Application of NE-Adrb2 signal channel targeting reagent in preparation of medicine for treating xerophthalmia

Abstract

The invention provides application of a reagent of a targeted NE-Adrb2 signal channel in preparation of drugs for treating xerophthalmia, and particularly belongs to the technical field of xerophthalmia drugs. The invention provides an application of a reagent of a targeted NE-Adrb2 signal channel in preparation of a medicine for treating xerophthalmia. Specifically, the reagent for targeting the NE-Adrb2 signal channel comprises a reagent for blocking the NE-Adrb2 signal channel. The invention discovers that the NE-Adrb2 pathway plays a direct role in the occurrence of the xerophthalmia, and the targeted NE-Adrb2 signal pathway can be used for preparing the medicine for treating the xerophthalmia. Specifically, the beta2-adrenergic receptor blocker can relieve the severity of the xerophthalmia and achieve treatment of the xerophthalmia, and a new potential strategy is provided for prevention and treatment of the xerophthalmia.

Description

Technical Field

[0001] The present invention belongs to the technical field of dry eye drugs, and in particular relates to the application of a reagent targeting a NE-Adrb2 signaling pathway in the preparation of a drug for treating dry eye. Background Art

[0002] Dry eye disease (DED) is a chronic, multifactorial disease that primarily affects the tear film and ocular surface, causing symptoms such as eye pain, burning sensation, and even visual impairment (1-3). The pathogenesis of dry eye involves tear film instability and increased osmotic pressure, which in turn causes further damage to the ocular surface (4). Among the various causes, chronic stress (including environmental stress and psychological stress) plays a key role in the occurrence and progression of dry eye by disrupting ocular surface homeostasis and aggravating local inflammatory responses (5-8). Previous studies have shown that chronic stress can also trigger activation of the sympathetic nervous system (SNS) (9,10). However, the relationship between the SNS and the pathogenesis of dry eye is still unclear.

[0003] The cornea is mainly innervated by sensory nerves from the ophthalmic branch of the trigeminal ganglion (11). However, recent studies have found that the cornea also has sympathetic innervation from the superior cervical ganglion (SCG) (12-14). Anatomical evidence shows that sympathetic nerves are mainly distributed in the limbal region, serving as a barrier between vascularized conjunctival tissue and avascular corneal tissue (12,15). Studies have shown that sympathetic nervous system (SNS) activation and norepinephrine (NE) release are closely related to corneal alkali burns, pathogen infection, and neovascularization, and these pathological changes can aggravate corneal inflammatory responses (16-18). SNS ablation using 6-hydroxydopamine (6-OHDA) or local depletion of NE by DSP-4 has shown the potential to alleviate inflammatory responses (12,15,19). NE can trigger local inflammatory responses, delay corneal wound healing, promote macrophage activation, regulate chemokine expression, and induce immune cell recruitment, thereby participating in corneal pathological processes (15, 20, 21). These findings provide an important basis for understanding the role of sympathetic nerves in corneal diseases. However, there is currently a clear lack of sympathetic nerve-related drugs in the treatment of dry eye. The relationship between SNS and the pathogenesis of dry eye has not been fully clarified, resulting in a lack of clear direction for the development of sympathetic nerve-based drugs, making it difficult to develop accurate and effective drugs for the treatment of dry eye. This directly leads to great restrictions on doctors' choice of drugs in the clinical treatment of dry eye. Therefore, there is an urgent need to conduct more in-depth research and develop new drugs to meet the actual needs of clinical treatment of dry eye.

[0004] References:

[0005] 1. Craig JP, et al. TFOS DEWS II Definition and Classification Report. Ocul Surf. 2017;15(3):276 - 283.

[0006] 2. Clayton JA. Dry Eye. The New England journal of medicine. 2018;378(23):2212 - 2223.

[0007] 3. Belmonte C, et al. TFOS DEWS II pain and sensation report. The ocular surface. 2017;15(3):404 - 437.

[0008] 4. Stapleton F, et al. TFOS DEWS II Epidemiology Report. The ocular surface. 2017;15(3):334 - 365.

[0009] 5. Tiskaoglu NS, et al. Dry Eye Disease in Patients with Newly Diagnosed Depressive Disorder. Current eye research. 2017;42(5):672 - 676.

[0010] 6. Sano K, et al. Enriched environment alleviates stress - induced dry - eye through the BDNF axis. Scientific reports. 2019;9(1):3422.

[0011] 7. Wang S, et al. Obstructive Sleep Apnea Affects Lacrimal Gland Function. Investigative ophthalmology & visual science. 2022;63(3):3.

[0012] 8.Zhang S,et al.Hyperglycemia Induces Tear Reduction and Dry Eye inDiabetic Mice through theNorepinephrine-α(1)Adrenergic Receptor-MitochondrialImpairmentAxis ofLacrimal Gland.Am JPathol.2023;193(7):913-926.

[0013] 9.Ji YW,et al.The Dopaminergic Neuronal System Regulates theInflammatory Status of MouseLacrimal Glands inDryEye Disease.Investigativeophthalmology&visualscience.2021;62(4):14.

[0014] 10.Cardoso F,et al.Neuro-mesenchymal units control ILC2and obesityvia a brain-adipose circuit.Nature.2021;597(7876):410-414.

[0015] 11.Yu FX,et al.The impact ofsensory neuropathy and inflammation onepithelial wound healing indiabeticcorneas.Progressinretinalandeyeresearch.2022;89:101039.

[0016] 12.Xue Y,et al.Stress systems exacerbate the inflammatory responseafter corneal abrasion insleep-deprivedmice viathe IL-17signalingpathway.MucosalImmunol.2024;17(3):323-345.

[0017] 13.Yun H,et al.Sensory Nerve Retraction and Sympathetic NerveInnervation Contribute toImmunopathology ofMurine Recurrent Herpes StromalKeratitis.Invest Ophthalmol Vis Sci.2022;63(2):4.

[0018] 14.Marfurt CF,et al.Sensory and sympathetic innervation of themammalian cornea.A retrogradetracing study.Invest Ophthalmol Vis Sci.1989;30(3):461-472.

[0019] 15.Xue Y,et al.The mouse autonomic nervous system modulatesinflammation and epithelial renewalafter corneal abrasion through theactivation of distinct local macrophages.Mucosal Immunol.2018;11(5):1496-1511.

[0020] 16.Lasagni VitarRM,et al.AHypothalamic-ControlledNeural ReflexPromotes Corneal Inflammation.Invest Ophthalmol Vis Sci.2021;62(13):21.

[0021] 17.Yun H,et al.Production of the Cytokine VEGF-A by CD4(+)T andMyeloid Cells Disrupts theCornealNerve Landscape andPromotes Herpes StromalKeratitis.Immunity.2020;53(5):1050-1062.e1055.

[0022] 18. Dong Q, et al. Overactivation of Norepinephrine-β2-Adrenergic Receptor Axis Promotes CornealNeovascularization. Invest Ophthalmol VisSci. 2023; 64(3):20.

[0023] 19. Ma

[0024] 20.Liu J,et al.Sympathetic Signals Promote ImmunosuppressiveNeutrophils in Lung Tumors.bioRxiv.2024:2024.2002.2015.580434.

[0025] 21. He S, et al. Sympathetic Nerves Coordinate Corneal Epithelial WoundHealing by Controlling theMobilization of Ly6Chi Monocytes From the Spleen to the Injured Cornea. Invest Ophthalmol Vis Sci. 2023; 64(12):13. Summary of the invention

[0026] The purpose of the present invention is to provide an application of an agent targeting the NE-Adrb2 signaling pathway in the preparation of a drug for treating dry eye. The present invention finds that the norepinephrine-β2-adrenergic receptor (NE-Adrb2) pathway plays a direct role in the pathogenesis of dry eye, and targeting the NE-Adrb2 signaling pathway can be used for the preparation of a drug for treating dry eye.

[0027] The present invention provides application of a reagent targeting NE-Adrb2 signaling pathway in preparing a drug for treating dry eye.

[0028] Preferably, the agent targeting the NE-Adrb2 signaling pathway includes an agent that blocks the NE-Adrb2 signaling pathway.

[0029] The present invention also provides the use of the beta 2-adrenergic receptor blocker in the preparation of a medicine for treating dry eye.

[0030] The present invention also provides the use of a β2-adrenergic receptor blocker in the preparation of a drug having any one of the effects ① to ⑥:

[0031] ①Increase tear secretion;

[0032] ②Improve corneal epithelial barrier function;

[0033] ③ Improve corneal nerve innervation;

[0034] ④ Reduce the expression of matrix metalloproteinases;

[0035] ⑤Improve the inflammatory response of the cornea and conjunctiva;

[0036] ⑥Restore the density of conjunctival goblet cells.

[0037] The present invention also provides the use of the beta 2-adrenergic receptor blocker in the preparation of a drug for down-regulating inflammation-related pathways.

[0038] Preferably, the β2-adrenergic receptor blocker includes ICI 118551.

[0039] The present invention also provides the use of N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride in preparing a medicine for treating dry eye.

[0040] The present invention also provides the use of the beta-adrenergic receptor blocker in the preparation of a medicine for treating dry eye.

[0041] Preferably, the type of dry eye includes aqueous deficiency dry eye or anxiety-depression dry eye.

[0042] Preferably, the drug comprises an external ocular drug.

[0043] The present invention provides the use of an agent targeting the NE-Adrb2 signaling pathway in the preparation of a drug for treating dry eye. The present invention uses a classic dry eye mouse model, and through chronic dry stress combined with scopolamine treatment, it is found that the sympathetic nervous system (SNS) of the model mouse is activated and the level of corneal norepinephrine (NE) is increased. Topical application of NE can directly induce dry eye symptoms in healthy mice by inducing inflammation and immune responses related to dry eye in the cornea. It shows that SNS activation is involved in the onset of dry eye. The present invention finds that the NE-Adrb2 pathway plays a direct role in the onset of dry eye, and targeting the NE-Adrb2 signaling pathway can be used for the preparation of drugs for treating dry eye. Specifically, agents that block the NE-Adrb2 signaling pathway (such as agents for systemic SNS ablation, agents for local NE depletion, and agents for β2-adrenergic receptor blocking) can achieve the treatment of dry eye. The test results show that β2-adrenergic receptor blockers can increase tear secretion, improve corneal epithelial barrier function, improve corneal innervation, reduce the expression of matrix metalloproteinases, improve corneal and conjunctival inflammatory responses, and restore conjunctival goblet cell density; and β2-adrenergic receptor blockers can also downregulate inflammation-related pathways, including TNF, NF-κB, chemokines, and IL-17 signaling pathways. This indicates that β2-adrenergic receptor blockers alleviate the severity of dry eye and can achieve the treatment of dry eye. The present invention provides a new potential strategy for the prevention and treatment of dry eye. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0045] Figure 1The present invention provides a graph showing the analysis results of sympathetic nerve activity and corneal norepinephrine (NE) levels in dry eye mice; wherein, (A) a graph showing the measurement results of tear secretion in mice after scopolamine combined with dryness stress treatment; (B) a graph showing the results of corneal sodium fluorescein staining and scoring on the 7th day after scopolamine injection; (C) a graph showing the comparison of TNF-α and IL-1β mRNA expression levels in the mouse cornea; (D) a representative immunofluorescence image and quantitative analysis result graph of c-FOS+TH+ neurons in the superior cervical ganglion (SCG) 2 hours after scopolamine injection, scale bar: 50 μm; (E) a graph showing the measurement results of NE content in the mouse cornea after scopolamine combined with dryness stress treatment; (F) a graph showing the immunofluorescence staining results of NE in the limbus and central cornea of ​​the mouse, scale bar: 20 μm; the sample size of each group is 3 to 6. Data are expressed as mean ± SEM; *P < 0.05, **P < 0.001, ns indicates no significant difference;

[0046] Figure 2 The results of the alleviating effect of NE depletion on the severity of dry eye provided by the present invention are shown in the figure; wherein, (A) a schematic diagram of the experimental design of dry eye mice treated with 6-OHDA and DSP-4; (B) a diagram showing the measurement results of NE concentration in the mouse cornea on the 7th day of scopolamine modeling; (C) a diagram showing the measurement results of tear secretion in dry eye mice treated with 6-OHDA and DSP-4; (D) a diagram showing the results of corneal sodium fluorescein staining and scoring on the 7th day; (E and F) representative images and quantitative analysis results of MMP3, MMP9 and TUNEL+ cells in the corneal epithelium; scale bar: 20 μm; (G) a diagram showing the comparison of TNF-α and IL-1β mRNA expression levels in the mouse cornea; the sample size of each group was 3 to 6; the data were expressed as mean ± standard error (mean ± SEM); *P<0.05, **P<0.01, ***P<0.001;

[0047] Figure 3 The results of the effect of topical NE eye drops on the occurrence of dry eye in mice provided by the present invention are shown in figure; wherein, (A) a schematic diagram of the experimental design of topical NE eye drops; (B) a diagram showing the measurement of tear secretion in mice after topical NE eye drops; (C and D) a diagram showing the results of corneal sodium fluorescein staining and scoring on the 7th day after NE eye drops; (E) a diagram showing the comparison of the expression levels of TNF-α, IL-1β, Cxcl1 and Cxcl2 mRNA in the mouse cornea; (F) a diagram showing the representative images and quantitative analysis results of MMP3 in the corneal epithelium; (G) a diagram showing the representative images and quantitative analysis results of MMP9 in the corneal epithelium; (H) a diagram showing the representative images and quantitative analysis results of TUNEL+ cells in the corneal epithelium, scale bar: 20 μm; the sample size of each group is 3 to 6; the data are expressed as mean ± standard error (mean ± SEM); *P<0.05, **P<0.01, ***P<0.001, ns indicates no significant difference;

[0048] Figure 4 The present invention provides a result graph showing that Adrb2- / - mice do not respond to NE-induced dry eye; wherein, (A) a result graph showing the expression level of adrenergic receptor mRNA in the mouse cornea; (B) a result graph showing the expression of Adrb2 mRNA in the Adrb2- / - mouse cornea; (C) a result graph showing the measurement of tear secretion in mice after local 10 mM NE instillation; (D) a result graph showing corneal sodium fluorescein staining and scoring on the 7th day after NE instillation; (E) a result graph showing the comparison of TNF-α, IL-1β, Cxcl1 and Cxcl2 mRNA expression levels in the mouse cornea; (F) a representative image and quantitative analysis result graph showing MMP3, MMP9 and TUNEL+ cells in the corneal epithelium, scale bar: 20 μm; the sample size in each group is 3 to 6; the data are expressed as mean ± standard error (mean ± SEM); *P<0.05, **P<0.01, ***P<0.001;

[0049] Figure 5 The results of the relieving effect of β2-adrenergic receptor blocking on the severity of dry eye provided by the present invention are shown in the figure; wherein, (A) a schematic diagram of the experimental design of dry eye mice treated with the β2-adrenergic receptor blocker ICI 118,551 (ICI); (B) a graph showing the measurement results of tear secretion in dry eye mice treated with ICI; (C) a graph showing the results of corneal sodium fluorescein staining and scoring on the 14th day; (D and E) representative images and quantitative analysis results of MMP3, MMP9 and TUNEL+ cells in the corneal epithelium, scale bar: 20μm; (F) a representative image of immunofluorescence staining of TUBB3, scale bar: 20μm; (G) NGF and Sema3a mRNA in the mouse cornea Comparison of expression levels; (H) Comparison of TNF-α and IL-1β mRNA expression levels in mouse cornea; (I and J) Comparison of TNF-α and IL-1β protein levels in mouse cornea and conjunctiva; (K) Comparison of PAS staining of conjunctival goblet cells and goblet cell density, scale bar: 50 μm; sample size for each group was 3 to 6; data are expressed as mean ± standard error (mean ± SEM); *P < 0.05, **P < 0.01, ***P < 0.001;

[0050] Figure 6The invention provides a result diagram of the effect of β2-adrenergic receptor blockade on corneal inflammatory response; wherein, (A) a volcano plot showing the distribution of differentially expressed genes in the cornea of ​​dry eye mice treated with ICI 118551 (ICI) or vehicle; (B) a result diagram of KEGG pathway enrichment analysis (top 10 pathways) of down-regulated genes in the cornea of ​​the ICI-treated group and the vehicle-treated group; (C) a heat map display of differentially expressed genes; (D) a comparison result diagram of Cxcl1, Cxcl2, IL17c and S100a9 mRNA expression levels in mouse cornea; (E) a CD45 immunostaining result diagram of corneal cross-section, scale bar: 50 μm; (F) a representative image of NF-κB p65 nuclear translocation under normal culture medium, 500 mOsM hypertonic culture medium and 500 mOsM hypertonic culture medium combined with ICI treatment, scale bar: 20 μm; (G) p-NF-κB Comparison results of p65 protein levels; (H) Comparison results of TNF-α, IL-1β, CXCL1 and CXCL2 mRNA expression levels in human corneal epithelial cells (HCECs); the sample size of each group was 3 to 4. Data are expressed as mean ± standard error (mean ± SEM); *P < 0.05, **P < 0.01, ***P < 0.001, ns indicates no significant difference;

[0051] Figure 7 This is a graph showing the results of different concentrations of β2-adrenergic receptor blocking to improve the tear secretion level of dry eye mice provided by the present invention;

[0052] Figure 8 This is a graph showing the results of different concentrations of β2-adrenergic receptor blockers provided by the present invention inhibiting the expression of hyperosmotic-induced inflammatory factors;

[0053] Figure 9 A graph showing the comparison of the therapeutic effects of the β2 adrenergic receptor blocker and glaucoma drugs provided by the present invention;

[0054] Figure 10 The results of the restraint stress model are shown in Figure 1. A is the tear secretion result diagram; B is the sodium fluorescein score result diagram; C is the norepinephrine result diagram;

[0055] Figure 11 The figure shows the treatment results of restraint stress dry eye model with β2-AR blocker ICI 118551; A is a schematic diagram of the design of the treatment experiment for restraint stress dry eye mice; B is a figure showing the tear secretion results; C is a figure showing the relative expression levels of TNF-α and IL-1β mRNA. DETAILED DESCRIPTION

[0056] The present invention provides the use of an agent targeting the NE-Adrb2 signaling pathway in the preparation of a drug for treating dry eye. In a specific embodiment, the agent targeting the NE-Adrb2 signaling pathway includes an agent that blocks the NE-Adrb2 signaling pathway. In the present invention, the agent that blocks the NE-Adrb2 signaling pathway includes an agent for systemic SNS ablation, an agent for local NE depletion, and an agent for β2-adrenergic receptor blocking. In a specific embodiment, the agent for local NE depletion includes N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP-4). In a specific embodiment, the type of dry eye includes aqueous deficiency dry eye or anxiety-depression dry eye. In a specific embodiment, the drug includes an ocular topical medication. Dry eye is an inflammatory disease of the ocular surface caused by chronic environmental and psychological stress. More and more evidence shows that the sympathetic nervous system plays a core role in mediating chronic stress responses. The present invention reveals for the first time the direct connection and specific mechanism of action between the pathogenesis of dry eye and SNS activation. The present invention confirms the presence of SNS activation and excessive NE release in the dry eye mouse model induced by chronic dry stress and scopolamine. Systemic SNS ablation or local NE depletion intervention can effectively reduce inflammatory response and alleviate the severity of dry eye. More importantly, the present invention found that local NE eye drops can directly damage corneal barrier function, reduce tear secretion, and induce corneal inflammation in a dose-dependent manner. These results show that chronic stress-induced SNS activation leads to increased corneal NE levels, directly triggering the occurrence and progression of dry eye, revealing a new mechanism of chronic stress-induced dry eye. The present invention discovered the role of the NE-Adrb2 signaling axis in the pathogenesis of dry eye. The present invention confirms that after Adrb2 blockade, among the 208 genes that changed significantly in the cornea of ​​dry eye mice, the top 10 down-regulated pathways are closely related to dry eye-related syndrome reactions. This finding was further verified in an in vitro cultured human corneal epithelial cell experiment, where Adrb2 blockade inhibited the activation of the classical NF-κB signaling pathway and the expression of proinflammatory factors induced by hyperosmotic stress. Consistent with the results of in vivo and in vitro blocking experiments, Adrb2 knockout mice showed resistance to NE-induced dry eye. In summary, these results indicate that SNS activation inducing inflammatory response through the NE-Adrb2 signaling pathway is the main mechanism of dry eye. This invention points out for the first time that chronic stress-induced sympathetic nervous system activation is directly involved in the occurrence of dry eye, and targeting the NE-Adrb2 signaling pathway can become a new strategy for the prevention and treatment of dry eye.

[0057] The present invention also provides the use of a β2-adrenergic receptor (Adrb2) blocker in the preparation of a drug for treating dry eye. In a specific embodiment, the β2-adrenergic receptor blocker includes ICI 118551. In a specific embodiment, the type of dry eye includes aqueous deficiency dry eye or anxiety-depression dry eye. In a specific embodiment, the drug includes an ocular topical medication. The experimental results show that SNS activation and its neurotransmitter norepinephrine induce corneal inflammatory response associated with dry eye through the Adrb2 receptor in the mouse cornea. This discovery provides a new potential strategy for the prevention and treatment of dry eye.

[0058] The present invention also provides the use of a β2-adrenergic receptor blocker in the preparation of a drug having any one of the effects ① to ⑥:

[0059] ①Increase tear secretion;

[0060] ②Improve corneal epithelial barrier function;

[0061] ③ Improve corneal nerve control;

[0062] ④ Reduce the expression of matrix metalloproteinases;

[0063] ⑤Improve the inflammatory response of the cornea and conjunctiva;

[0064] ⑥Restore the density of conjunctival goblet cells.

[0065] In a specific embodiment, the β2-adrenergic receptor blocker includes ICI 118551. In a specific embodiment, the drug includes an ocular topical medication. The test results show that topical application of the β2-AR blocker ICI 118551 for eye drop treatment significantly restored the tear secretion of mice, improved corneal barrier damage, and significantly reduced the fluorescein sodium staining score. ICI118551 treatment significantly inhibited the expression of MMP3 and MMP9 and reduced the apoptosis of corneal epithelial cells. The corneal innervation of mice in the ICI 118551 treatment group was improved, and the inflammatory response of the mouse cornea and conjunctiva was significantly improved. The density of conjunctival goblet cells in the treated group mice was also restored. These results show that Adrb2 antagonism has potential application value in the treatment of dry eye.

[0066] The present invention also provides the use of a β2-adrenergic receptor blocker in the preparation of a drug for downregulating inflammation-related pathways. In a specific embodiment, the β2-adrenergic receptor blocker includes ICI 118551. In a specific embodiment, the drug includes an ocular topical medication. In a specific embodiment, the inflammation-related pathway includes any one or more of the TNF, NF-κB, chemokine and IL-17 signaling pathways. The test results showed that after treatment with ICI 118551, a total of 174 genes were upregulated and 134 genes were downregulated; KEGG pathway analysis showed that inflammation-related pathways (including TNF, NF-κB, chemokine and IL-17 signaling pathways) were significantly downregulated. The expression levels of inflammation-related genes in these pathways were significantly reduced. The results show that antagonizing Adrb2 effectively regulates the inflammatory response associated with dry eye by downregulating key inflammatory pathways such as NF-κB.

[0067] The present invention also provides the use of a beta-adrenergic receptor blocker in the preparation of a drug for treating dry eye. In a specific embodiment, the beta-adrenergic receptor blocker is a beta2-adrenergic receptor blocker. In a specific embodiment, the beta2-adrenergic receptor blocker includes ICI 118551. In a specific embodiment, the type of dry eye includes aqueous deficiency dry eye or anxiety-depression dry eye.

[0068] The present invention also provides the use of N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride in the preparation of a drug for treating dry eye. In a specific embodiment, the type of dry eye includes aqueous deficiency dry eye or anxiety-depression dry eye.

[0069] In a specific embodiment, the drug includes an ocular external medicine. In a specific embodiment, the ocular external medicine includes eye drops. In the present invention, the drug includes a drug for subconjunctival injection.

[0070] To further illustrate the present invention, the application of the reagent targeting the NE-Adrb2 signaling pathway provided by the present invention in the preparation of a drug for treating dry eye is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0071] Example 1

[0072] Animal models

[0073] Female C57 / BL6J mice aged 8 to 12 weeks were used in the experiment and purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. Adrb2 gene knockout mice (Adrb2- / -) were constructed by Nanjing Jicui Yaokang Biotechnology Co., Ltd. (strain number: T007691).

[0074] To establish a mouse model of aqueous deficiency dry eye, mice in the experimental group were subcutaneously injected with scopolamine hydrobromide (0.5 mg / 0.2 ml PBS solution, Abcam, Cat. No. ab141080) three times a day (8:00, 14:00, 20:00) and placed in a dry stress environment for 7 days. Mice in the control group were not treated in any way.

[0075] To systemically deplete norepinephrine (NE), mice in the experimental group were intraperitoneally injected with 6-hydroxydopamine hydrobromide (6-OHDA, MCE, catalog number HY-B1081A, 80 mg / kg, dissolved in 0.9% sterile saline containing 0.1% ascorbic acid), once a day for the first four days (from day -6 to day -3), and then once every three days (from day -3 to day 7), for a total of six injections.

[0076] To locally deplete NE, mice in the experimental group were injected subconjunctivally with 5 μL of N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP-4, neurotoxin, MCE, catalog number HY-103210, 20 mg / mL PBS solution) on day -1 and day 3. Mice in the control group were injected with an equal volume of saline or PBS solution containing 0.1% ascorbic acid.

[0077] To evaluate the effect of NE on dry eye, mice in the experimental group were eye-dropped with 5 μL of 0.2-10 mM NE (MCE, Catalog No. HY-13715A, freshly dissolved in PBS) four times daily for 7 days, and PBS was used as a solvent control.

[0078] To study the effects of β2-AR blockers, dry eye model mice were treated with ICI 118,551 (20 μM, MCE, Catalog No. HY-13951) four times a day for 7 consecutive days, and PBS was used as a solvent control.

[0079] Tear secretion measurement

[0080] The tear secretion was measured using the phenol red cotton thread method (Jingming, catalog number 30059010). The phenol red cotton thread was placed on the conjunctiva of the lower eyelid for 15 seconds, and then the length of the wet part was measured (in millimeters).

[0081] Corneal fluorescein sodium staining

[0082] The degree of corneal damage was assessed by sodium fluorescein staining. 0.25% sodium fluorescein solution (Jingming, Tianjin, China) was used for eye drops, and the staining was observed by slit lamp microscopy (BQ900, Haag-Streit, Bern, Switzerland). The cornea was divided into four quadrants, and the degree of staining in each quadrant was scored independently according to the previously described scoring criteria (Qu M, et al. Therapeutic Effects of STAT3 Inhibition on Experimental Murine Dry Eye. Invest Ophthalmol Vis Sci. 2019; 60(12): 3776-3785).

[0083] Cell culture and treatment

[0084] The culture method of human corneal epithelial cells (HCECs) was referred to the literature (Qu M, et al. Different cellular effects of four anti-inflammatory eye drops on human corneal epithelial cells: independent inactive components. Mol Vis. 2011; 17: 3147-3155). To construct a hypertonic environment, 90 mmol / L NaCl was added to the culture medium to make the osmotic pressure reach 500 mOsm. The cells were cultured in isotonic (312 mOsM) or hypertonic (500 mOsM) culture medium, and 20 μM ICI 118551 was added to the treatment group. After 12 hours of treatment, the cells were collected for RNA extraction and Western blot analysis.

[0085] Real-time quantitative PCR (qPCR)

[0086] Using TransZol TM Total RNA was extracted from mouse cornea and HCECs using the Up Plus RNA kit (Beijing Quanshijin Biotechnology Co., Ltd.), and cDNA was synthesized using the Hiscript First-Strand cDNA Synthesis Kit (Nanjing Novogene Biotechnology Co., Ltd.). Quantitative PCR reactions were performed using SYBR Green reagent (Roche, Germany) on an Applied Biosystems 7500 real-time fluorescence quantitative PCR system (Applied Biosystems, USA). The primer sequences are shown in Table 1.

[0087] Table 1 Primer sequences used for qPCR

[0088] Gene Forward primer (SEQ ID NO.) Reverse primer (SEQ ID NO.) m-TNF-α ACAAGGCTGCCCCGACTAC(1) TGGGCTCATACCAGGGTTTG(2) m-IL-1β CTTTCCCGTGGACCTTCCA(3) CTCGGAGCCTGTAGTGCAGTT(4) m-Cxcl1 TGTCAGTGCCTGCAGACCAT(5) CAAGGGAGCTTCAGGGTCAA(6) m-Cxcl2 GGCTGTTGTGGCCAGTGAA(7) ACTTTTTGACCGCCCTTGAGA(8) m-Adrb1 CTCATCGTGGTGGGTAACGTG(9) ACACACAGCACATCTACCGAA(10) m-Adrb2 GTGCCACCCACAAGAAAGCT(11) CCTGGAAGACCCGGGAATAG(12) m-Adrb3 GGCCCTCTCTAGTTCCCAG(13) TAGCCATCAAACCTGTTGAGC(14) m-NGF GCCAAGGACGCAGCTTTCTA(15) TTCAGGGACAGAGTCTCCTTCTG(16) m-Sema3a GGAGACTTGGCATGACCTAGAAG(17) ATGTCACAGCGGTGTAGAGGAA(18) m-IL-17c TCGCATCGACACAGATGAGAA(19) GGCTGTCGCCGTAGTACCA(20) m-S100a9 GCACAGTTGGCAACCTTTATGAA(21) CTCATGACAGGCAAAGATCAACTT(22) m-β-actin ACGGCCAGGTCATCACTATTG(23) AGAGGTCTTTACGGATGTCAACGT(24) h-TNF-α TGTAGCCCATGTTGTAGCAAACC(25) GAGGACCTGGGAGTAGATGAGGTA(26) h-IL-1β CTGAGCACCTTCTTTCCCTTCA(27) TGGACCAGACATCACCAAGCT(28) h-CXCL1 GGGAATTCACCCCAAGAACAT(29) GTCACTGTTCAGCATCTTTTCGA(30) h-CXCL2 GCCCCTGGCCACTGAACT(31) CAAGCTTTCTGCCCATTCTTG(32) h-GAPDH CATGTTCGTCATGGGTGTGAA(33) GGCATGGACTGTGGTCATGAG(34)

[0089] Immunofluorescence staining

[0090] For immunofluorescence staining, superior cervical ganglion (SCG) and ocular tissues were embedded in OCT and sectioned to 7 μm thickness. Sections were fixed with 4% paraformaldehyde (PFA) for 10 min and subsequently washed with PBS. SCG sections were permeabilized with 3% Triton X-100 in PBS for 30 min. Both SCG and corneal sections were blocked with 5% donkey serum for 1 h at room temperature and then incubated with primary antibodies overnight at 4°C. Human corneal epithelial cells (HCECs) were fixed with 4% PFA for 10 min, permeabilized with 0.3% Triton X-100 for 15 min, blocked with 5% donkey serum, and incubated with primary antibodies. All samples were detected using Alexa dye-labeled secondary antibodies (Invitrogen), and images were acquired using a ZEISS LSM880 inverted microscope (ZEISS, Germany). Information on the primary antibodies used is shown in Table 2.

[0091] TUNEL staining

[0092] To evaluate corneal epithelial cell apoptosis, frozen ocular tissue sections were subjected to in situ TUNEL assay (Roche, Cat. No. 11684817910) according to the reagent instructions. The sections were counterstained with DAPI, and images were collected by fluorescence microscopy (Nikon).

[0093] ELISA analysis

[0094] Corneal or conjunctival tissues from four eyes were collected and combined into one sample. According to the instructions of the ELISA kit, the levels of norepinephrine (Abnova, Catalog No. KA3836), TNF-α (Proteintech, Catalog No. KE10002) and IL-1β (Proteintech, Catalog No. KE10003) were detected respectively. The absorbance was measured at a wavelength of 450 nm using an ELISA reader (Molecular Devices, USA), and the protein concentration was calculated according to the standard curve.

[0095] Histology and staining

[0096] Mouse eyeballs were fixed with 4% paraformaldehyde (PFA), embedded in paraffin and sliced ​​at a thickness of 4 μm. The slices were stained with hematoxylin-eosin (H&E) and PAS (MXB, Fuzhou, China) according to the instructions of the reagents. Representative images of the staining results were collected by optical microscopy (Nikon, Tokyo, Japan).

[0097] RNA sequencing and data processing

[0098] Fourteen days after scopolamine hydrobromide injection, corneal tissues of dry eye mice treated with and without ICI 118551 were collected (four corneas were pooled in each group), and total RNA was extracted. Libraries were constructed using the VAHTS Universal V6 RNA-seq Library Construction Kit (Novozyme Biotech) and sequenced on an Illumina NovaSeq 6000 sequencing platform (Illumina, San Diego, USA). Sequencing services were provided by Shanghai Ouyi Biotech. The raw sequencing data were saved in fastq format, and low-quality reads were filtered using fastp software to obtain high-quality clean reads. Subsequently, clean reads were aligned to the reference genome using HISAT2. Gene expression levels were expressed as fragments per kilobase per million reads (FPKM), and read counts were calculated by HTSeq-count. Principal component analysis (PCA) was performed in R 3.2.0 to evaluate sample reproducibility. Differential expression analysis was performed using DESeq2 software, with the screening criteria of Q value < 0.05 and expression fold change > 2 or < 0.5 to identify significantly differentially expressed genes (DEGs). Based on the hypergeometric distribution test, KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis was performed on differentially expressed genes using R 3.2.0 to screen for significantly enriched biological pathways (the significance threshold is usually p value < 0.05 or corrected Q value < 0.05).

[0099] Western blotting

[0100] Human corneal epithelial cells (HCECs) in each group were lysed with pre-cooled RIPA lysis buffer (containing protease inhibitor cocktail, Roche, Germany). Proteins were separated by SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 5% BSA for 1 hour at room temperature and then incubated with primary antibodies (see Table 2) at 4°C overnight. After washing three times with TBST, the membranes were incubated with goat anti-rabbit secondary antibodies (Zhongshan Jinqiao, Beijing, China, Cat. No. ZDR-5306, 1:3000 dilution) at room temperature for 1 hour. Protein bands were detected by enzyme-linked chemiluminescence using an ECL kit (Chemicon, Temecula, USA), and the grayscale values ​​of the images were analyzed using Image J software (NIH, USA).

[0101] Table 2 Information of primary antibodies used in immunofluorescence staining and Western blotting

[0102]

[0103]

[0104] IF: Immunofluorescence staining, WB: Western Blot

[0105] Statistical analysis

[0106] Statistical analysis was performed using GraphPadPrism 8.0 software. Unpaired two-tailed Student's t test was used for comparison between two groups; one-way analysis of variance (ANOVA) was used for comparison between multiple groups, followed by Tukey's post hoc test. Data are presented as mean ± standard error (mean ± SEM), and P values ​​< 0.05 were considered statistically significant.

[0107] Study ethics approval

[0108] All experimental protocols of the present invention were approved by the Ethics Committee of Shandong Institute of Ophthalmology. All experimental operations were carried out in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement on the Use of Animals in Ophthalmic and Vision Research.

[0109] Chronic dry eye stress increases SNS activity and corneal NE levels

[0110] In order to explore the relationship between chronic dry eye stress and sympathetic nervous system (SNS) activation, the present invention used scopolamine combined with chronic dry stress to induce dry eye mouse model. The experiment lasted for 7 days, and healthy mice of the same age were used as controls. The results showed that the tear secretion of mice treated with scopolamine decreased rapidly, and by the 7th day it dropped to 30% of the normal level ( Figure 1 A in the figure), and the corneal epithelial barrier function was impaired, with the score increased by 3.4 times compared with the control group mice ( Figure 1 Quantitative PCR results further confirmed that the transcription levels of TNF-α and IL-1β were significantly upregulated in the cornea of ​​dry eye mice ( Figure 1 In addition, the number of c-FOS+TH+ neurons in the superior cervical ganglion (SCG) of dry eye mice increased significantly ( Figure 1 D in Figure 1). ELISA assay showed that the norepinephrine (NE) content in the cornea of ​​dry eye mice increased significantly starting from the fifth day of scopolamine treatment ( Figure 1 E in Figure 3). Immunofluorescence staining results showed that the elevated NE was mainly distributed in the limbal and central corneal epithelial regions of dry eye mice, and the staining intensity in the limbal region was higher than that in the central cornea ( Figure 1 F). Taken together, these results indicate that dry eye stress can induce SNS activation and increase corneal NE levels, suggesting that SNS activation may be involved in the pathogenesis of dry eye.

[0111] Systemic and local NE depletion alleviates the severity of dry eye

[0112] In order to explore the role of sympathetic nerve activation in the pathogenesis of dry eye, the present invention conducted systemic SNS ablation and local NE depletion experiments in a scopolamine-induced dry eye mouse model. Systemic SNS ablation was achieved by intraperitoneal injection of the selective neurotoxin 6-OHDA, while local NE depletion was achieved by subconjunctival injection of the neurotoxin DSP-4 ( Figure 2 The results showed that systemic SNS ablation significantly reduced NE levels in the cornea of ​​dry eye mice ( Figure 2 At the same time, compared with the control group, the tear secretion of dry eye mice with SNS ablation increased by 2 times on the 7th day ( Figure 2 C in Figure 1). Keratopathy was significantly improved, as indicated by a decrease in corneal score ( Figure 2 D in the figure), decreased expression of MMP3 and MMP9, and decreased epithelial cell apoptosis ( Figure 2 E and Figure 2 F), and down-regulation of TNF-α and IL-1β mRNA transcription levels ( Figure 2 Similar increases in tear secretion and improvements in corneal lesions were observed in dry eye mice with local NE depletion by subconjunctival injection of DSP-4 ( Figure 2 B~ Figure 2 G in Figure ). Therefore, these results indicate that both systemic SNS ablation and local NE depletion can effectively alleviate the severity of dry eye in mice, further confirming the key role of elevated NE levels in the pathogenesis of dry eye.

[0113] Topical NE application directly induces dry eye symptoms

[0114] In order to explore the potential role of norepinephrine (NE) in the pathogenesis of dry eye, the present invention applied NE to healthy mice topically 4 times a day for 7 days, with a NE concentration of 0.2-10 mM ( Figure 3 The results showed that the tear secretion of all NE-treated mice was reduced, and the higher the NE concentration, the more significant the reduction in tear secretion, indicating that the effect of NE on reducing tear secretion is concentration-dependent ( Figure 3 (B). On day 7, tear secretion in the 2mM and 10mM NE-treated mice decreased to 61% and 58% of that in the control group, respectively. However, tear secretion in the 0.2mM NE-treated mice was significantly reduced on day 3, but fully recovered on day 7. Similarly, the sodium fluorescein staining score showed that there was no significant difference between the 0.2mM NE-treated mice and the control group, while the scores of the 2mM and 10mM NE-treated mice were significantly higher than those of the control group ( Figure 3 C and Figure 3Quantitative PCR results showed that the mRNA transcription levels of TNF-α, Cxcl1, and Cxcl2 in the corneas of all NE-treated mice were significantly upregulated in a dose-dependent manner, while the transcription level of IL-1β was only increased in the corneas of the 2mM and 10mM NE-treated mice ( Figure 3 Immunofluorescence staining further showed that the staining intensity of MMP3 and MMP9 in the corneal epithelium of all NE-treated mice increased significantly in a dose-dependent manner ( Figure 3 F and Figure 3 G in Figure 1). TUNEL staining results showed that apoptosis occurred in the corneal epithelial cells of mice in the 2mM and 10mM NE treatment groups, while no obvious apoptosis was observed in the 0.2mM NE treatment group and the control group ( Figure 3 Taken together, these results indicate that NE can directly induce dry eye symptoms in mice, further confirming the role of NE in the pathogenesis of dry eye.

[0115] Adrb2 knockout blocks NE-induced dry eye symptoms

[0116] The sympathetic nervous system functions by releasing norepinephrine (NE) and interacting with adrenergic receptors. In order to identify the key receptors involved in the pathogenesis of dry eye, the present invention detected the mRNA expression level of adrenergic receptors in the cornea and found that Adrb2 had the highest expression, followed by Adrb1 and Adra3 ( Figure 4 In order to explore the potential role of the NE-β2-adrenergic receptor (β2-AR) pathway, the present invention further used Adrb2 knockout (Adrb2- / -) mice and wild-type mice as controls to compare their responses to NE-induced dry eye. The results showed that the expression of Adrb2 in the cornea of ​​Adrb2- / - mice was significantly reduced ( Figure 4 The results showed that topical NE eye drops induced a decrease in tear secretion in wild-type mice, but this phenomenon was not observed in Adrb2- / - mice ( Figure 4 C). Sodium fluorescein staining scores showed that corneal lesions in Adrb2- / - mice were significantly improved and the scores were reduced ( Figure 4 In addition, the expression levels of TNF-α, IL-1β, Cxcl1, and Cxcl2 in the cornea of ​​Adrb2- / - mice were significantly lower than those in wild-type mice ( Figure 4 At the same time, the expression of MMP3 and MMP9 and the number of apoptotic epithelial cells in the cornea of ​​Adrb2- / - mice were significantly reduced ( Figure 4 These findings strongly support a direct role for the NE-Adrb2 pathway in the pathogenesis of dry eye disease.

[0117] Topical application of Adrb2 blockers to relieve dry eye symptoms

[0118] To verify the role of NE-Adrb2 signaling pathway in dry eye, the present invention applied β2-AR blocker ICI 118551 for eye drop treatment 7 days after scopolamine injection and the dry eye model was successfully established ( Figure 5 The results showed that after 5 days of ICI118551 eye drops treatment, the tear secretion of mice was significantly restored, increasing by 2.2 times compared with the control group ( Figure 5 At the same time, the corneal barrier damage of mice in the ICI 118551 treatment group was improved, and the fluorescein sodium staining score was significantly reduced ( Figure 5 C). Immunofluorescence staining showed that ICI 118551 treatment significantly inhibited the expression of MMP3 and MMP9 and reduced the apoptosis of corneal epithelial cells compared with the control group ( Figure 5 D and Figure 5 E in it). Given the key role of corneal nerve innervation in tear secretion (EfraimY, et al. A synthetic tear protein resolves dry eye through promoting corneal nerve regeneration. Cell Rep. 2022; 40(9): 111307), the present invention further evaluated the changes in corneal nerve fibers by anti-Tubb3 immunostaining. The results showed that the nerve fiber density in the limbal and central corneal epithelial regions of dry eye mice was significantly reduced, while the corneal nerve innervation of mice treated with ICI118551 was improved, and the nerve fibers extended to the surface epithelium ( Figure 5 In addition, ICI 118551 treatment significantly increased the mRNA expression level of the neurotrophic factor NGF in the cornea of ​​dry eye mice, while reducing the mRNA expression level of the repulsive axon guidance factor Sema3a ( Figure 5 G), indicating that antagonizing Adrb2 has an improving effect on corneal innervation. RT-PCR and ELISA results further confirmed that the inflammatory response of the mouse cornea and conjunctiva was significantly improved after ICI118551 treatment ( Figure 5 H- Figure 5 At the same time, PAS staining showed that the density of conjunctival goblet cells in the treated mice was also restored ( Figure 5 Taken together, these results suggest that Adrb2 antagonism has potential application in the treatment of dry eye disease.

[0119] Antagonism of Adrb2 regulates dry eye-related inflammatory responses

[0120] To elucidate the mechanism of action of Adrb2 blocking, the present invention performed RNA-seq analysis on the corneas of dry eye mice treated with ICI 118551 or solvent. The results showed that after ICI 118551 treatment, a total of 174 genes were upregulated and 134 genes were downregulated ( Figure 6 A in Figure 2). KEGG pathway analysis showed that the classic inflammatory pathways associated with dry eye (including TNF, NF-κB, Chemokine, NOD-like receptors, and IL-17 signaling pathways) were significantly downregulated ( Figure 6 Heat map analysis further showed that the expression levels of inflammation-related genes in these pathways were significantly reduced ( Figure 6 C in Figure ). qRT-PCR results confirmed that the expression levels of Cxcl1, Cxcl2, IL17c, and S100a9 in the cornea of ​​mice treated with ICI 118551 were significantly decreased compared with those in the solvent group ( Figure 6 In addition, CD45 staining showed that the inflammatory cell infiltration in the cornea of ​​mice treated with ICI 118551 was significantly reduced ( Figure 6 E in it). The present invention further focuses on the NF-κB signaling pathway, which plays a key role in innate and adaptive immune responses and is closely related to cytokine production (Zhang J, et al.Calcitriol, the ActiveMetabolite of Vitamin D (3), Inhibits Dry Eye Related Corneal Inflammation InVivo and In Vitro. Ocul Immunol Inflamm. 2019; 27 (2): 257-265). Using human corneal epithelial cells (HCECs), the present invention studied the effect of ICI 118551 on NF-κB activation under hyperosmotic stress. Immunofluorescence staining showed that hyperosmotic stress induced the translocation of NF-κB from the cytoplasm to the nucleus, and this process was significantly inhibited by ICI 118551 ( Figure 6 In addition, hyperosmotic stress significantly increased the phosphorylation level of NF-κB, while ICI 118551 treatment reduced this level by approximately 30% ( Figure 6 Meanwhile, ICI 118551 treatment significantly reduced the mRNA levels of TNF-α, IL-1β, and CXCL1 under hyperosmotic stress, but had no significant effect on the expression of CXCL2 ( Figure 6 Taken together, these results suggest that antagonizing Adrb2 effectively regulates dry eye-related inflammatory responses by downregulating key inflammatory pathways such as NF-κB.

[0121] Example 2

[0122] 20μM~1mM ICI can treat dry eyes and increase tear secretion in dry eye mice

[0123] After the dry eye model was successfully established by scopolamine injection for 7 days, mice were treated with topical application of different concentrations (20 μM, 100 μM, 1 mM) of β2-AR blocker ICI 118551 ( Figure 7 ). The results showed that after 5 days of eye treatment with different concentrations of ICI118551, the tear secretion of mice in each treatment group showed a significant recovery trend compared with the untreated dry eye model group mice, and the difference was statistically significant (P<0.05). The results showed that within the concentration range of 20μM to 1mM, ICI 118551 can effectively treat dry eye in mice, increase the tear secretion level of dry eye mice, and thus improve dry eye symptoms.

[0124] Example 3

[0125] Cell experiments verified that 20-100 μM ICI treatment can reduce the expression of inflammatory factors in HCEC induced by hypertonicity

[0126] Using human corneal epithelial cells (HCECs), the present invention verified the effect of different concentrations of ICI 118551 on the expression of inflammatory factors under hyperosmotic stress. Treatment with 20-100 μM ICI 118551 can significantly reduce the mRNA levels of TNF-α, IL-1β and CXCL2 under hyperosmotic stress, but has no significant effect on the expression of CXCL1. Hyperosmosis is a common pathogenesis of dry eye. Hyperosmosis can increase the expression of inflammatory factors in corneal epithelial cells (HCECs) and aggravate ocular surface inflammation. Hyperosmotic-treated HCECs are often used as an in vitro cell model for dry eye research. Experiments showed that treatment with 20-100 μM ICI 118551 could significantly reduce the mRNA levels of TNF-α, IL-1β and CXCL2 under hyperosmotic stress. Although it had no significant effect on CXCL1 expression, it reduced the overall level of corneal epithelial cell inflammation. This shows that ICI 118551 can inhibit the expression of inflammatory factors in corneal epithelial cells under hyperosmotic environment, reduce ocular surface inflammation, and play a therapeutic role in dry eye.

[0127] Example 4

[0128] Comparison of the therapeutic effects of β2-adrenergic receptor blockers and glaucoma drugs betaxolol (β1 blocker) and timolol (β1&β2 blockers)

[0129] Betaxolol and timolol are β-adrenergic receptor blockers for the treatment of glaucoma, which work by reducing intraocular pressure (IOP). Betaxolol inhibits the β receptors of ciliary epithelial cells, reduces aqueous humor production, and reduces intraocular pressure. The commonly used eye drops concentration is 0.25% to 0.5%. Timolol blocks β1 and β2 receptors, reduces aqueous humor production and may increase aqueous humor outflow, reducing intraocular pressure. The commonly used eye drops concentration is 0.25% to 0.5%. The percentage concentration of 20μM ICI118551 is 0.00062772%, which is 1 / 398 to 1 / 796 of the commonly used eye drops concentration (0.25% to 0.5%).

[0130] Seven days after scopolamine injection, the dry eye model was successfully established. Then, 20 μM ICI 118551, betaxolol (commercial glaucoma eye drops betaxolol concentration 0.25%), and timolol (commercial glaucoma eye drops timolol concentration 0.5%) were applied topically for eye drops ( Fig. 9 The results showed that after 5 days of ICI 118551 eye drops treatment, the tear secretion of mice was significantly restored, and betaxolol and timolol could not increase the tear secretion of dry eye mice.

[0131] Example 5

[0132] Anxiety-depression dry eye model

[0133] Restraint stress (RST) mouse model is often used to simulate social stress conditions related to anxiety and depression in modern society (Sano, K. et al. Enriched environment alleviates stress-induced dry-eye through the BDNF axis. Sci. Rep. 9, 3422 (2019); Chiba, S. et al. Chronic restraint stress causes anxiety-and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain-derived neurotrophic factor in the prefrontal cortex. Prog. Neuropsychopharmacol. Biol. Psychiatry. 39, 112-119 (2012)). Female C57 / BL6J mice aged 10 to 12 weeks were selected and placed in a 50 mL plastic tube for 10 hours every day for 7 consecutive days. The mice in the control group were fasted and deprived of water and moved freely. Both groups of mice were placed in a dry stress environment for 7 days.

[0134] The experimental results showed that restraint stress significantly reduced the tear secretion of mice, increased the corneal fluorescein sodium score, and caused dry eye symptoms. In addition, the concentration of corneal norepinephrine (NE) in RST mice was significantly increased ( Fig.10 ).

[0135] After 7 days of restraint stress and the successful establishment of the dry eye model, the β2-AR blocker ICI 118551 was applied topically for eye drops ( Fig.11 The results showed that after 5 days of ICI 118551 eye drops treatment, the tear secretion of mice was significantly restored, increasing by 1.6 times compared with the control group ( Fig.11 ICI 118551 treatment also significantly reduced the mRNA expression levels of inflammatory factors TNF-α and IL-1β in the cornea of ​​dry eye mice ( Fig.11 C).

[0136] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of reagents targeting the NE-Adrb2 signaling pathway in the preparation of drugs for the treatment of dry eye disease.

2. The use according to claim 1, characterized in that: The agent targeting the NE-Adrb2 signaling pathway includes an agent that blocks the NE-Adrb2 signaling pathway.

3. Application of β2-adrenergic receptor blockers in the preparation of drugs for treating dry eye.

4. Use of β2-adrenergic receptor blockers in the preparation of drugs having any one of the effects ① to ⑥: ①Increase tear secretion; ②Improve corneal epithelial barrier function; ③ Improve corneal nerve control; ④ Reduce the expression of matrix metalloproteinases; ⑤Improve the inflammatory response of the cornea and conjunctiva; ⑥Restore the density of conjunctival goblet cells.

5. The use of β2-adrenergic receptor blockers in the preparation of drugs for downregulating inflammation-related pathways.

6. The use according to any one of claims 3 to 5, characterized in that: The β2-adrenergic receptor blockers include ICI 118551.

7. Use of N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride in the preparation of drugs for treating dry eye.

8. Use of β-adrenergic receptor blockers in the preparation of drugs for treating dry eye.

9. The use according to any one of claims 1 to 3 or 7 or 8, characterized in that: The types of dry eye include aqueous deficiency dry eye or anxiety-depression dry eye.

10. The use according to any one of claims 1 to 5 or 7 or 8, characterized in that: The medicines include external eye medicines.

Images