Genetic engineering strain with high yield of ergothioneine, construction method of genetic engineering strain and method for producing ergothioneine

Abstract

The invention discloses a genetic engineering strain with high yield of ergothioneine, a construction method of the genetic engineering strain and a method for producing ergothioneine, and belongs to the technical field of ergothioneine synthesis. The invention solves the problems of low ergothioneine yield and high production cost in the prior art. According to the genetic engineering strain with high yield of ergothioneine, streptomyces fradiae is used as an original strain, and ergothioneine synthesis genes POegt1 and POegt2 are simultaneously over-expressed in the original strain. The gene engineering strain is cultured to produce high-yield ergothioneine, and the production cost is saved. The genetic engineering strain provided by the invention is suitable for production of ergothioneine.

Description

Technical Field

[0001] The invention relates to the technical field of ergothioneine synthesis, and in particular to a genetic engineering strain and a construction method thereof, and a method for producing ergothioneine. Background Art

[0002] Ergothioneine has multiple effects such as anti-aging, anti-oxidation, anti-inflammatory, prolonging cell life cycle, promoting nerve cell formation, etc. Due to the high preparation cost of ergothioneine, its application is mostly limited to high-end cosmetics and nutritional supplements. The preparation of ergothioneine by biosynthesis has the advantages of easy access to raw materials and increased yield, but the synthesis of ergothioneine can usually only be completed by some actinomycetes or fungi, the fermentation capacity of wild strains is limited, and the difficulty of strain transformation by mutagenesis breeding or gene editing breeding is high, so it is difficult to reduce the biological fermentation production cost of ergothioneine. Therefore, a highly efficient improvement and creation strategy for producing ergothioneine strains is urgently needed to provide technical support for the market application of ergothioneine. Summary of the invention

[0003] The invention discloses a genetic engineering strain with high ergothioneine yield, a construction method thereof and a method for producing ergothioneine, which solve the current problems of low ergothioneine yield and high production cost.

[0004] The technical solution of the present invention is as follows:

[0005] A genetically engineered strain with high ergothioneine production capacity is disclosed. The strain uses Streptomyces freundii as an original strain, and simultaneously overexpresses ergothioneine synthesis genes POegt1 and POegt2 in the original strain.

[0006] Furthermore, the POegt1 gene is shown as SEQ ID NO.1, and the POegt2 gene is shown as SEQ ID NO.2.

[0007] A method for constructing a genetically engineered strain with high ergothioneine yield, the method comprising the steps of:

[0008] Step 1: Amplify ergothioneine synthesis genes POegt1 and POegt2;

[0009] Step 2: constructing an ergothioneine synthesis gene expression vector and obtaining positive transformants by screening;

[0010] Step 3: co-cultivating the positive transformant with Streptomyces freundii, introducing the positive transformant into Streptomyces freundii through conjugation transfer, and screening to obtain a genetically engineered strain with high ergothioneine production.

[0011] Further, the method for amplifying thioneine synthesis genes POegt1 and POegt2 in the step 1 is to design primers of thioneine synthesis gene clusters POegt1 and POegt2, and to amplify POegt1 and POegt2 genes using cDNA reverse transcribed from RNA of Pleurotus ostreatus as a template.

[0012] Furthermore, the method for obtaining positive transformants in step 2 is to add corresponding restriction sites on both sides of the amplified POegt1 and POegt2 genes, and then connect them to the pKC1139 plasmid to obtain a ligation product, transform the ligation product into Escherichia coli ET12567 competent cells for cultivation, and obtain positive transformants by identification after the cultivation is completed.

[0013] Furthermore, during the conjugation transfer process, the bacterial concentration ratio of Streptomyces freundii to the positive transformant was 1:0.6.

[0014] Furthermore, the co-culture condition is a culture temperature of 28° C. for 16 to 20 hours.

[0015] Furthermore, the screening method is antibiotic screening.

[0016] A method for producing ergothioneine comprises inoculating the above-mentioned genetically engineered strain into a fermentation medium for fermentation and culturing to obtain ergothioneine.

[0017] Furthermore, the fermentation medium comprises 30 g / L glucose, 20 g / L (NH 4 ) 2 SO 4 , 20g / LNa 2 HPO 4 12H 2 O, 6g / L KH 2 PO 4 , 4g / L yeast powder, 10mmol / L MgSO 4 , 0.2mmol / L CaCl 2 (pH 6.8-7.0); the fermentation culture conditions are temperature 28°C, rotation speed 160rpm, and time 96h.

[0018] Beneficial effects of the present invention

[0019] The invention discloses a genetic engineering strain with high ergothioneine yield and a construction method thereof, and a method for producing ergothioneine. When the method described in the invention is applied to carry out ergothioneine fermentation culture, a transformant with high ergothioneine yield can be effectively obtained, the ergothioneine fermentation level can reach 172 mg / L, the ergothioneine yield is high, and the production cost is low. DETAILED DESCRIPTION

[0020] The present invention is further described below through specific implementation modes, but the protection scope of the present invention is not limited to the following embodiments.

[0021] Embodiment 1:

[0022] Total RNA was extracted from Pleurotus ostreatus. The steps of RNA extraction were as follows:

[0023] 100 mg of Pleurotus ostreatus cells were quickly frozen with liquid nitrogen and ground into powder, the ground powder was transferred into a 1.5 ml centrifuge tube and allowed to stand at room temperature for 5 min; then 200 μl of chloroform was added, the centrifuge tube was inverted to mix, allowed to stand for 2-15 min to separate layers, and then centrifuged at 12000 r / min and 40°C for 10 min; the supernatant was transferred into another centrifuge tube, 200 μl of chloroform was added, the centrifuge tube was inverted to mix, allowed to stand for 5 min, and then centrifuged at 12000 r / min for 10 min; the upper aqueous phase was transferred into a 1.5 ml centrifuge tube, an equal volume of isopropanol was added, the mixture was shaken and mixed, allowed to stand at room temperature for 5-10 min, and the mixture was centrifuged at 12000 r / min for 5 min, and the supernatant was carefully discarded; 1 ml of 75% ethanol solution was added to the centrifuge tube, centrifuged at 7500 r / min for 2 min, and the supernatant was carefully discarded; after the RNA was dried at room temperature, ddH 2 Dissolve RNA in PBS (RNase free) and store at -70°C.

[0024] The extracted RNA was reverse transcribed to obtain the first-chain cDNA. The reaction conditions were: dNTP 4μl, Primer mix 2μl, RNA template 1μl, 5×RT Buffer 4μl, DTT 2μl, Hifiscript 1μl, RNase-Free Water 6μl, vortex to mix, incubate at 42°C for 50 minutes, and incubate at 85°C for 5 minutes.

[0025] Using cDNA as template for amplification, the amplification primers for ergothioneine biosynthesis genes POegt1 and POegt2 are:

[0026] POegt1: Forward: ATGGCCATTCAAATCGTCGACG, as shown in SEQ ID NO. 3;

[0027] Reverse:TCAAATATCGTAAACAATTCGCCCTCCC, as shown in SEQ ID NO.4;

[0028] POegt2: Forward: GTGCTAGCTTCGCTCCTCTCC, as shown in SEQ ID NO. 5;

[0029] Reverse:TTATTTGCCAAGGTACTCGAAGTCAGAAAC, as shown in SEQ ID NO.6;

[0030] The PCR reaction system is:

[0031]

[0032] The PCR program is:

[0033] Pre-denaturation: 98℃~30s

[0034] {Denaturation: 98℃-10s, annealing: 52℃-30s, extension: 72℃-45s} 30 cycles

[0035] Final extension: 72℃-2min

[0036] The target fragment was recovered by gel (Agarose Gel DNA Recovery Kit (Enhanced), TIANGEN) and ligated to the pMD18-T vector (pMD TM 18-T Vector Cloning Kit, TAKARA), incubate at 37°C for 30 min to obtain the ligation product, and transform the ligation product into Escherichia coli DH5α (DH5α competent cells, TIANGEN) and then sequence.

[0037] 2. Recombinant vector construction and transformation

[0038] Using the ligated pMD18-T as a template, BamHI and XbalI restriction sites were added to the 5' end of the primers for PCR. The PCR product and the pKC1139 vector were digested with BamHI and XbalI, respectively. The restriction system is:

[0039] pKC1139 backbone vector / pMD18t-POegt1 / POegt2: 1 μg

[0040] BamHI (NEB, China): 1 μL

[0041] XbaI (NEB, China): 1 μL

[0042] Cut Smart Buffer (NEB, China): 5 μL

[0043] ddH2O: up to 50μL

[0044] The enzyme digestion was carried out at 37°C overnight and terminated in a water bath at 65°C. The pKC1139 linearized vector and the target fragment digestion product were recovered separately.

[0045] The ligation reaction system is as follows:

[0046] 10x T4 Ligase Buffer (NEB, China): 2 μL

[0047] Vector DNA (pKC1139 linearized vector): 37.5ng

[0048] Insert DNA (sigmaH): 50ng

[0049] T4 DNAligase (China, NEB): 1μL

[0050] ddH2O: up to 20μL

[0051] Ligation was carried out at 16°C overnight.

[0052] The ligation product was transformed into competent E. coli ET12567 cells (TIANGEN, China) to demethylate the plasmid. After bacterial culture, the plate was coated with LB plates containing 50 ng / μL Kan. After overnight culture at 37°C, positive single clones were picked and inoculated into LB liquid culture medium with a concentration of 50 ng / μL Kan. The cells were cultured at 37°C for 12 h, the plasmids were extracted, and enzyme digestion was performed for identification. The successfully identified recombinant vectors could be used for the next step of conjugation transfer.

[0053] Streptomyces freundii was cultured, and the Streptomyces freundii was purchased from Qiyi Biotechnology (Shanghai) Co., Ltd., with a catalog number of 88100341. An appropriate amount of 2×YT culture medium was added to the MS plate of Streptomyces freundii cultured for 3 to 4 days, and spores were gently scraped with a sterilized cotton swab. After vortexing, the spores were added to a sterilized syringe with absorbent cotton, and the residual culture medium and mycelium were filtered. Conjugation transfer to obtain conjugants: The prepared Streptomyces spore suspension was suspended in 5 mL, pH = 8.0 TES, heat-shocked in a 50°C water bath for 10 minutes, and after cooling, an equal volume of 2×YT was added, and pre-germination was carried out in a shaker at 37°C and 180r / min for 2.5 hours, and the spores were collected by centrifugation, and the spores were resuspended in an appropriate amount of 2×YT or sterile water for use. After breaking up the spores on an oscillator, mix them evenly with the collected transformant E. coli ET12567 (pUZ8002 / pKC1139), apply 100 μL on the surface of the culture medium, culture at 28°C for 16 to 20 hours, take 1 mL of antibiotic aqueous solution to cover the plate, and continue to culture at 28°C for 3 to 4 days to grow transformants. Pick the transformants with better growth and culture at 40°C for 16 hours to eliminate the plasmid.

[0054] Production of thioneine: inoculating the genetically engineered strain into a fermentation medium to obtain thioneine. The thioneine fermentation medium comprises: 30 g / L glucose, 20 g / L (NH4) 2 SO4 , 20g / L Na 2 HPO 4 12H 2 O, 6g / L KH 2 PO 4 , 4g / L yeast powder, 10mmol / L MgSO 4 , 0.2mmol / L CaCl 2 (pH 6.8-7.0), the fermentation culture conditions are temperature 28°C, rotation speed 160rpm, and fermentation time 96h.

[0055] 3. Detection of ergothioneine products

[0056] The EGT concentration value in the thioneine extract obtained by the method of the present invention is determined by high performance liquid chromatography. Detection conditions: the chromatographic column model is Thermo BDS HYPERSIL C18 (4.6mm × 250mm, 5μm), the mobile phase A is 0.1% formic acid acetonitrile solution, the mobile phase B is 0.1% formic acid aqueous solution, the flow rate is 0.4mL / min, the column temperature is set to 40°C, and the measurement is carried out at a wavelength of 262nm, and the sample volume is 3μL. Test results: the fermentation level of thioneine can reach 172mg / L.

[0057] The above is a preferred embodiment of the present invention, but the present invention should not be limited to the contents disclosed in the embodiment. Therefore, any equivalent or modification completed without departing from the spirit disclosed in the present invention shall fall within the scope of protection of the present invention.

Claims

1. A genetically engineered strain that produces high yield of ergothioneine, It is characterized in that The strain uses Streptomyces freundii as the original strain, and simultaneously over-expresses ergothioneine synthesis genes POegt1 and POegt2 in the original strain.

2. The genetically engineered strain of high-yield ergothioneine according to claim 1, It is characterized in that The POegt1 gene is shown as SEQ ID NO.1, and the POegt2 gene is shown as SEQ ID NO.

2.

3. A method for constructing a genetically engineered strain that produces high yield of ergothioneine, It is characterized in that The method comprises the following steps: Step 1: Amplify ergothioneine synthesis genes POegt1 and POegt2; Step 2: constructing an ergothioneine synthesis gene expression vector and obtaining positive transformants by screening; Step 3: co-cultivating the positive transformant with Streptomyces freundii, introducing the positive transformant into Streptomyces freundii through conjugation transfer, and screening to obtain a genetically engineered strain with high ergothioneine production.

4. The method according to claim 3, It is characterized in that The method for amplifying the ergothioneine synthesis genes POegt1 and POegt2 in the step 1 is to design primers of the ergothioneine synthesis gene clusters POegt1 and POegt2, and to amplify the POegt1 and POegt2 genes using cDNA reverse transcribed from RNA of Pleurotus ostreatus as a template.

5. The method according to claim 3, It is characterized in that The method for obtaining positive transformants in step 2 is to add corresponding restriction sites on both sides of the amplified POegt1 and POegt2 genes, then connect them to the pKC1139 plasmid to obtain a connection product, transform the connection product into Escherichia coli ET12567 competent cells for cultivation, and obtain positive transformants through identification after the cultivation is completed.

6. The method according to claim 3, It is characterized in that During the conjugation transfer process, the bacterial concentration ratio of Streptomyces freundii to the positive transformant was 1:0.

6.

7. The method according to claim 3, It is characterized in that The co-culture condition is culturing at 28° C. for 16 to 20 hours.

8. The method according to claim 3, It is characterized in that The screening method is antibiotic screening.

9. A method for producing ergothioneine, It is characterized in that The genetically engineered strain according to claim 1 is inoculated into a fermentation medium for fermentation and culturing to obtain ergothioneine.

10. The method according to claim 9, It is characterized in that The fermentation medium contains 30 g / L glucose, 20 g / L (NH4) 2 SO 4 , 20g / L Na 2 HPO 4 12H 2 O, 6g / L KH 2 PO 4 , 4g / L yeast powder, 10mmol / L MgSO 4 , 0.2mmol / L CaCl 2 (pH 6.8-7.0); the fermentation culture conditions are temperature 28°C, rotation speed 160rpm, and time 96h.

Images