Easily-recycled organophosphorus pesticide degradation catalyst and preparation method thereof

Abstract

The invention discloses an easy-to-recover organophosphorus pesticide degradation catalyst and a preparation method thereof, the easy-to-recover organophosphorus pesticide degradation catalyst comprises Fe3O4 (at) Ni < 2 + > (at) OPH and Fe3O4 (at) Ni < 2 + > (at) NfsB, the nucleotide sequences of Fe3O4 (at) Ni < 2 + > surface modification Ni < 2 + > Fe3O4 nano magnetic beads, OPH and NfsB are respectively shown as SEQ ID NO.01 and SEQ ID NO.02, and OPH and NfsB are respectively connected with Ni < 2 + > through 6 * His tag, so that Fe3O4 (at) Ni < 2 + > (at) OPH and Fe3O4 (at) Ni < 2 + > (at) NfsB are respectively formed. According to the invention, nitroreductase is introduced to degrade 4-NP, magnetic nanoparticles are utilized to adsorb and immobilize free enzyme, OPH-NfsB enzyme cascade reaction is realized, the defects that free enzyme is easy to inactivate, difficult to store, difficult to recycle and the like are overcome, the problem of organophosphorus pesticide residue is effectively solved, the degradation efficiency of organophosphorus pesticide is improved, and the application range of organophosphorus hydrolase is expanded.

Description

Technical Field

[0001] The invention belongs to the technical field of harmless treatment of organophosphorus pesticides, and particularly relates to an easily recyclable organophosphorus pesticide degradation catalyst and a preparation method thereof. Background Art

[0002] Organophosphorus pesticides have been widely used in agricultural production due to their significant bactericidal and insecticidal effects, providing an important guarantee for the high and stable yield of crops. However, the problem of organophosphorus pesticide residues has aroused widespread concern. Residual organophosphorus pesticides have strong neurotoxicity and may not only enter the human body through the food chain, posing a serious threat to human health, but may also accumulate in the environment and destroy the ecological balance. Therefore, how to effectively degrade organophosphorus pesticides and reduce their harm to the environment and human health has become an important issue that needs to be solved urgently.

[0003] Biodegradation has become an important research direction in the field of organophosphorus pesticide degradation due to its advantages such as low cost and green environmental protection. This method uses enzymatic reactions in organisms to decompose organophosphorus pesticides, avoiding the secondary pollution problems that may be caused by traditional chemical degradation methods, and is in line with the concept of sustainable development. Among the many biodegradation methods, organophosphorus hydrolase (OPH) has attracted much attention due to its efficient degradation ability. OPH can quickly decompose organophosphorus pesticides and convert them into relatively harmless compounds, thereby reducing the pressure of pesticide residues on the environment.

[0004] However, free OPH still has some significant disadvantages in practical applications. First, its enzyme activity is relatively low, which makes it difficult to meet the needs of large-scale degradation; second, the storage conditions of OPH are relatively harsh, and its stability is poor, making it difficult to store for a long time; in addition, free OPH cannot be recycled and reused, which not only increases the degradation cost, but also limits the feasibility of its large-scale application. More importantly, after OPH degrades organophosphorus pesticides, its product, 4-nitrophenol (4-NP), still has a certain toxicity. This means that the degradation process does not completely eliminate the potential hazards to the environment and organisms, but may introduce new pollution risks. Therefore, how to overcome these shortcomings of free OPH and further reduce the toxicity of its degradation products has become a key issue that needs to be urgently solved in the current field of organophosphorus pesticide biodegradation. Summary of the invention

[0005] The present invention aims to overcome the defects of the prior art and provide an easily recyclable catalyst for degradation of organophosphorus pesticides.

[0006] Another object of the present invention is to provide a method for preparing the above-mentioned easily recyclable organophosphorus pesticide degradation catalyst.

[0007] The technical solution of the present invention is as follows:

[0008] An easily recyclable organophosphorus pesticide degradation catalyst comprising Fe 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB, where Fe 3 O 4 @Ni 2+ Surface modified Ni 2+ Fe 3 O 4 Nanomagnetic beads, the nucleotide sequences of OPH and NfsB are shown in SEQ ID NO.01 and SEQ ID NO.02, respectively, and OPH and NfsB are tagged with the above Ni 2+ connected to form Fe 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB.

[0009] The method for preparing the easily recyclable organophosphorus pesticide degradation catalyst comprises the following steps:

[0010] (1) expressing the target protein in E. coli and purifying it by nickel column affinity adsorption to obtain OPH and NfsB with 6×His tag respectively;

[0011] (2) Preparation of Fe 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB;

[0012] (3) The Fe obtained in step (2) 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB are mixed to obtain the easily recyclable organophosphorus pesticide degradation catalyst.

[0013] In a preferred embodiment of the present invention, in step (2), the Fe 3 O 4 @Ni 2+ The preparation method of @OPH comprises: 3 O4 @Ni 2+ The supernatant was removed by magnetic separation and washed with Tris-HCl buffer to obtain Fe 3 O 4 @Ni 2+ Solid; then Fe 3 O 4 @Ni 2+ The solid and the OPH solution were mixed by rotation on an oscillator; then magnetic separation was performed, and the solid phase was washed by shaking with Tris-HCl buffer to obtain the Fe 3 O 4 @Ni 2+ @OPH.

[0014] Further preferably, the concentration of the OPH solution is 0.3-1 mg / mL.

[0015] More preferably, the rotation speed of the oscillator is 50-100 r / min, and the time is 2-60 min.

[0016] In a preferred embodiment of the present invention, in step (2), the Fe 3 O 4 @Ni 2+ The preparation method of @NfsB comprises: 3 O 4 @Ni 2+ The supernatant was removed by magnetic separation and washed with Tris-HCl buffer to obtain Fe 3 O 4 @Ni 2+ Solid; then Fe 3 O 4 @Ni 2+ The solid and the NfsB solution were mixed by rotation on an oscillator; then magnetic separation was performed, and the solid phase was washed by shaking with Tris-HCl buffer to obtain the Fe 3 O 4 @Ni 2+ @NfsB.

[0017] Further preferably, the concentration of the NfsB solution is 0.2-1 mg / mL.

[0018] More preferably, the rotation speed of the oscillator is 50-100 r / min, and the time is 2-60 min.

[0019] The beneficial effects of the present invention are:

[0020] 1. The present invention introduces nitroreductase to degrade 4-NP, uses magnetic nanoparticles to adsorb and immobilize free enzymes, realizes the OPH-NfsB enzyme cascade reaction, overcomes the defects of free enzymes, and efficiently degrades organic phosphorus.

[0021] 2. The stability and storage properties of the present invention are very good. After being stored at a high temperature of 60° C. for 4 hours, the residual enzyme activity is 76.31-78.01%; after being stored at 4° C. for 8 days, the residual enzyme activity is 80.04-81.73%.

[0022] 3. The present invention can effectively immobilize free enzymes and has good magnetic separation effect and fast magnetic separation speed. Under external magnetic field conditions, the catalyst can be recovered within 10 seconds. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The SDS-PAGE electrophoresis analysis diagram of OPH and NfsB in Example 1 of the present invention. Wherein: (a) OPH SDS-PAGE electrophoresis analysis diagram, M: Maker; 1: 20mM imidazole, 2: 40mM imidazole, 3: 60mM imidazole, 4: 80mM imidazole, 5: 100mM imidazole, 6: 500mM imidazole, 7: 1M imidazole; (b) NfsB SDS-PAGE electrophoresis analysis diagram, M: Maker; 1: protein supernatant; 2: 20mM imidazole, 3: 40mM imidazole, 4: 50mM imidazole, 5: 80mM imidazole, 6: 100mM imidazole, 7: 200mM imidazole, 8: 500mM imidazole, 9: 1M imidazole.

[0024] Figure 2 This is a schematic diagram of magnetic separation of the easily recyclable organophosphorus pesticide degradation catalyst prepared in Example 1 of the present invention. Wherein: (a) before magnetic separation; (b) after magnetic separation.

[0025] Figure 3 The scanning electron microscope image of the easily recyclable organophosphorus pesticide degradation catalyst prepared in Example 1 of the present invention. 3 O 4 @Ni 2+ , (b) easily recyclable organophosphorus pesticide degradation catalyst.

[0026] Figure 4 The results of the thermal stability study of the easily recyclable organophosphorus pesticide degradation catalyst and the free organophosphorus pesticide degradation catalyst prepared in Example 1 of the present invention are shown.

[0027] Figure 5 The results of the storage investigation of the easily recyclable organophosphorus pesticide degradation catalyst and the free organophosphorus pesticide degradation catalyst prepared in Example 1 of the present invention are shown. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0029] Example 1

[0030] An easily recyclable catalyst for degradation of organophosphorus pesticides, comprising Fe 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB, where Fe 3 O 4 @Ni 2+ Surface modified Ni 2+ Fe 3 O 4 Nanomagnetic beads, the nucleotide sequences of OPH and NfsB are shown in SEQ ID NO.01 and SEQ ID NO.02, respectively, and OPH and NfsB are tagged with the above Ni 2+ connected to form Fe 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB.

[0031] SEQ ID NO.01:

[0032] atgagcatcggcaccggcgacaggatcaacaccgtgaggggccccatcaccatcagcgaggccggcttcaccctgacccacgagcacatctgcggcagc

[0033] agcgccggcttcctgagggcctggcccgagttcttcggcagcaggaaggccctggccgagaaggccgtgaggggcctgaggagggccagggccgccg

[0034] gcgtgaggaccatcgtggacgtgagcaccttcgacatcggcagggacgtgagcctgctggccgaggtgagcagggccgccgacgtgcacatcgtggccg

[0035] ccaccggcctgtggttcgacccccccctgagcatgaggctgaggagcgtggaggagctgacccagttcttcctgagggagatccagtacggcatcgaggac

[0036] accggcatcagggccggcatcatcaaggtggccaccaccggcaaggccacccccttccaggagctggtgctgaaggccgccgccagggccagcctggc

[0037] caccggcgtgcccgtgaccacccacaccgccgccagccagagggacggcgagcagcaggccgccatcttcgagagcgagggcctgagccccagcagg

[0038] gtgtgcatcggccacagcgacgacaccgacgacctgagctacctgaccgccctggccgccaggggctacctgatcggcctggaccacatcccccacagcg

[0039] ccatcggcctggaggacaacgccagcgccagcgccctgctgggcatcaggagctggcagaccagggccctgctgatcaaggccctgatcgaccagggct

[0040] acatgaagcagatcctggtgagcaacgactggctgttcggcttcagcagctacgtgaccaacatcatggacgtgatggacagggtgaaccccgacggcatg

[0041] gccttcatccccctgagggtgatccccttcctgagggagaagggcgtgccccaggagaccctggccggcatcaccgtgaccaaccccgccaggttcctgagccccaccctgagggccagc;

[0042] SEQ ID NO.02:

[0043] ccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagcagccatatggatattattagcgtggcgctgaaacgccatagcaccaaagcgtttgatgcg

[0044] agcaaaaaactgaccccggaacaagcggaacagattaaaaccctgctgcagtatagcccgagcagcaccaacagtcagccgtggcattttattgtggcgag

[0045] caccgaagaaggcaaagcgcgcgtggcgaaaagcgcggcgggcaactatgtgtttaacgaacgcaaaatgctggatgcgagccatgtggttgtgttttgcg

[0046] cgaaaaccgcgatggatgatgtgtggctgaaactggtggtggatcaagaagatgcggatggccgctttgcgaccccggaagcgaaagcggcgaacgataa

[0047] aggccgcaaattttttgcggatatgcatcgcaaagatctgcatgatgatgcggaatggatggcgaaacaagtgtatctgaacgtgggcaactttctgctgggcgt

[0048] ggcggcgctgggcctggatgcggtgccgattgaaggctttgatgcggcgattctggatgcggaatttggcctgaaagaaaaaaggctatacgagcctggtggtt

[0049] gtgccggtgggccatcatagcgtggaagattttaacgcgaccctgccgaaaagccgcctgccgcagaacattaccctgaccgaagtgctcgagcaccacca

[0050] ccaccaccact

[0051] The method for preparing the easily recyclable organophosphorus pesticide degradation catalyst comprises the following steps:

[0052] (1) The target proteins were expressed in E. coli and purified by nickel column affinity adsorption to obtain OPH and NfsB with 6×His tag, respectively, including:

[0053] A. Target gene transformation

[0054] Plasmid construction: The genes encoding the OPH enzyme and the NfsB enzyme were constructed into the pET 28b plasmid, and a 6×His tag was added to the protein tail by gene editing;

[0055] Transformation: Under sterile conditions, take 40 μL ddHO 2 O to dissolve the plasmid powder, add 2 μL of plasmid vector to the competent E. coli BL21, incubate on ice for 20 min, heat shock in a 42°C water bath for 60 s, incubate on ice again for 2 min, add 1 mL of LB medium, and culture at 37°C with shaking for 40 min;

[0056] Amplification: Add 4 mL of LB medium containing 50 μg / mL kanamycin to the transformed bacterial solution and culture at 37°C with shaking overnight.

[0057] B. Target protein expression

[0058] Seed preservation: Mix 500 μL of the above bacterial solution with 500 μL of sterilized 50% glycerol and freeze at -80°C;

[0059] Induction: transfer 4 mL of the above bacterial solution to 400 mL of LB medium to which the corresponding antibiotics have been added, and culture in a shaking incubator at 37°C until OD600 reaches between 0.6 and 0.8, then add IPTG at a final concentration of 0.5 mmol / L to induce expression, and then culture in a shaking incubator at 16°C for 18 to 20 h;

[0060] Cell collection: transfer the induced bacterial solution to a centrifuge bottle, centrifuge it in a high-speed centrifuge at 4000rpm for 13min, discard the supernatant and keep the precipitate, add 20-30mL buffer (20mmol / L Tris-HCl, 100mmol / LNaCl, pH8.0) to resuspend, transfer to a 50mL centrifuge tube after resuspending, and store it in a -20℃ refrigerator for later use;

[0061] Crushing and centrifugation: Take the collected cell suspension, thaw it at room temperature, transfer it to a small beaker, raise and lower the probe under ice bath conditions, place the probe 1-2cm below the liquid surface, set the operating parameters, ultrasonic on time 2s, ultrasonic off time 2s, set the alarm temperature 25.0℃, ultrasonic power 50%, start working for 30 minutes, take out the crushing liquid and transfer it to a 50mL centrifuge tube, and centrifuge it at 4℃ and 9500rpm for 60 minutes. After the end, separate the supernatant and the precipitate, put the supernatant into the tube and put it in the ice box for the next step;

[0062] C. Nickel column affinity purification

[0063] After the column is treated and balanced, the supernatant is added to the column, and the flow rate is controlled at 1 mL / min. Different concentrations of imidazole are added in sequence to elute the protein, and the supernatants corresponding to different concentrations of imidazole are collected, marked, and a small amount of corresponding samples are taken for SDS-PAGE electrophoresis to detect the protein concentration, and the OPH and NfsB elution treatments with the highest degree of purification are found;

[0064] D.SDS-PAGE electrophoresis detection

[0065] The supernatants corresponding to different concentrations of imidazole were prepared separately and tested by SDS-PAGE. Then, according to the results of SDS-PAGE electrophoresis, the imidazole concentration with the most expressed target protein in the supernatant was selected to determine the elution concentration of OPH and NfsB to express the target protein in large quantities. The results are shown in FIG. Figure 1 As shown;

[0066] (2) Preparation of Fe 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB; Specifically,

[0067] Fe 3 O 4 @Ni 2+ The preparation method of @OPH comprises: 3 O 4 @Ni 2+ The supernatant was removed by magnetic separation and washed with Tris-HCl buffer to obtain Fe 3 O 4 @Ni 2+ Solid; then Fe 3 O 4 @Ni 2+The solid and OPH solution (solute is OPH obtained in step (1), 20mM Tris-HCl 400mMNaCl buffer) are mixed by rotation on an oscillator; then magnetic separation is performed, and the solid phase is washed by shaking with Tris-HCl buffer to obtain the Fe 3 O 4 @Ni 2+ @OPH; The concentration of OPH solution is 1 mg / mL, the rotation speed of the oscillator is 100 r / min, and the time is 20 min;

[0068] Fe 3 O 4 @Ni 2+ The preparation method of @NfsB comprises: 3 O 4 @Ni 2+ The supernatant was removed by magnetic separation and washed with Tris-HCl buffer to obtain Fe 3 O 4 @Ni 2+ Solid; then Fe 3 O 4 @Ni 2+ The solid and NfsB solution (solute is NfsB obtained in step (1), solvent is 20mM Tris-HCl 400mMNaCl buffer) are mixed by rotation on an oscillator; then magnetic separation is performed, and the solid phase is washed by shaking with Tris-HCl buffer to obtain the Fe 3 O 4 @Ni 2+ @NfsB; the concentration of NfsB solution is 1 mg / mL, the rotation speed of the oscillator is 100 r / min, and the time is 20 min;

[0069] (3) The Fe obtained in step (2) 3 O 4 @Ni 2+ @OPH and Fe 3 O 4 @Ni 2+ @NfsB are mixed in a molar ratio of 1:1 to obtain the easily recyclable organophosphorus pesticide degradation catalyst.

[0070] Take an appropriate amount of the above-mentioned easily recyclable organophosphorus pesticide degradation catalyst in a centrifuge tube, place it on a magnetic rack, and record the magnetic separation time. Figure 2 As shown, under the condition of adding an external magnetic field, most of the easily recoverable organophosphorus pesticide degradation catalysts prepared in this embodiment can be attracted to the vicinity of the external magnetic field within 10 seconds, which shows that the easily recoverable organophosphorus pesticide degradation catalysts prepared in this embodiment have a good magnetic separation effect and a faster magnetic separation speed.

[0071] The Fe 3 O 4 @Ni 2+ The surface structure of the easily recyclable organophosphorus pesticide degradation catalyst prepared in this embodiment. Figure 3 Comparison between (a) and (b) shows that in Fe 3 O 4 @Ni 2+ After specific adsorption of OPH and NfsB, the particle morphology changed significantly.

[0072] In this embodiment, one catalyst activity unit is defined as the amount of catalyst required to generate 1 μmol of p-aminophenol per minute. Take an appropriate amount of catalyst and add it to Tris-HCl buffer, add methyl parathion, react at 40°C for 30 minutes, measure the amount of p-aminophenol generated, and calculate its enzyme activity. The results obtained are: the average enzyme activity of the free organophosphorus pesticide degradation catalyst is 87.58~97.61U, while the average enzyme activity of the easily recyclable organophosphorus pesticide degradation catalyst prepared in this embodiment is 95.76~117.01U;

[0073] An appropriate amount of catalyst was placed in a 60°C water bath, incubated for a certain period of time, taken out, and allowed to cool to room temperature. Tris-HCl buffer was added to react with methyl parathion for 30 minutes, and the catalyst activity was measured to evaluate its stability. Figure 4 The results of the thermal stability study of the easily recyclable organophosphorus pesticide degradation catalyst prepared in this example and the free organophosphorus pesticide degradation catalyst are shown. The free organophosphorus pesticide degradation catalyst and the easily recyclable organophosphorus pesticide degradation catalyst prepared in this example were stored at 60°C for different periods of time and their activities were tested. Figure 4 As shown: after being stored at a high temperature of 60° C. for 4 hours, the residual enzyme activity of the free organophosphorus pesticide degradation catalyst is 43.45-46.69%, while the residual enzyme activity of the easily recyclable organophosphorus pesticide degradation catalyst prepared in this embodiment is 76.31-78.01%.

[0074] Figure 5 The results of the storage investigation of the easily recyclable organophosphorus pesticide degradation catalyst and the free organophosphorus pesticide degradation catalyst prepared in this example are shown. The activity of the easily recyclable organophosphorus pesticide degradation catalyst prepared in this example was tested after being stored at 4°C for different periods of time. The results are as follows: Figure 5 As shown: after being stored at 4° C. for 8 days, the residual enzyme activity of the easily recyclable organophosphorus pesticide degradation catalyst prepared in this example is 80.04-81.73%.

[0075] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. An easily recyclable organophosphorus pesticide degradation catalyst, characterized in that: The mixture includes Fe3O4@Ni mixed in a molar ratio of 1:

1. 2+ @OPH and Fe3O4@Ni 2+ @NfsB, where Fe3O4@Ni 2+ Surface modified Ni 2+ The nucleotide sequences of OPH and NfsB are shown in SEQ ID NO.01 and SEQ ID NO.02, respectively, and OPH and NfsB are tagged with the above Ni 2+ connected to form Fe3O4@Ni 2+ @OPH and Fe3O4@Ni 2+ @NfsB.

2. The method for preparing an easily recyclable organophosphorus pesticide degradation catalyst as claimed in claim 1, characterized in that: The steps include: (1) expressing the target protein in E. coli and purifying it by nickel column affinity adsorption to obtain OPH and NfsB with 6×Histag respectively; (2) Preparation of Fe3O4@Ni 2+ @OPH and Fe3O4@Ni 2+ @NfsB; (3) Fe3O4@Ni obtained in step (2) 2+ @OPH and Fe3O4@Ni 2+ @NfsB are mixed to obtain the easily recyclable organophosphorus pesticide degradation catalyst.

3. The method for preparing the easily recyclable organophosphorus pesticide degradation catalyst according to claim 1, characterized in that: In the step (2), the Fe3O4@Ni 2+ The preparation method of @OPH comprises: preserving Fe3O4@Ni 2+ The supernatant was removed by magnetic separation and washed with Tris-HCl buffer to obtain Fe3O4@Ni 2+ Solid; then Fe3O4@Ni 2+ The solid and the OPH solution were mixed by rotation on an oscillator; then magnetic separation was performed, and the solid phase was washed by shaking with Tris-HCl buffer to obtain the Fe3O4@Ni 2+ @OPH.

4. The preparation method according to claim 3, characterized in that: The concentration of the OPH solution is 0.3-1 mg / mL.

5. The preparation method according to claim 3 or 4, characterized in that: The rotation speed of the oscillator is 50-100 r / min, and the time is 2-60 min.

6. The method for preparing the easily recyclable organophosphorus pesticide degradation catalyst according to claim 1, characterized in that: In the step (2), the Fe3O4@Ni 2+ The preparation method of @NfsB comprises: preserving Fe3O4@Ni 2+ The supernatant was removed by magnetic separation and washed with Tris-HCl buffer to obtain Fe3O4@Ni 2+ Solid; then Fe3O4@Ni 2+ The solid and the NfsB solution were mixed by rotation on an oscillator; then magnetic separation was performed, and the solid phase was washed by shaking with Tris-HCl buffer to obtain the Fe3O4@Ni 2+ @NfsB.

7. The preparation method according to claim 6, characterized in that: The concentration of the NfsB solution is 0.2-1 mg / mL.

8. The preparation method according to claim 6 or 7, characterized in that: The rotation speed of the oscillator is 50-100 r / min, and the time is 2-60 min.

Images