Compare the destructive effects of liposomes containing different concentrations of platelet-activating factors on the integrity of the biomembrane.

[0118] Table 9. Composition of liposomes used in the experiment

[0119]

[0120] 7. Detection of platelet activating factor levels

[0121] (1) Platelet Activating Factor ELISA: After specific treatment of cell samples inoculated in a 24-well plate, the supernatant of the cultured cells was aspirated to detect the content of extracellular platelet activating factor. The specific experimental steps were all referred to the Platelet Activating Factor ELISA Kit instructions provided by BioVision.

[0122] (2) Immunofluorescence: 1) Cell climbing: Place a cleaned and disinfected coverslip in a 24-well plate, plant the cells on the coverslip, and wait for them to adhere to the wall and grow to a certain confluence before transfection or drug treatment. 2) Fixation: After washing with PBS, fix with 4% formaldehyde solution for 20 minutes. 3) Punching: After washing with PBS, add 0.2% Triton X-100 solution and punch at room temperature for 1 minute. If the punching time is too long, it will cause mitochondrial damage. 4) Blocking: After washing with PBS, add 4% BSA solution to block for 30 minutes. 0.1% Triton X-100 can be added to the blocking solution to promote the entry of BSA or antibodies. Transfer the coverslip cell side up to a humidified box. 5) Incubate with primary antibody: Dilute the primary antibody with 4% BSA solution and take 80μL to cover the cell side of the coverslip. Incubate overnight at 4℃. 6) Wash the primary antibody: Wash the cells 6 times with 4% BSA solution, two minutes each time. 7) Incubate with secondary antibody: dilute the fluorescent secondary antibody that matches the primary antibody with 4% BSA solution, and take 80μL to cover the cell surface of the coverslip. Incubate at room temperature and away from light for 30 minutes. 8) Wash the secondary antibody: wash 6 times with PBS in the dark. 9) Stain the nucleus: dilute DAPI with PBS, and take 80μL to cover the cells. Incubate for 10 minutes in the dark. 10) Wash the nuclear dye: wash the cells 3 times with PBS solution in the dark, two minutes each time. 11) Seal: take 3μL of sealant to seal the cell surface between the coverslip and the slide, and it can be used for storage and imaging.

[0123] 8. Transmission electron microscopy

[0124] 1) Cells: The cells were aggregated at the bottom of the centrifuge tube and fixed with 2.5% glutaraldehyde (4°C). After fixation with osmium phosphate and gradient alcohol dehydration, the samples were embedded, polymerized and trimmed. Ultrathin sections were made using Leica EMUC6, and the samples were placed on a copper grid and imaged using a Spirit 120kV ultrathin section transmission electron microscope.

[0125] 2) Mouse kidney: After killing the mouse and opening the abdomen, inject physiological saline from the left ventricle with a syringe, drain the blood through rapid perfusion, and then perfuse with 4% formaldehyde and 0.5% glutaraldehyde. Finally, remove the mouse kidney, cut the renal cortex part of 1 cubic millimeter, and fix it with 2.5% glutaraldehyde at 4°C overnight. The subsequent steps are the same as the cell sample preparation method.

[0126] 9. HE staining

[0127] 1) Fixation: Take the mouse kidney after ischemia-reperfusion, fix it with 15mL 4% paraformaldehyde tissue fixative, shake at 4℃ overnight. 2) Dehydration: Take out the mouse kidney and wash it five times with distilled water. Wrap it with gauze, put it in an embedding box, and dehydrate it step by step with gradient ethanol, and maintain each concentration for 1 hour. 3) Transparency: Replace the alcohol with xylene three times. 4) Wax immersion: Soak it in dissolved paraffin for 1 hour, repeat three times. 5) Embedding: Put the tissue block in liquid paraffin and trim it after it hardens. 6) Slicing and baking: Use Leica RM2245 slicer to cut 5μm thick continuous wax slices from the embedded low-temperature wax block, spread it in a 40℃ water bath, and then scoop it onto a slide. After leaving it in a 60℃ baking machine for 1 hour, bake it in a 60℃ oven for 2 hours to prevent the sample from falling off. 7) Dewaxing and hydration: After baking, the slides were dewaxed 3 times with xylene, and then rehydrated with gradient ethanol to replace the xylene in the tissue. Rinse with distilled water. 8) HE staining: Stain with hematoxylin for 1 minute and rinse with distilled water. Soak in hydrochloric acid ethanol for 30 seconds and rinse with distilled water. Stain with eosin stain for 1 minute and rinse with distilled water. The staining time can be adjusted appropriately according to the staining depth. 9) Dehydration and transparency: Dehydrate with gradient alcohol and transparent with xylene 3 times. 10) Sealing and photographing: After sealing with neutral gum, it can be used to detect the degree of damage to the renal tubules. Imaging was completed using a Leica DM4000 B advanced upright microscope.

[0128] 10. Immunohistochemistry

[0129] The preparation of wax slides in immunohistochemistry experiments is the same as (1-7) in the HE staining step, so it will not be repeated here. The remaining steps are as follows: 1) Antigen repair: Transfer the sample in step 7 above into the heated citrate buffer, boil it in a pressure cooker, and expose the antigen sites by high pressure. 2) Inactivation: After defining the boundaries with a tissue oil pen, incubate with 3% H2O2 at room temperature for 10 minutes to consume the peroxidase in the tissue. 3) Blocking: After rinsing with PBS, block with goat serum. 4) Incubate with primary antibody: Add the primary antibody prepared with goat serum and incubate at 4°C overnight. 5) Incubate with secondary antibody: After washing with PBS, add the secondary antibody and protect from light for 1 hour. 6) DAB color development: After washing with PBS, add the diluted DAB color development solution. When the target tissue appears brown and the background does not appear, wash it with PBS immediately to stop the color development. 7) Counterstaining: Soak in hematoxylin for 30 seconds, and rinse with distilled water. Soak in 10% hydrochloric acid ethanol and rinse with distilled water to return to blue. 8) Dehydration: Use graded alcohol dehydration and xylene clearing 3 times. 9) Sealing: Use neutral gum to seal the slides and then use them for imaging.

[0130] 11. Isolation of primary renal tubules

[0131] 1) Take an eight-week-old C57BL / 6J mouse, kill it by cervical dislocation, open the abdomen, and remove both kidneys. After washing with HBSS, place it on autoclaved gauze. Use pointed forceps to peel off the transparent capsule on the outer surface of the kidney and cut off the renal pedicle. Cut it in half along the largest section. Use curved scissors to remove the renal medulla part inside the kidney that is different in color from the renal cortex. Transfer the renal cortex to an Ep tube, add pre-cooled tissue separation buffer (glucose 10mM / L, glycine 5mM / L, alanine 1mM / L, Hepes buffer (pH=7.4) 15mM / L, HBSS to volume), cut it into small pieces of about 1 cubic millimeter with scissors, and transfer it to a 15mL centrifuge tube. 2) Centrifuge at 800rpm, 4℃ for 1 minute, and carefully aspirate and discard the supernatant. 3) Add 5mL collagenase (1mg / ml) and digest at 37℃ for 15 minutes. Mix slightly during digestion. Violent beating and over-digestion will cause the renal tubules to break and break, making it difficult to obtain high-quality renal tubules. 4) Add 5mL F12 medium (10% FBS) to end digestion. 5) Centrifuge at 800rpm, 4℃ for 1 minute, and gently aspirate the supernatant. 6) After resuspending with 5mL HBSS, transfer to an 80-mesh sieve (rinsed in advance) and collect the filtered liquid (containing renal tubules). 7) Gently grind the tissue blocks on the sieve, rinse the sieve with HBSS and collect the filtered liquid (containing renal tubules). 8) Gently drop the filtered solution collected in steps 9 and 10 on a 150-mesh sieve (rinsed in advance). At this time, the renal tubules are blocked above the sieve. Collecting the filtered solution and passing it through the sieve again can increase the yield. 9) Invert the above 150-mesh sieve on a 50mL centrifuge tube, and rinse the renal tubules from the bottom of the sieve into the 50mL centrifuge tube with preheated HBSS. 10) Centrifuge at 800 rpm, 4°C for 2 minutes. Wash once with HBSS. 11) Resuspend in F12 medium containing 1% serum, inoculate in a glass-bottomed dish, and then perform microinjection and imaging.

[0132] 12. Microinjection

[0133] 1) Inoculate tumor cells or renal tubules in a small dish with a glass bottom. After they adhere to the wall, use the Leica AM6000 microscope and the right arm of the Eppendorf FemtoJet 4i micromanipulator for microinjection. 2) Find the tumor cells or renal tubules to be injected under the 10× microscope and move them to the center of the field of view. Lower the freshly made glass needle tip with a diameter of about 2μm below the liquid surface by adjusting the micromanipulator, approaching but not touching the target object. 3) Raise the objective lens to 20×, adjust the focus, adjust the target object to the center of the field of view, and continue to lower the glass needle tip, also approaching but not touching the target object. 4) Raise the objective lens to 40×, adjust the focus, and control the needle tip to move to the top of the target injection site. Quickly lower the needle tip so that it pierces the target injection site. Inject immediately. pi = 100hPa, ti = 0.5s, pc = 10hPa. When microinjecting cells, the needle tip falls in the cytoplasm. When microinjecting the renal tubules, the needle tip should be inserted into the renal epithelial cells or tubular lumen. Try to avoid the needle tip touching the bottom of the glass dish. After the injection is completed, the glass needle is removed from the liquid surface and microscopic imaging can be performed.

[0134] 13. Renal ischemia-reperfusion

[0135] 1) Eight-week-old C57BL / 6J mice were intraperitoneally injected with ML225 (10 mg / kg) or its control once a day for one week. Surgery was performed 24 hours after injection. Ferrostatin-1 (5 mg / kg) was supplemented 2 hours before ischemia-reperfusion. 2) Surgery was started after intraperitoneal injection of tribromoethanol (200 mg / kg) to anesthetize the mice. 3) After fixing the mouse's limbs, the skin outside the right kidney on its abdomen was depilated and disinfected. 4) A wound of about 1 cm was cut at the site, and the right kidney, renal artery and renal vein were found, and clamped with a large micro-hemostatic clip. After clamping, the kidney can be seen to change from pink to dark red immediately. 5) After 30 minutes of ischemia, the hemostatic clip was removed, and the color of the kidney quickly returned to pink, indicating that blood reperfusion was successful. The wound was sutured with 6-0 silk thread and transferred to a heating pad to restore its body temperature. 6) After 24 hours of ischemia-reperfusion, the mice were killed by cervical dislocation, and the right renal cortex was dissected and tested.

[0136] 14. In vivo imaging of mouse kidney

[0137] 1) Anesthetize and fix the mouse, and remove the hair and disinfect the skin outside the left kidney on its back. 2) Cut a wound of about 1 cm on the skin outside the left kidney on the back, clamp the left renal artery and vein with a hemostatic clip, and ischemia for 30 minutes. Removing the hemostatic clip can restore renal blood flow reperfusion. 3) Suture the inner and outer layers of skin at the edge of the wound with 3-0 silk thread to form a wound circle, insert a peptide ring into the wound circle, and fix the peptide ring to the skin by tightening the silk thread. 4) Use neutral resin to stick a round cover glass on the outside of the peptide ring. Place it on a heating pad to restore the body temperature of the mouse. 5) After 24 hours of reperfusion, mouse kidney live imaging can be performed. 6) Before live imaging, anesthetize the mouse by intraperitoneal injection of tribromoethanol. Fix the peptide ring on the back of the mouse on the mouse adapter. Adjust the height of the adapter so that the cover glass is in a horizontal state. 7) Calcein (2 mg / kg) and propidium iodide (0.5 mg / kg) were injected into the periocular vein of mice to indicate live cells and dead cells, respectively. 8) The cell death ratio of the mouse renal tubules was observed using an Olympus FV1200MPE two-photon microscope at 25× magnification. The excitation wavelength was 835 nm (10% laser transmittance), the receiving wavelength of calcein was 495-540 nm, and the receiving wavelength of propidium iodide was 575-630 nm.

[0138] 15. Preparation and purification of wild-type human recombinant PAFAH2 protein, human recombinant PAFAH2 protein with single-point mutation in the enzyme activity site, and human recombinant PAFAH2 protein with triple-point mutation in the enzyme activity site

[0139] 1) According to NCBI Gene ID: 5051, the sequence information of human PAFAH2 gene was obtained, and cloned into the eukaryotic plasmid vector pcDNA3.1 (honorgene, HG-VPI0282) with a His tag by PCR amplification to obtain the wild-type plasmid PAFAH2-WT (the wild-type plasmid PAFAH2-WT is the plasmid obtained by connecting the DNA molecule shown in SEQ ID No.2 to the eukaryotic plasmid vector pcDNA3.1, and the plasmid can express the wild-type human recombinant PAFAH2 protein shown in SEQ ID No.1). Based on this wild-type plasmid, the enzyme activity site single-point mutation plasmid PAFAH2-S236A and the enzyme activity site triple-point mutation plasmid PAFAH2-3 (PAFAH2-S236A / D259A / H314A) were constructed. 2) These plasmids were transfected into HEK 293F cells (density of 1×10 6 / mL), at 37°C, 120 rpm, 5% CO 2After culturing for 48 hours under the conditions of 1500rpm centrifugation for 15 minutes, discard the supernatant and collect the cell pellet. 3) Resuspend the cell pellet with buffer I (300mM NaCl, 50mM Tris pH 8.5) with protease inhibitors, and then lyse the cells in a high-pressure cell crusher (4°C) to obtain a lysate. 4) The lysate was centrifuged at 18,000rpm and 4°C for 40 minutes to obtain a supernatant containing the target protein with the cell debris precipitate removed. The supernatant was first affinity adsorbed with Ni-NTA silicone resin, and then eluted with buffer II (300mM NaCl, 300mM imidazole, 50mM Tris pH 8.5) to obtain human recombinant PAFAH2 protein. 5) The human recombinant PAFAH2 protein was sterilized by filtration with a 0.22μm filter membrane and stored at -80°C.

[0140] Example 1: Platelet-activating factor and its similar phospholipids induce cell ferroptosis

[0141] Ferroptosis is a type of cell death caused by the accumulation of iron-dependent lipid peroxidation. Lipid peroxidation refers to the oxidation reaction of lipids with free radicals, but not all lipids are easily oxidized. Polyunsaturated fatty acids (PUFA) containing diallyl carbon-hydrogen bonds have low bond dissociation energy and are therefore more susceptible to lipid peroxidation by hydrogen abstraction. The esterification of PUFA to form phospholipids requires acyl-CoA synthetase long-chain family member 4 (ACSL4) to catalyze the acylation of fatty acids and lysophosphatidylcholine acyltransferase (LPCAT3) to catalyze the transfer of acylated fatty acids to lysophospholipids. Studies have shown that arachidonic acid (AA) and adrenic acid (AdA) esterified at the sn-2 position of phosphatidylethanolamine are the main substrates for lipid peroxidation during ferroptosis. They are oxidized and catalyzed by lipoxygenases (LOXs) and oxidoreductases (POR, CYB5R1) to become lipid peroxides. Lipid peroxidation catalyzed by oxidoreductases can promote the rupture of lipid membranes containing polyunsaturated fatty acids.

[0142] Further attack of phospholipid peroxides by secondary free radicals will produce oxidized truncated phospholipids. Phospholipid peroxides tend to break near the first and last olefinic bond positions of esterified polyunsaturated fatty acids, producing sn-2 truncated phospholipids. This oxidized truncated phospholipid is structurally similar to platelet activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine, PAF) and has platelet activating factor-like activity, so it is also called platelet activating factor-like phospholipids (platelet activating factor-LPLs).

[0143] The inventors of the present application used various types of platelet-activating factors to treat cells (HK2, HT1080 or HUVEC cell lines), and found that cell viability was significantly affected ( Figure 1 AC). However, only the ferroptosis inhibitors Fer-1 and DFO can inhibit platelet-activating factor-induced cell death ( Figure 1 D). In addition, platelet-activating factor also leads to mitochondrial membrane shrinkage, increased lipid peroxidation, and upregulation of ferroptosis marker genes PTGS2 and CHAC1, which are hallmark features of ferroptosis ( Figure 1 EH). The inventors of the present application have verified whether the most representative oxidatively truncated phospholipids have similar characteristics. The results also showed that the decrease in cell viability caused by the oxidatively truncated phospholipids PGPC and POVPC can also be inhibited by Fer-1 ( Figure 1 I, J). In addition, the inventors of the present application also isolated renal tubules from mouse kidneys and treated the freshly isolated primary renal tubules with platelet-activating factor. The results showed that renal tubular cell death caused by platelet-activating factor could also be inhibited by Fer-1 and DFO ( Figure 1 K, L). Therefore, the inventors of the present application have demonstrated that platelet activating factor and its similar phospholipids can cause cell ferroptosis.

[0144] Example 2: Platelet Activating Factor Directly Leads to Increased Membrane Permeability

[0145] Platelet activating factor is a special type of phosphatidylcholine, which contains a short-chain acetyl group at the sn-2 position instead of a long-chain fatty acid chain. Therefore, the spatial conformation and performance of platelet activating factor are different from those of traditional phosphatidylcholine. The head-to-body ratio of platelet activating factor is greater than that of phosphatidylcholine, which may promote the increase in the curvature of the phospholipid bilayer membrane and change the structure and performance of the biological membrane. The inventors of the present application speculate that during ferroptosis, after the PE-PUFA on the biological membrane is peroxidized, the oxidized truncated phospholipids produced will cause damage to the local membrane phospholipid structure in a small range.

[0146] In order to further explore the specific mechanism of platelet activating factor and its similar phospholipids in causing cell ferroptosis. The inventors of this application constructed liposomes containing different ratios of platelet activating factor or PGPC, and the inner and outer membranes of each liposome contained uniformly dispersed NBD-PE. After adding the reducing agent sodium dithionite, the NBD fluorescence in the outer phospholipid molecules of the intact liposomes will be quenched by sodium dithionite ( Figure 2 A). After adding platelet-activating factor to the liposome, the permeability of the phospholipid bilayer is destroyed and cannot prevent sodium dithionite from entering the liposome, and the NBD fluorescence in the inner leaflet is also quenched ( Figure 2B). This in vitro simulation experiment showed that platelet-activating factor and PGPC would promote the increase of liposome membrane permeability ( Figure 2 C, D), Increased platelet-activating factor and LPLs during ferroptosis may be the cause of cell membrane rupture.

[0147] Example 3: Platelet-activating factor spreads ferroptosis in cell populations

[0148] Different from cell death caused by apoptosis, necroptosis and autophagy, ferroptosis also presents a unique wave-like spatiotemporal propagation feature in the cell population, rather than a random death pattern. Ferroptotic cells can induce ferroptosis in neighboring cells, and this process occurs before the cell membrane breaks down. This means that ferroptotic cells secrete propagation factors that cause ferroptosis in neighboring cells.

[0149] The inventors of this application used ELISA to detect changes in platelet activating factor in HT1080 cells. The results showed that RSL3 treatment can promote the increase of platelet activating factor in cell culture medium ( Figure 3 A). This indicates that when ferroptosis occurs, platelet-activating factor (PAF) in the cell is secreted outside the cell. PAF is a potent lipid mediator that is secreted outside the cell and exerts its lipid mediator function by binding to PAF receptors on adjacent cell membranes. However, knocking down PAF R does not block PAF-induced cell death ( Figure 3 B). This shows that when ferroptosis occurs, cell death caused by the outbreak of platelet-activating factor or platelet-activating factor LPLs is not achieved by activating platelet-activating factor R. This may be because oxidized truncated phospholipids are not effective substrates for platelet-activating factor R. The inventors of the present application speculate that after the oxidized phospholipids are attacked by free radicals, the platelet-activating factor LPLs are rapidly enriched in a small area on the membrane, causing damage to the membrane structure, thereby leading to the occurrence of ferroptosis. In addition, the inventors of the present application also used antagonists of platelet-activating factor R for further verification. The results showed that the platelet-activating factor R antagonists WEB2086 or Ginkgolide B could not inhibit the ferroptosis caused by platelet-activating factor ( Figure 3 C). This indicates that platelet-activating factor R does not participate in the regulation of ferroptosis, and that platelet-activating factor-induced ferroptosis occurs through a platelet-activating factor R-independent mechanism. After platelet-activating factor LPLs are synthesized, they are secreted outside the cell, and the secretion process requires acid sphingomyelinase. After the latter is mobilized, it is translocated from the lysosome to the outer leaflet of the plasma membrane, promoting changes in the structure and fluidity of the plasma membrane, and completing budding and the release of microvesicle particles. The inhibitor of acid sphingomyelinase, imipramine, can significantly inhibit platelet-activating factor C16-induced ferroptosis ( Figure 3D). Dynamin is essential for the formation of clathrin-coated vesicles during endocytosis. Dynamin inhibitor Dynasore can also significantly inhibit platelet-activating factor C16-induced ferroptosis ( Figure 3 E). This indicates that the platelet-activating factor increased in cells during ferroptosis is secreted in a paracrine manner. This exosome is then internalized by the receptor cells, promoting the spread of ferroptosis in the cell population. In summary, the platelet-activating factor and platelet-activating factor LPLs produced in cells during ferroptosis promote the spread of ferroptosis in the cell population through exocytosis and endocytosis, rather than through downstream signals mediated by platelet-activating factor receptors.

[0150] In order to verify that platelet-activating factor is a propagation factor of ferroptosis, the inventors of the present application injected exogenous platelet-activating factor C16 into the cytoplasm of several cells through micromanipulation technology, thereby controlling the stimulation of platelet-activating factor within a small area of ​​these cells. Fluorescence microscopy imaging showed that cells microinjected with platelet-activating factor died rapidly. After a period of time, cells near these dead cells began to die gradually, showing a spatiotemporal pattern of propagation ( Figure 3 F, G). This suggests that ferroptosis caused by platelet-activating factor can induce ferroptosis in the surrounding cells, and platelet-activating factor may act as a lethal factor for this cell death, spreading ferroptosis between cells. In addition, the inventors of the present application used commercial platelet-activating factor neutralizing antibodies (platelet-activating factor Ab) to verify the ability of platelet-activating factor to spread ferroptosis. The results showed that platelet-activating factor Ab can significantly inhibit RSL3-induced cell death ( Figure 3 H, I). This indicates that after RSL3 treatment, the platelet activating factor in the cells increases and is secreted into the extracellular environment. However, the platelet activating factor Ab added to the culture medium cannot effectively enter the cells. It binds to the platelet activating factor in the culture medium and inhibits the cell damage caused by the spread of platelet activating factor. This also proves the function of platelet activating factor as a ferroptosis propagation factor.

[0151] The renal tubules are tissues that are sensitive to ferroptosis. The inventors of the present application isolated the renal tubules of mice and verified the view that platelet-activating factor is a factor that propagates ferroptosis. The specific method is as follows: platelet-activating factor C16 or its control (green) was injected at one end of the primary renal tubules, and platelet-activating factor Ab or IgG (blue) was injected at the other end. The results showed that platelet-activating factor can promote the death of primary tubular cells, and this tubular cell death presents a synchronized death pattern. The death of primary tubular cells promoted by platelet-activating factor can be inhibited by the injected platelet-activating factor Ab, but not by IgG ( Figure 3J, K). In summary, when ferroptosis occurs, platelet-activating factor and platelet-activating factor LPLs in cells increase significantly. Cells can secrete platelet-activating factor LPLs to the outside of the cell, promoting ferroptosis in a platelet-activating factor R-independent manner. Inhibition of exocytosis and endocytosis can effectively inhibit ferroptosis. Platelet-activating factor neutralizing antibodies added to the cell interior or external environment can also effectively inhibit ferroptosis. This shows that platelet-activating factor has the characteristics and functions of a ferroptosis transmission factor.

[0152] Example 4: Platelet-activating factor acetylhydrolase 2 (PAFAH2) has the function of resisting ferroptosis

[0153] PAFAH2 is a highly conserved protein, mainly expressed in the proximal and distal tubules of the kidney, intestinal epithelial cells, hepatocytes and skin cells. PAFAH2 can specifically hydrolyze platelet-activating factor and oxidized truncated phospholipids, but cannot hydrolyze long-chain fatty acyl groups on phospholipids. The inventors of this application used a concentration gradient of RSL3 to treat HT1080 cells with PAFAH2 knockdown and their control cells. The results showed that after PAFAH2 knockdown, the sensitivity of the cells to RSL3 was significantly increased ( Figure 4 A). This indicates that PAFAH2 can protect cells from the stress of ferroptosis. In order to further confirm the function of PAFAH2 in resisting ferroptosis, the inventors of the present application constructed a PAFAH2-knocked-out HT1080 monoclonal cell line. First, the inventors of the present application verified the efficiency of gene knockout and the response of the PAFAH2-knocked-out HT1080 cell line to ferroptosis inducers at the protein level. The inventors of the present application used propidium iodide (PI) staining to indicate dead cells, and used flow cytometry and microscopic imaging techniques to analyze the proportion of cell death. Figure 4 B and Figure 4 As shown in C, the PAFAH2 knockout cell line is more sensitive to RSL3 than its control cell line. In addition, the inventors of the present application also used RSL3 with a concentration gradient to treat PAFAH2 knockout cells and their control cells, and detected the survival rate of cells by CCK8 ( Figure 4 D). It was further verified that after PAFAH2 was knocked out, the sensitivity of cells to ferroptosis increased significantly. In addition to using RSL3 to target and inactivate GPX4, the inventors of the present application also used Class I ferroptosis inducers Erastin and Sorafenib to inhibit the activity of SLC7A11, thereby blocking the supply of cystine and the synthesis of glutathione. The results showed that the PAFAH2 knockout cell line was significantly more sensitive to Erastin and Sorafenib than its control cell line ( Figure 4E, F). In addition, the inventors of the present application also used staurosporine, an apoptosis inducer, to detect whether PAFAH2 knockout HT1080 cells were involved in the regulation of apoptosis. The results showed that there was no significant difference in the response of PAFAH2 knockout cells to apoptosis inducers compared with their control cells ( Figure 4 G). In summary, the ability of PAFAH2-knockout cells to resist ferroptosis stress was significantly reduced, further verifying the role of PAFAH2 in protecting cells from ferroptosis.

[0154] An important feature that distinguishes ferroptosis from other forms of cell death is the massive accumulation of lipid peroxidation. Lipophilic antioxidants, free radical scavengers, and iron chelators can effectively inhibit ferroptosis, but not other forms of cell death. In order to further verify that the cell death promoted by PAFAH2 knockout is ferroptosis, the inventors of the present application used a variety of cell death inhibitors. The results showed that cell death promoted by PAFAH2 knockout can be blocked by inhibitors of ferroptosis such as Fer-1 or DFO, but cannot be inhibited by inhibitors of other forms of death such as Z-VAD-FMK or Nec-1 ( Figure 4 H). This indicates that the cell death promoted by PAFAH2 knockout is ferroptosis. The lipid peroxidation dye BODIPY 581 / 591C11 is a reliable indicator for identifying ferroptosis. The dye makes non-oxidized lipids appear red (emission peak is 590nm) and oxidized lipids appear green (emission peak is 510nm). The intensity of the green fluorescence signal indicates the abundance of peroxidized lipids in the cell. The results show that the PAFAH2 knockout cell line itself does not have significant changes in lipid peroxidation, but when subjected to ferroptosis stimulation, the level of intracellular lipid peroxidation increases sharply ( Figure 4 I). Under the same treatment conditions, only a small number of cells in the control group showed weak lipid peroxidation signals.

[0155] Studies have shown that ML225 specifically inhibits PAFAH2 by carbamylation of the serine (S236) in the active center of PAFAH2. Therefore, the inventors of the present application further verified its function in ferroptosis by inhibiting PAFAH2 at the drug level. The results showed that the sensitivity of cells to ferroptosis increased sharply after selective inhibition of PAFAH2 by pretreatment with ML225 ( Figure 4 JL). In addition, the inventors of the present application also tested the effect of ML225 on lipid peroxidation. The results showed that simple ML225 treatment did not affect the level of intracellular lipid peroxidation. However, ML225 pretreatment significantly increased lipid peroxidation caused by RSL3, and lipid peroxidation promoted by ML225 could be completely inhibited by ferroptosis inhibitors ( Figure 4M). In summary, by regulating PAFAH2 at the gene level and the drug level, the inventors of the present application found that, as a phospholipase A2, PAFAH2 can resist oxidative damage caused by various ferroptosis inducers and protect a variety of cell lines from lipid peroxidation and ferroptosis.

[0156] Example 5: Renal ischemia-reperfusion can cause ferroptosis in renal tubular epithelial cells

[0157] During renal ischemia-reperfusion (I / R), lipid peroxidation accumulates and the level of the secondary product malondialdehyde increases. Ferrostatins and lipoxstatins, inhibitors of ferroptosis, can alleviate severe renal I / R injury. In addition, knockout of GPX4, a core protein that resists ferroptosis, leads to ferroptosis of renal tubular cells and acute kidney injury. This indicates that ferroptosis is activated during ischemia-reperfusion injury.

[0158] The inventors of the present application used C57BL / 6J mice and subjected their right kidneys to ischemia-reperfusion injury. At the same time, mice whose abdominal cavities were cut open to expose the kidneys but not subjected to ischemia were used as sham operation groups. First, the inventors of the present application detected the transcription levels of PTGS2 and CHAC1, the marker genes of ferroptosis, at different time points after ischemia-reperfusion. The results showed that within 48 hours after ischemia-reperfusion, the transcription levels of PTGS2 and CHAC1, the marker genes of ferroptosis, increased significantly, reaching a peak at 24 hours ( Figure 5 A, B). In addition, the inventors of this application detected the changes in key proteins of ferroptosis in the renal cortex. The results showed that the protein levels of transferrin TFR1 and SLC7A11 also increased significantly ( Figure 5 C). This may be a stress response of cells to ferroptosis stimulation. However, the protein level of GPX4 decreased slightly. This indicates that ferroptosis occurs in renal tubular cells during renal ischemia-reperfusion injury.

[0159] In addition, the inventors of this application also used hematoxylin and eosin staining and urea nitrogen detection to analyze the damage of renal tubular ischemia-reperfusion, and detected the changes in urea nitrogen levels in mouse serum after renal ischemia-reperfusion. The results showed that renal ischemia-reperfusion can lead to the increase of renal tubular lumen, disappearance of brushing edges, shedding of cell nuclei into the lumen and increased serum urea nitrogen levels, and pretreatment with the inhibitor of ferroptosis Fer-1 can significantly alleviate these phenotypes ( Figure 5D, E). 4-Hydroxyarrenoic acid is a secondary product of lipid peroxidation, and its increase is considered to be an important feature of ferroptosis at the tissue level. Increased transferrin TFR1 and lipoxygenase COX2 protein can also indicate increased ferroptosis. Immunohistochemical analysis of the content of 4-Hydroxyarrenoic acid, transferrin receptor and lipoxygenase found that ischemia-reperfusion leads to increased levels of these ferroptosis markers, and pretreatment with the inhibitor of ferroptosis Fer-1 can significantly alleviate these phenotypes ( Figure 5 E) This suggests that ischemia-reperfusion induces ferroptosis in renal tubular cells.

[0160] The inventors of the present application used immunohistochemistry and western blot to detect the changes in PAFAH2 protein levels within 48 hours of ischemia-reperfusion injury. The results showed that after 6 hours of ischemia-reperfusion, the PAFAH2 protein level increased sharply. The high level of PAFAH2 content was maintained until the 24th hour after reperfusion. And it decreased significantly at the 48th hour after reperfusion ( Figure 5 FH). The inventors of the present application believe that the increase in PAFAH2 protein levels after renal ischemia-reperfusion is due to the damage of renal tubular cells, and PAFAH2 upregulates its protein to resist oxidative stress through an adaptive response mechanism. This suggests that PAFAH2 may participate in the regulation of renal ischemia-reperfusion injury by inhibiting ferroptosis.

[0161] Example 6: Inhibition of PAFAH2 by ML225 exacerbates acute kidney injury caused by renal ischemia-reperfusion

[0162] The inventors of this application verified the role of PAFAH2 in renal ischemia-reperfusion injury by intraperitoneally injecting ML225 into C57BL / 6J mice for three consecutive days to inhibit PAFAH2. Hematoxylin-eosin staining showed that during ischemia-reperfusion injury, the renal tubules showed tubular dilation, the brush-like edges of the tubules disappeared, and the epithelial cells became flat or detached. After PAFAH2 was inhibited, the renal tubules were significantly damaged when subjected to ischemia-reperfusion ( Figure 6 A, B). The renal tubular damage promoted by ML225 can be effectively alleviated by the ferroptosis inhibitor Fer-1. This indicates that PAFAH2 inhibits renal ischemia-reperfusion injury in a ferroptosis-dependent manner. In addition, the inventors of the present application also detected the changes in important markers of ferroptosis by immunohistochemical staining. MLL25 treatment can significantly promote the staining of 4-hydroxyarsenic acid, transferrin receptor and lipoxygenase caused by ischemia-reperfusion ( Figure 6A, CE). This indicates that ML225 can significantly promote ferroptosis of renal tubular cells during renal ischemia-reperfusion and aggravate ischemia-reperfusion injury. Mitochondrial morphological changes are also one of the important characteristics of ferroptosis. Electron microscopy imaging showed that ischemia-reperfusion led to the fragmentation of mitochondria in renal tubular cells. After PAFAH2 was inhibited, the degree of mitochondrial fragmentation and membrane density were aggravated ( Figure 6 A, G).

[0163] In order to further verify the resistance of PAFAH2 to renal ischemia-reperfusion injury, the inventors of the present application used two-photon in vivo imaging technology to detect the death of renal tubular cells after ischemia-reperfusion. An incision was made on the outside of the left kidney on the back of the mouse, a peptide ring was used as a support, and a coverslip was placed on the skin to perform in vivo imaging of the mouse kidney 24 hours after ischemia-reperfusion. Before in vivo imaging, calcein and propidium iodide were injected intravenously, and imaging was completed within 30 minutes. The results of two-photon microscopy in vivo imaging showed that after 30 minutes of ischemia and 24 hours of reperfusion, a small number of renal tubular cells showed strong propidium iodide staining, while the other renal tubules only had strong calcein staining ( Figure 6 H, I). On the one hand, it shows that calcein and propidium iodide can distinguish the live and dead tubular cells in vivo. On the other hand, it shows that tubular cell death has the characteristics of synchronization. The death of tubular cells is not randomly distributed, but clustered in the damaged tubules. Often all cells in the damaged tubules have strong propidium iodide staining. ML225 causes a significant increase in propidium iodide-stained tubules, but there is still a small part of the tubules that are not invaded ( Figure 6 H, I). Fer-1 can effectively inhibit the death of renal tubular cells promoted by ML225. This indicates that PAFAH2 can effectively resist the synchronized death of renal tubular cells during ischemia-reperfusion injury.

[0164] In summary, during ischemia-reperfusion injury, the PAFAH2 protein level in the mouse renal cortex showed a stress response pattern. Drug inhibition of PAFAH2 led to the aggravation of tubular ischemia-reperfusion injury, and a significant increase in tubular ferroptosis indicators and synchronized cell death. This shows that PAFAH2 can resist renal ischemia-reperfusion injury by inhibiting ferroptosis, providing a new treatment idea for acute kidney injury.

[0165] Example 7: Knockout of PAFAH2 exacerbates renal tubular cell ferroptosis and acute kidney injury caused by renal ischemia-reperfusion

[0166] In order to further verify the role of PAFAH2 in ischemia-reperfusion, the inventors of the present application constructed PAFAH2 knockout mice. Wild-type and PAFAH2 knockout mice were subjected to ischemia-reperfusion surgery, and then the renal tubular damage was analyzed by hematoxylin and eosin staining and serum urea nitrogen detection. The results showed that compared with wild-type mice, PAFAH2 knockout mice showed more severe renal damage after ischemia-reperfusion treatment ( Figure 7 AD). Immunohistochemical analysis of platelet activating factor content found that PAFAH2 knockout mice contained higher levels of platelet activating factor after ischemia-reperfusion (Figure A, E). Platelet activating factor can cause ferroptosis in cells and purified renal tubules in vitro, so the inventors of this application used two-photon microscopy to in situ detect the death of renal tubular cells in PAFAH2 knockout mice after ischemia-reperfusion. The results showed that compared with wild-type mice, PAFAH2 knockout mice contained more cell death after ischemia-reperfusion ( Figure 7 FH).

[0167] In addition, the inventors of this application also used immunohistochemical staining to analyze the changes in important markers of ferroptosis. Compared with wild-type mice, PAFAH2 knockout mice had higher levels of 4-hydroxyarbutin, transferrin receptor, and lipoxygenase signals in the renal tubules after renal ischemia-reperfusion ( Figure 7 I, L). This indicates that PAFAH2 deficiency can significantly promote ferroptosis of renal tubular cells during renal ischemia-reperfusion and aggravate ischemia-reperfusion injury.

[0168] In summary, PAFAH2 knockout mice developed more severe acute kidney injury and tubular cell ferroptosis when faced with ischemia-reperfusion stimulation, which indicates that PAFAH2 has the ability to resist ischemia-reperfusion injury.

[0169] Example 8. Intravenous injection of recombinant PAFAH2 protein helps mice resist ferroptosis and renal injury caused by ischemia-reperfusion. 1. Verification of the ability of purified human recombinant PAFAH2 protein to resist ferroptosis at the in vitro cell level

[0170] The inventors of this application added bovine serum albumin solution, wild-type human recombinant PAFAH2 protein (PAFAH2-WT) solution and human recombinant PAFAH2 protein with single-point mutation in enzyme activity site (PAFAH2-S236A) solution to HT1080 cell culture medium, respectively. The solvent of each protein solution was a buffer solution containing 300mM NaCl and 50mM Tris (pH 8.5). The final concentration of each protein in the cell culture medium was 0.08mg / mL, and RSL3 was used to induce ferroptosis in HT1080 cells. The concentration of RSL3 in the cell culture medium was 0.2μM. The results showed that the addition of wild-type human recombinant PAFAH2 protein can significantly inhibit ferroptosis caused by RSL3 treatment ( Figure 8 A, B), which means that when cells undergo ferroptosis, platelet-activating factor and its similar phospholipids are secreted into the extracellular culture medium, and PAFAH2 inhibits the spread of platelet-activating factor and its similar phospholipids in the cell population by hydrolyzing them in the culture medium.

[0171] 2. Verify the ability of in vitro purified human recombinant PAFAH2 protein to protect against renal injury caused by ischemia-reperfusion in an in vivo animal model

[0172] The inventors of the present application used a micro-hemostatic clamp to subject the left kidney of C57BL / 6J mice to ischemia for 30 minutes. During the ischemia period, 15 minutes before reperfusion, a solution of wild-type human recombinant PAFAH2 protein (PAFAH2-WT), a solution of human recombinant PAFAH2 protein with a single-point mutation in the enzyme activity site (PAFAH2-S236A), and a solution of human recombinant PAFAH2 protein with a triple-point mutation in the enzyme activity site (PAFAH2-S236A / D259A / H314A, abbreviated as PAFAH2-3A) were injected intravenously. The concentration of each protein solution was 2 mg / mL, and the injection dose was 20 mg / kg. After 30 minutes of ischemia, the hemostatic clamp was removed to restore blood reperfusion. After reperfusion for 24 hours, a two-photon microscope was used to detect in situ the death of renal tubular cells in each experimental group of mice after ischemia-reperfusion. The results showed that injection of wild-type human recombinant PAFAH2 protein before reperfusion could significantly inhibit the ferroptosis of renal tubular epithelial cells induced by renal ischemia-reperfusion ( Figure 8 C, D). This indicates that the injection of PAFAH2 protein before reperfusion can block the damage of platelet-activating factor and its similar phospholipids to renal tubular epithelial cells.

[0173] Furthermore, the inventors of the present application used hematoxylin and eosin staining and serum urea nitrogen detection to analyze the damage of renal tubules. The results showed that injection of wild-type human recombinant PAFAH2 protein before reperfusion could significantly inhibit acute renal injury and increase in serum urea nitrogen levels caused by renal ischemia-reperfusion, while PAFAH2 protein with mutations in the enzyme activity site did not have this effect ( Figure 8 EH). In addition, the inventors of the present application also used immunohistochemical staining to analyze the changes in important markers of ferroptosis. The results also showed that injection of wild-type human recombinant PAFAH2 protein before reperfusion could significantly inhibit the increase of 4-hydroxyarsenic acid, transferrin receptor and lipoxygenase staining caused by renal ischemia-reperfusion ( Figure 8 IK).

[0174] In summary, the in vitro purified human recombinant PAFAH2 protein achieves resistance to ischemia-reperfusion injury by clearing platelet-activating factor and its similar phospholipids caused by renal ischemia-reperfusion, blocking the spread of ferroptosis among cell populations.

Claims

1. Use of PAFAH2 protein or a substance that promotes the expression of PAFAH2 protein in the preparation of a product for preventing and / or treating and / or inhibiting ischemia-reperfusion injury.

2. The use according to claim 1, Features: The PAFAH2 protein is the protein shown in R1)-R4) below: R1) The amino acid sequence is the protein shown in SEQ ID No. 1; R2) A fusion protein having the same function obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1); R3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in R1) or R2); R4) A protein having 90% or more identity with the amino acid sequence represented by R1) or R2) or R3) and having the same function.

3. The use according to claim 1 or 2, Features: The PAFAH2 protein inhibits ischemia-reperfusion injury by inhibiting ferroptosis caused by lipid peroxidation.

4. The use according to any one of claims 1 to 3, Features: The ischemia-reperfusion injury includes the injury caused by blood circulation obstruction requiring blood reperfusion during clinical treatment; Alternatively, the diseases requiring blood reperfusion during clinical treatment due to obstructed blood circulation include organ transplantation, sepsis, myocardial infarction or atherosclerosis.

5. The use according to claim 4, Features: The ischemia-reperfusion injury includes the injury caused by reperfusion-like treatment in the ischemic state of tissues or organs; The situations in which reperfusion therapy is performed in a state of tissue or organ ischemia include unblocking microcirculation during shock, relieving coronary artery spasm or cardiocerebral pulmonary resuscitation after cardiac arrest.

6. A product for preventing and / or treating and / or inhibiting ischemia-reperfusion injury, wherein the active ingredient is PAFAH2 protein or a substance that promotes the expression of PAFAH2 protein.

7. The product according to claim 6, Features: The PAFAH2 protein is the protein shown in R1)-R4) below: R1) The amino acid sequence is the protein shown in SEQ ID No. 1; R2) A fusion protein having the same function obtained by fusing a tag protein to the carboxyl terminus and / or amino terminus of the protein shown in R1); R3) A protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in R1) or R2); R4) A protein having 90% or more identity with the amino acid sequence represented by R1) or R2) or R3) and having the same function.

8. The product according to claim 6 or 7, Features: The PAFAH2 protein inhibits ischemia-reperfusion injury by inhibiting ferroptosis caused by lipid peroxidation.

9. The product according to any one of claims 6 to 8, Features: The ischemia-reperfusion injury includes the injury caused by blood circulation obstruction requiring blood reperfusion during clinical treatment; Or, the diseases requiring blood reperfusion during clinical treatment due to obstructed blood circulation include organ transplantation, sepsis, myocardial infarction or atherosclerosis; Or, the ischemia-reperfusion injury includes the injury caused by reperfusion-like treatment in a state of tissue or organ ischemia; Alternatively, the conditions similar to reperfusion therapy performed in a state of tissue or organ ischemia include unblocking microcirculation during shock, relieving coronary artery spasm, or cardiocerebral and pulmonary resuscitation after cardiac arrest.

10. A method for inhibiting ischemia-reperfusion injury, comprising the step of intravenously injecting PAFAH2 protein into a subject.

Images