Application of STX17 in preparation of targeted drug for treating cardiac hypertrophy

Abstract

The invention relates to the technical field of medical biology, in particular to application of STX17 in preparation of a myocardial hypertrophy targeted drug, and provides application of STX17 lactylation in weakening ISO-induced myocardial hypertrophy. The invention also discloses application of biological materials such as a recombinant vector, a transgenic cell line or a recombinant virus containing the STX17 sequence gene in preparation of targeted drugs for treating cardiac hypertrophy, and also comprises a substance capable of performing lactic acid modification on the STX17 sequence gene, and the substance realizes the application by performing lactic acid modification on the STX17. The biological material is expressed or overexpressed in a host animal body, so that the myocardial hypertrophy symptom can be improved.

Description

Technical Field

[0001] The present invention relates to the field of medical biotechnology, and in particular to application of STX17 in the preparation of a targeted drug for myocardial hypertrophy. Background Art

[0002] The main principle of current treatment of myocardial hypertrophy is to relieve symptoms, improve cardiac function, and delay disease progression. The treatment of patients with non-obstructive myocardial hypertrophy mainly focuses on controlling the progression of myocardial hypertrophy, reducing left ventricular filling pressure, alleviating clinical symptoms, and treating and managing complications such as arrhythmias and heart failure; for patients with obstructive HCM, medication, interventional therapy, and surgical procedures can be used to improve symptoms and reduce risks.

[0003] This disease is an autosomal dominant primary cardiomyopathy, mainly caused by pathogenic variants in genes encoding sarcomere-related proteins. However, there is currently no feasible and effective strategy for gene therapy. Summary of the invention

[0004] The purpose of the present invention is to provide an application of STX17 lactic acidification in attenuating ISO-induced myocardial hypertrophy and cardiac remodeling.

[0005] STX17 (Syntaxin 17) is a gene encoding SNARE protein, which is mainly involved in the fusion process of autophagosome and lysosome during cell autophagy. ISO (isoproterenol) induction is commonly used in experimental research in this field, especially in the establishment of myocardial injury models.

[0006] The technical solution of the present invention is:

[0007] Provided is the use of STX17 in the preparation of targeted drugs for the treatment of myocardial hypertrophy.

[0008] Furthermore, the lactylation modification of STX17 is used as a target to realize its application in the preparation of targeted drugs for the treatment of myocardial hypertrophy.

[0009] The nucleotide sequence of STX17 is shown in SEQ ID No.1 or a sequence with a homology of more than 90% with SEQ ID NO.1, and the SEQ ID NO.1 is:

[0010] .

[0011] Furthermore, the present application provides the use of lactylation modification of STX17 K95 as a target in the preparation of a targeted drug for the treatment of myocardial hypertrophy.

[0012] The technical solution of the present invention also includes the use of biological materials such as recombinant vectors, transgenic cell lines or recombinant viruses containing the above-mentioned STX17 sequence gene in the preparation of targeted drugs for treating myocardial hypertrophy, and also includes a substance capable of lactic acid modification of the STX17 sequence gene, and the substance achieves the above-mentioned application through lactic acid modification;

[0013] Furthermore, the lactic acid modification is lysine at position 95 of the STX17 sequence gene.

[0014] The biomaterial can improve the symptoms of myocardial hypertrophy by expressing or overexpressing it in the host animal. The substance can achieve the purpose of reducing the symptoms of myocardial hypertrophy by lactic acid modification of the biomaterial. The effects of the two can be exerted separately or in combination.

[0015] In particular, the present invention provides the use of STX17 lactylation in attenuating ISO-induced myocardial hypertrophy in mice;

[0016] Furthermore, the present invention provides the use of STX17 K95 lactylation in attenuating ISO-induced myocardial hypertrophy in mice.

[0017] By using AAV adeno-associated virus as a vector, STX17 with lactylation modification was specifically expressed in the mouse heart, which attenuated ISO-induced myocardial hypertrophy in mice, especially when targeting STX17 K95 lactylation modification, providing a new treatment strategy for myocardial hypertrophy.

[0018] Specifically, the 95th lysine of STX17 (codon is AAA) was mutated to arginine (codon is CGC) to delete the lactylation of STX17, and PENAAV-cTNT-GFP was used as a vector to construct PENAAV-cTNT-STX17 WT -GFP and PENAAV-cTNT-STX17 K95R -GFP plasmid, in which the cTNT promoter makes STX17 WT and STX17 K95R Heart-specific expression.

[0019] In order to make lactylated STX17 WT and STX17 K95R In mouse heart expression, plasmids PENAAV-cTNT-GFP, PENAAV-cTNT-STX17 WT -GFP and PENAAV-cTNT-STX17 K95R -GFP was packaged into recombinant virus and injected into the tail vein to express STX17 with or without lactylation modification specifically in the heart of C57BL / 6J mice.

[0020] Subsequently, ISO was used to induce myocardial hypertrophy in mice, and Western Blot was used to verify the expression of STX17 and lactylation-deficient variant STX17 in myocardial tissue. K95R The expression of mutants was analyzed by LC3 and P62 / SQSTM to analyze autophagic flux. At the same time, the results of heart size, cardiac ultrasound and myocardial fibrosis showed that STX17 protected cardiac function, while the lactylation-deficient variant STX17 K95R Reduced the protective effect against ISO-induced cardiac hypertrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the plasmid map of PENAAV-cTNT-STX17-GFP in the present invention;

[0022] Figure 2 It is a quantitative analysis diagram of left ventricular ejection fraction EF and left ventricular shortening fraction FS of a mouse echocardiogram in an example of the present invention;

[0023] Figure 3 It is a quantitative analysis of the left ventricular end-diastolic diameter LVIDd and the left ventricular end-systolic diameter LVIDs of mice in the examples of the present invention;

[0024] Figure 4 This is a graph showing the results of hematoxylin and eosin staining (HE staining) of mouse heart tissue in an example of the present invention;

[0025] Figure 5 This is a diagram showing the results of Masson staining of mouse heart tissue in an example of the present invention;

[0026] Figure 6 This is a flow chart of STX17 mouse heart expression in the present invention example;

[0027] Figure 7 The Western Blot verification diagram of STX17 mouse heart expression and the autophagy flux analysis diagram in the examples of the present invention;

[0028] Figure 8 It is a diagram of heart morphology and ultrasonic cardiac parameter analysis in an example of the present invention;

[0029] Fig. 9 These are representative images and analysis diagrams of Masson staining and WGA staining of mouse heart tissue in the examples of the present invention. DETAILED DESCRIPTION

[0030] In this application:

[0031] STX17 WT The nucleotide sequence is the nucleotide sequence of STX17 shown in SEQ ID NO.1.

[0032] STX17 K95R The nucleotide sequence is shown in SEQ ID NO.2, and SEQ ID NO.2 is:

[0033] ATGTCTGAAGATGAAGAAAAAGTGAAATTACGCCGTCTTGAACCAGCTATCCAGAAATTCATTAAGATAGTAATCCCAACAGACCTGGAAAGGTTAAGAAAGCACCAGATAAATATTGAGAAGTATCAAAGGTGCAGAATCTGGGACAAGTTGCATGAAGAGCATATCAATGCAGGACGTACAGTTCAGCAACTCCGATCCAATATCCGAGAAATTGAGAAACTTTGTTTGAAAGTCCGAAAGGATGACCTAGTACTTCTGAAGAGAATGATAGATCCTGTTCGCGAAGAAGCATCAGCAGCAACAGCAGAATTTCTCCAACTCCATTTGGAATCTGTAGAAGAACTTAAGAAGCAATTTAATGATGAAGAAACTTTGCTACAGCCTCCTTTGACCAGATCCATGACTGTTGGTGGAGCATTTCATACTACTGAAGCTGAAGCTAGTTCTCAGAGTTTGACTCAGATATATGCCTTACCTGAAATTCCTCAAGATCAAAATGCTGCAGAATCGTGGGAAACCTTAGAAGCGGACTTAATTGAACTTAGCCAACTGGTCACTGACTTCTCTCTCCTAGTGAATTCTCAGCAGGAGAAGATTGACAGCATTGCAGACCATGTCAACAGTGCTGCTGTGAATGTTGAAGAGGGAACCAAAAACTTAGGGAAGGCTGCAAAATACAAGCTGGCAGCTCTGCCTGTGGCAGGTGCACTCATCGGGGGAATGGTAGGGGGTCCTATTGGCCTCCTTGCAGGCTTCAAAGTGGCAGGAATTGCAGCTGCACTTGGTGGTGGGGTGTTGGGCTTCACAGGTGGAAAATTGATACAAAGAAAGAAACAGAAAATGATGGAGAAGCTCACTTCCAGCTGTCCAGATCTTCCCAGCCAAACTGACAAGAAATGCAGT。

[0034] Example 1: Construction of PENAAV-cTNT-STX17 WT -GFP, PENAAV-cTNT-STX17K95R -GFP plasmid (1) STX17 amplification - polymerase chain reaction (PCR)

[0035] Using pcDNA5 - STX17 WT -Flag, pcDNA5 - STX17 K95R -Flag as the template plasmid, the total reaction system is 50 μL. Add 25 μL of PrimeSTAR Max enzyme, 1 μL of template plasmid, 0.2 μM of upstream primer, 0.2 μM of downstream primer, and ddH 2 O into the PCR tube, flick gently to mix the liquid evenly, centrifuge and then place it in the PCR instrument. Pre - denature at 95 °C for 5 min; denature at 95 °C for 15 s, anneal at 55 °C for 20 s, extend at 72 °C at a rate of 0.2 kb / s, perform 30 cycles from denaturation to extension; fully extend at 72 °C for 5 min, and store at 4 °C.

[0036] (2) Vector amplification - polymerase chain reaction (PCR)

[0037] Using PENAAV - cTNT - GFP as the template, the plasmid map of PENAAV - cTNT - GFP is as shown in Figure 1 shown, the total reaction system is 50 μL. Add 25 μL of PrimeSTAR Max enzyme, 1 μL of template plasmid, 0.2 μM of upstream primer, 0.2 μM of downstream primer, and ddH 2 O into the PCR tube, flick gently to mix the liquid evenly, centrifuge and then place it in the PCR instrument. Pre - denature at 95 °C for 5 min; denature at 95 °C for 15 s, anneal at 55 °C for 20 s, extend at 72 °C at a rate of 0.2 kb / s, perform 30 cycles from denaturation to extension; fully extend at 72 °C for 5 min, and store at 4 °C.

[0038] (3) Agarose gel electrophoresis

[0039] Prepare 50×TAE electrophoresis buffer and dilute it to 1×TAE for standby. Prepare 1% agar gel. Weigh 0.5 g of agarose and add it to 1×TAE, heat it in the microwave until dissolved, add the dye YeaGreen Nucleic Acid GelStain and mix well, then add it to the gel plate mold and insert the comb. After the agarose gel solidifies, remove the comb and place it in the electrophoresis tank to prepare for loading. Before loading, mix the DNA sample with 6×DNA loading buffer and add about 10 μL of electrophoresis Marker. Turn on the electrophoresis instrument, set a constant voltage of 125 V, and run for 20 - 30 min. After electrophoresis, take out the gel block from the mold and place it under the ultraviolet analyzer, check the bright bands according to the Marker, cut the target band with a clean blade, and put it into a 2 mL EPP tube.

[0040] (4) Glue recovery and connection

[0041] The agarose gel containing the target band was recovered using a DNA gel recovery kit (purchased from Sangon Biotech Co., Ltd.). Add 300 μL of binding buffer II and place in a metal bath at 50-60℃ for 10 minutes to completely dissolve the gel. After dissolution, remove it from the metal bath and prepare to load it after cooling. Place the adsorption column EZ Spin Column on a 2mL collection tube, load the dissolved gel onto the column, and let it stand for 1 minute to improve the recovery effect. Centrifuge at 12000rpm for 1 minute, and then load the liquid in the collection tube onto the column again (the same column), centrifuge again at 12000rpm for 1 minute, and discard the waste liquid. Take 500 μL of wash buffer with anhydrous ethanol added, centrifuge and discard the liquid, and perform this step twice. Centrifuge at 12000rpm for 4 minutes to ensure that the residual wash buffer is removed. Open the lid of the adsorption column after idling and place it in a sterilized 1.5mL EP tube, and place it in a metal bath at 55℃ for 10 minutes until the alcohol evaporates. Add 30 μL preheated ddH2O and centrifuge at 12000 rpm for 4 min to elute DNA. Add the fragments and vectors recovered from the gel and the Basic mix into a PCR tube and connect at 50°C for 20 min.

[0042] (5) Plasmid transformation and bacterial culture

[0043] Add an appropriate amount of competent medium to the ligation product, place it on ice for 15 minutes, and then heat shock it in a 42°C water bath for 90 seconds. After heat shock, place it in an ice bath for another 3 minutes. Add LB medium without antibiotics and culture it on a shaking table for 45 minutes. After the shaking is completed, centrifuge at 5000rpm for 5 minutes, and take an appropriate amount of bacterial liquid and evenly spread it on the solid LB medium containing ampicillin resistance. Invert the plate and place it in a 37°C constant temperature incubator for overnight culture. The next day, pick a single clone from the plate, add it to 500μL of the culture medium containing resistance and culture it for about 5 hours, then take 50μL for sequencing.

[0044] (6) Endotoxin-free plasmid extraction

[0045] The bacterial solution with correct sequencing was added to 200 mL of liquid LB medium with corresponding resistance, placed in a 37°C shaker at 220 rpm for about 15 hours, and then DNA was extracted using an endotoxin-free plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.). The bacterial solution cultured overnight was collected in a 50 mL centrifuge tube, centrifuged at 8000 rpm for 2 minutes, and the waste liquid was discarded. 8 mL of solution P1 (containing RNaseA) was added to the centrifuge tube of bacterial precipitation, and vortexed to mix. 108 mL of solution P2 was added, gently turned upside down about 8 times, mixed evenly, and placed at room temperature for 5 minutes. 8 mL of solution P4 was added, turned upside down until a large amount of white flocculent precipitate appeared. Placed at room temperature for 10 minutes. Centrifuged at 8000 rpm for 15 minutes, the supernatant was transferred to the filter CS1, the push handle was pushed to filter, and the filtrate was collected in a clean 50 mL centrifuge tube. 0.3 times the volume of isopropanol was added to the filtrate, mixed evenly and prepared for column loading. Add 2.5mL of equilibrium solution BL to the adsorption column CP6, centrifuge at 8000rpm for 1min, and discard the waste liquid. Transfer the filtrate to the adsorption column CP6, centrifuge at 8000rpm for 1min, and discard the waste liquid (repeat three times). Add 10mL of solution PW to the adsorption column CP6, centrifuge at 8000rpm for 2min, and discard the waste liquid. This step is performed twice. Add 3mL of anhydrous ethanol to the adsorption column CP6, centrifuge at 8000rpm for 2min, and discard the waste liquid. Put the adsorption column CP6 back into the collection tube and centrifuge at 8000rpm for 5min. Put the adsorption column CP6 into a clean collection tube and leave it at room temperature for 10min to dissipate the residual ethanol. Then add 1mL of ddH 2 0, centrifuge at 8000 rpm for 5 min. Transfer the liquid in the collection tube to a 1.5 mL centrifuge tube and use an ELISA reader to quantify the plasmid.

[0046] Finally, PENAAV-cTNT-STX17 was obtained WT -GFP and PENAAV-cTNT-STX17 K95R -GFP two plasmids, such as Figure 1 As shown. Among them, STX17 WT The nucleotide sequence of STX17 is shown in SEQ ID No.1. K95R The nucleotide sequence is shown in SEQ ID No.2.

[0047] Example 2: STX17 WT and lactylation modification deletion variant STX17 K95R Preparation of adeno-associated virus

[0048] Combine PENAAV-cTNT-GFP, PENAAV-cTNT-STX17 WT-GFP, PENAAV-cTNT-STX17 K95R -GFP plasmid was sent to Hangzhou Guannan Biotechnology Co., Ltd., which customized three adeno-associated viruses with virus titers of 3.97×10 13 , 3.0×10 13 , 7.3×10 13 μg / mL.

[0049] Example 3: Construction of isoproterenol ISO-induced myocardial hypertrophy model in mice

[0050] Twelve 7-8-week-old C57BL / 6J mice were divided into ISO group and Vehicle group, with 6 mice in each group. The mice in ISO group were subcutaneously injected with isoproterenol ISO twice a day for 2 weeks, with a dose of 40 mg / kg on days 1-2, 20 mg / kg on days 3-7, and 10 mg / kg on days 8-14, while the mice in Vehicle group were subcutaneously injected with normal saline.

[0051] After 2 weeks of ISO treatment, mice were subjected to echocardiographic analysis. Figure 2 The results showed that compared with the Vehicle group, the cardiac contractile function of mice treated with ISO was significantly impaired, and the left ventricular ejection fraction EF and left ventricular shortening fraction FS decreased. Figure 3 The results showed that the left ventricular end-diastolic diameter LVIDd and the left ventricular end-systolic diameter LVIDs increased.

[0052] The mice were then killed for dissection and fresh heart tissue was isolated and fixed with 4% paraformaldehyde at 4°C overnight. The fixed tissue was rehydrated with graded concentrations of ethanol at room temperature (1 hour each time), and then deaffinity was performed after incubation in xylene for 20 minutes. The tissue was treated with paraffin / xylene (1:1) at 65°C for 1 hour, and then sliced ​​with a microtome. The slices were stained with hematoxylin and eosin (HE staining) and photographed using a Leica Q550 IW imaging workstation. The results are shown in Figure 2. Figure 4 As shown, cardiac inflammation was more obvious in mice after ISO induction compared with the Vehicle group.

[0053] Mouse left ventricular tissue was fixed with 4% paraformaldehyde, embedded in paraffin, and then cut into 10 mm thick sections. The sections were stained with Masson trichrome and the morphology of myocardial cells and the deposition of collagen were observed using a Leica Q550 IW imaging workstation. Figure 5 The results showed that compared with the Vehicle group, the mouse hearts had obvious fibrosis after ISO induction, indicating that the mouse myocardial hypertrophy model was successfully established.

[0054] Example 4: Lactate modification of STX17 WT and delactated STX17K95R Expression in mouse heart

[0055] The experimental process is as follows Figure 6 As shown, 24 7-8 week old C57BL / 6J mice were used as experimental materials, and each group was divided into four groups with 6 mice: Sham control group (no virus injection group), Control group (control virus injection group), STX17 WT Group (injected with STX17 wild-type virus), STX17 K95R Group (injected with STX17 delactated variant virus). The obtained AAV virus was injected into the tail vein, 200 μL / mouse, 1×10 12 μg / mL / mouse. After 20 days, the control group (injected with control virus), STX17 WT Group (injected with STX17 wild-type virus), STX17 K95R The mice in the group (injected with STX17 delactated variant virus) were subcutaneously injected with isoproterenol ISO, and the mice in the sham control group were injected with normal saline. The injection method was the same as that in Example 3.

[0056] In the ISO-induced control group, STX17 WT Group, STX17 K95R Three mice were randomly selected from each group, and 200 mg of heart was taken. The tissue was crushed in PBS + 0.5% Triton, centrifuged at 250xg and 4°C for 5 min, and the supernatant was taken. The supernatant was centrifuged at 15000rpm and 4°C for 30 min, and the loading buffer was added. The heart was incubated at 100°C for 1 h, and Western blot was used to verify the expression of STX17 and STX17 in mouse heart. K95R The results are as follows Figure 7 As shown in the third band in the middle left figure, STX17 and STX17 K95R All expressed.

[0057] Example 4: Effect of lactylation modification of STX17 K95 on promoting autophagic flux in the hearts of mice with myocardial hypertrophy

[0058] The mouse heart tissue samples obtained in Example 4 were used to detect the level of STX17 K95 lactylation modification promoting cardiac autophagy by the turnover of LC3-Ι and LC3-ΙΙ and the degradation of SQSTM1 / P62. Western Blot was performed using LC3 antibodies and SQSTM1 / P62 antibodies. The results are shown in Figure 7 As shown, compared with the Control group, STX17 WT Overexpression of STX17 promoted the turnover of LC3-II and the degradation of p62 / SQSTM1, but overexpression of STX17 K95RThe turnover of LC3-II and the degradation of p62 / SQSTM1 were impaired, indicating that the lactylation modification of STX17 K95 has the effect of promoting cardiac autophagy, n=4, data are mean ± SD, **p<0.01, independent repeated experiments.

[0059] Example 5: Lactylation modification of STX17 K95 improves ISO-induced cardiac enlargement in mice

[0060] The four groups of mice in Example 4, namely, the Sham control group, the Control group, the STX17 group, and the WT Group, STX17 K95R The mice were anesthetized and the cardiac function of the four groups of mice was evaluated by echocardiography. The heart was imaged in a two-dimensional parasternal short-axis view, and the left ventricular intra-dimension diastolic period (LVIDd) and left ventricular intra-dimension systolic period (LVIDs) were measured by m-mode echocardiography, and the shortening fraction (FS%) and ejection fraction (EF%) were calculated, respectively. The mice were then killed and dissected, and the heart tissues were separated. The sizes of the hearts of the four groups of mice were measured and compared.

[0061] The results are as follows Figure 8 As shown, the left figure shows the morphological imaging and echocardiographic results of the heart tissues of the four groups of mice, and the right figure shows the quantitative analysis of EF, FS, LVIDd and LVIDs, where n = 6, data are mean ± standard deviation, **p < 0.01, independent repeated experiments. Compared with the Sham control group, ISO caused the mouse heart to enlarge, STX17 WT The expression of STX17 significantly alleviated the cardiac enlargement caused by ISO, while the lack of STX17 K95 lactylation did not attenuate the cardiac enlargement effect caused by ISO. At the same time, echocardiography results showed that ISO treatment was accompanied by a decrease in EF% and FS% of the mouse heart, an increase in LVIDd and LVIDs, and STX17 WT Overexpression significantly improved these cardiac function parameters, while overexpression of the STX17K95 lactylation-deficient variant slightly improved these cardiac function parameters, indicating that lactylation modification of STX17 K95 can improve ISO-induced cardiac hypertrophy in mice.

[0062] Example 6: Lactation of STX17 K95 improves ISO-induced cardiac inflammation in mice

[0063] Take the Sham control group, Control group, STX17 WT Group and STX17 K95RThe left ventricular tissues of the four groups of mice were fixed with 4% paraformaldehyde, embedded in paraffin, cut into 10 mm thick sections, stained with Masson staining, and then the myocardial cell morphology and collagen deposition were observed under a microscope.

[0064] The results are as follows Fig. 9 The left figure shows representative images of Masson staining and WGA staining of heart tissues of four groups of mice, and the right figure shows quantitative analysis of myocardial fibrosis and myocardial cell cross-sections (n=6). Data are mean ± standard deviation, **p<0.01. Compared with Sham control, ISO leads to myocardial fibrosis, and overexpression of STX17 WT Myocardial fibrosis was significantly improved, while overexpression of the STX17 K95 lactylation deletion variant slightly improved myocardial fibrosis, indicating that lactylation of STX17K95 has the effect of improving cardiac inflammation caused by myocardial hypertrophy in mice.

Claims

1. Application of STX17 in the preparation of targeted drugs for the treatment of myocardial hypertrophy.

2. The use of STX17 according to claim 1 in the preparation of a targeted drug for treating myocardial hypertrophy, characterized in that: The application is achieved by using the lactylation modification of STX17 as a target.

3. Application of STX17 lactylation in attenuating ISO-induced cardiac hypertrophy.

4. The use according to any one of claims 1 to 3, characterized in that: The STX17 nucleotide sequence is shown in SEQ ID No. 1 or a sequence with a homology of more than 90% with SEQ ID NO.

1.

5. Use of a biomaterial in the preparation of a targeted drug for treating myocardial hypertrophy, characterized in that: The biological material is a recombinant vector, a transgenic cell line or a recombinant virus containing the gene of claim 4, or a substance modified by lactic acid of the gene of claim 4.

6. Use of a biomaterial in the preparation of a targeted drug for treating myocardial hypertrophy, characterized in that: The biological material is a substance that can lactate-modify the gene according to claim 4.

7. Use of a biomaterial according to claim 5 or 6 in the preparation of a targeted drug for treating myocardial hypertrophy, characterized in that: The biomaterial of claim 5 is expressed or overexpressed in a host animal, and / or the biomaterial of claim 5 is lactated and modified by the substance of claim 6 to improve the symptoms of myocardial hypertrophy in the host animal.

Images