EIF4A-1 target gene for preventing and treating tetranychus crataegi and tetranychus urticae, dsRNA synthesized by eIF4A-1 target gene and application of dsRNA

Abstract

The invention discloses an eIF4A-1 target gene for preventing and treating tetranychus crataegi and tetranychus urticae, dsRNA synthesized by the eIF4A-1 target gene and application of the dsRNA. The nucleotide sequence of the eIF4A-1 target gene is as shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of the dsRNA is as shown in SEQ ID NO.3 and SEQ ID NO.4; the dsRNA solution with the target gene being EIF4A-1 is used for soaking eggs of tetranychus crataegi and tetranychus urticae to influence the survival rate, and the prevention and treatment purpose is achieved; the method is convenient to operate, good in effectiveness and sensitivity and high in insecticidal efficiency, has the advantages of being environmentally friendly and the like, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology and relates to the prevention and control of agricultural pest mites based on RNAi technology, specifically an eIF4A-1 target gene for preventing and controlling hawthorn spider mites and two-spotted spider mites, dsRNA synthesized from the eIF4A-1 target gene and applications thereof. Background Art

[0002] The hawthorn spider mite and the two-spotted spider mite, belonging to the genus Tetranychus in the family Tetranychidae, are a worldwide pest that primarily harms fruit trees, greenhouse vegetables, and other agricultural and cash crops. Both species are small, highly reproductive, and spread rapidly. Long-term use of chemical pesticides for control has led to a strong resistance in these species.

[0003] RNA interference (RNAi), also known as RNA silencing, is a biological phenomenon in eukaryotes that is induced by double-stranded RNA (dsRNA), siRNA (small interfering RNA), or miRNA (microRNA). It efficiently and specifically degrades or inhibits the expression of homologous mRNA, thereby preventing the translation of target gene proteins. RNAi can be used to interfere with the normal growth of target pests, reducing damage to host plants, ultimately achieving the goal of pest control and plant protection.

[0004] RNAi technology holds great potential for agricultural pest control. Companies like Bayer and Syngenta have developed several RNAi-based pest control products. In 2021, MON87411 received a GMO safety certificate (for import and food / feed use) from China's Ministry of Agriculture and Rural Affairs. In particular, in October 2022, the world's first RNA insecticide received provisional approval from the International Organization for Standardization's Technical Committee on Pesticide Common Names for the English common name, Ledprona. This marked a milestone in the development of sprayable RNAi biopesticides towards production applications. RNAi technology holds great potential for controlling spider mites, but there are currently few reports domestically or internationally on the genetic functions of the hawthorn spider mite and the two-spotted spider mite, or on the target genes for their insecticidal activity.

[0005] Preliminary experiments have shown that toxicity to spider mites (Tetranychus viridis) and two-spotted spider mites can be achieved by soaking eggs in an appropriate exogenous dsRNA solution. Therefore, developing exogenous dsRNA products suitable for controlling these two pests at the genetic level is convenient and low-cost. Furthermore, due to their gene specificity, they can achieve precise and excellent control effects and are environmentally friendly, showing great potential for application in the control of these two pests. However, the greatest challenges and key issues remain the identification of relevant target genes and the design of dsRNA with effective, specific, and stable control effects. Summary of the Invention

[0006] The present invention overcomes the defects and shortcomings of existing hawthorn spider mite and two-spotted spider mite control technologies, and provides an eIF4A-1 target gene for controlling hawthorn spider mite and two-spotted spider mite, a dsRNA synthesized thereby, and applications thereof.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions: A method for preventing and controlling hawthorn spider mite and two-spotted spider mite eIF4A-1 target gene, the eIF4A-1 The nucleotide sequence of the target gene is shown in SEQ ID NO.1.

[0008] A dsRNA for preventing and controlling hawthorn spider mite and two-spotted spider mite, using the EIF4A-1 The target gene synthesizes dsRNA, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0009] The preparation of the dsRNA comprises the following steps: S1, using the cDNA sequences of two spider mites as templates, synthesized EIF4A-1 gene fragments; S2, EIF4A-1 The gene fragment was used as a template to design a primer sequence pair containing the T7 promoter sequence; S3, obtaining dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

[0010] The S1 is specifically: eIF4A-1 The primer pairs were designed based on the DNA sequence of the gene, and the cDNA sequences of the two spider mites were used as templates for PCR amplification to obtain EIF4A-1 Gene fragment.

[0011] A kind of eIF4A-1 The application of the target gene or the dsRNA includes any one of the following: 1) eIF4A-1 Use of the target gene or the dsRNA in controlling hawthorn spider mites and two-spotted spider mites; 2) eIF4A-1 Use of the target gene or the dsRNA in preventing pests of hawthorn spider mites and two-spotted spider mites and / or in preparing products for preventing and controlling pests of hawthorn spider mites and two-spotted spider mites; 3) eIF4A-1 Application of the target gene or the dsRNA in promoting the death of hawthorn spider mites and two-spotted spider mites and / or in preparing products that promote the death of hawthorn spider mites and two-spotted spider mites.

[0012] A method for preventing and controlling hawthorn spider mites and two-spotted spider mites, the method comprising introducing the dsRNA into the hawthorn spider mites and two-spotted spider mites.

[0013] The beneficial effects of the present invention compared to the prior art are: The present invention utilizes eIF4A-1 Genetic control of hawthorn spider mites and two-spotted spider mites, through eIF4A-1 Gene synthesis for the control of hawthorn spider mite and two-spotted spider mite dsRNA, the dsRNA can target the above eIF4A-1 Gene. Soak the eggs in dsRNA solution, dseIF4A-1 Entering the bodies of hawthorn spider mites and two-spotted spider mites, the dsRNA can silence / inhibit the growth of hawthorn spider mites and two-spotted spider mites. eIF4A-1 Gene expression promotes the death of hawthorn spider mites and two-spotted spider mites, thereby achieving the purpose of preventing and controlling hawthorn spider mites and two-spotted spider mites.

[0014] The present invention screened and obtained a lethal gene for spider mites and two-spotted spider mites ( eIF4A-1 ) and developed highly effective silencing dsRNA for its use, enabling effective control of both spider mites (Tetranychus viridis) and two-spotted spider mites. This method leverages the lethality of dsRNA against these two species to achieve control. This method offers numerous advantages, including ease of use, high efficacy and sensitivity, high insecticidal efficiency, and environmental friendliness, promising promising applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Picture 1 The effect of soaking eggs in the dseIF4A-1 solution in Example 2 on the phenotypes of the hawthorn spider mite and the two-spotted spider mite; Picture 2 This is the effect of soaking eggs in the dseIF4A-1 solution in Example 2 on the mortality of hawthorn spider mites and two-spotted spider mites.

[0016] Picture 3 After the eggs were soaked in dseIF4A-1 and dsGUS solution in Example 2, the eIF4A- 1 Changes in gene expression. DETAILED DESCRIPTION

[0017] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail with reference to the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the present invention and are not intended to limit the present invention. The technical solutions of the present invention will be described in detail below with reference to the embodiments and the accompanying drawings, but the scope of protection is not limited thereto.

[0018] Unless otherwise specified, the reagents, methods and equipment used in the following examples are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0019] The hawthorn spider mite and two-spotted spider mite used in the following examples were raised at the College of Plant Protection, Shanxi Agricultural University. These spider mites were inoculated onto peach seedlings and propagated in an artificial climate chamber (temperature 25±1°C, humidity 50%-60%, photoperiod L:D = 16:8).

[0020] RNA was extracted using the TRIzol method (Invitrogen, USA). The reverse transcription reagent (PrimeScript™ RTreagent Kit with gDNA Eraser) was purchased from TAKARA Biotechnology Co., Ltd., the dsRNA synthesis kit (T7RiboMAX™ Express RNAi System) was purchased from Promega, USA, the kit used in the PCR reaction system (GoTaq® Green Master Mix) was purchased from Promega, USA, and the DNA purification and recovery kit (Universal DNA Purification Kit) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0021] The data processing method in the following examples was as follows: The results of bioassays for Tetranychus viridis and Tetranychus urticae were analyzed using the egg immersion method. Mortality rates for Tetranychus viridis and Tetranychus urticae were calculated starting from day 0 (day 2 of adulthood) and analyzed using SPSS 19.0 software. Target gene expression levels were analyzed on day 8 (when the anterior nymph molts into the posterior nymph). qPCR data were calculated using the 2-ΔΔCt method (Ct represents the number of cycles) and analyzed using SPSS 19.0 software.

[0022] Example 1 Growth and development-related genes of spider mites and two-spotted spider mites EIF4A-1 Acquisition and utilization EIF4A-1 Gene synthesized dsRNA (dseIF4A-1) According to the transcriptome library of hawthorn spider mite and two-spotted spider mite, the EIF4A-1 The gene fragments are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0023] 1. Total RNA extraction and first-strand cDNA synthesis of hawthorn spider mite and two-spotted spider mite.

[0024] 100 adult mites of T. viciae and T. urticae were placed in a 1 mL centrifuge tube. Total RNA was extracted from these two mites using the TRIzol method. The RNA concentration and quality were determined using a NanoDrop OneC. Reverse transcription was performed using a PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA) according to the manufacturer's instructions to synthesize first-strand cDNA.

[0025] SEQ ID NO.1 SEQ ID NO.2 2. Primer design The transcriptome data of spider mites and two-spotted spider mites obtained by our research group were used to screen the two eIF4A-1 The NCBI primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to design the gene sequences of eIF4A-1 The full-length primers P1-2 and dsRNA primers P3-4 of the gene were used (Table 1). The β-glucuronidase gene (GUS) was obtained from a laboratory-stored GUS The dsRNA primer P5 of GUS gene was amplified on the plasmid (Table 1), and the target gene eIF4A-1 , internal reference genes AVGAPD H and TUCycA qPCR primers P6-9 (Table 1).

[0026] Table 1 3. Kit synthesis EIF4A-1 dsRNAs of the GUS gene and GUS gene PCR amplification was performed using primers P1 and P2 listed in Table 1. The reaction system consisted of 9.5 μL of RNase-free water, 12.5 μL of Go Taq® Green Master Mix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, and 1 μL of cDNA / GUS plasmid. The PCR amplification protocol was 94°C denaturation for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, followed by extension at 72°C for 5 min. The amplified product was stored at 4°C. After completion of the reaction, the amplification results were analyzed by agarose gel electrophoresis.

[0027] The two PCR products obtained above were purified using a DNA purification kit (Tiangen Universal DNA Purification Kit) and used as templates for in vitro dsRNA transcription. The in vitro dsRNA transcription system consisted of 1000 ng of Template DNA, Enzyme Mix, 2 μL of T7 Express, 10 μL of RiboMAX™ Express T7 2× Buffer, and Nuclease-free water to a total of 20 μL. After brief centrifugation by flicking, the reaction was performed in a water bath as follows: incubation at 37°C for 4 hours, 70°C for 10 minutes, and 25°C for 20 minutes. After the reaction, 1 μL of DNAase and 1 μL of RNAase were added. After incubation at 37°C for 30 minutes, 2.2 μL of sodium acetate solution and 24.2 μL of isopropanol were added and the mixture was incubated at -20°C overnight to fully precipitate the dsRNA. The following day, the mixture was centrifuged at 14,000 g for 10 minutes, the supernatant removed, and the precipitate washed twice with 75% ethanol and centrifuged to obtain the dsRNA. The alcohol was removed by air purging in a clean bench and the precipitate was dissolved in nuclease-free water. The dsRNA was analyzed for integrity by 1.5% agarose gel electrophoresis and quantified using a NanoDrop 2000. The dsEIF4A-1 and dsGUS were obtained by dilution to a final concentration of 250 ng / μL. The dsRNA bands were verified by 1.5% agarose gel electrophoresis and stored at -80°C. The sequences of dsEIF4A-1 from Tetranychus viridis and Tetranychus urticae are SEQ ID NOs. 3 and 4, respectively.

[0028] SEQ ID NO.3 >ATCGCTCAAGCACAATCCGGAACAGGTAAAACTGCTACCTTCTCTATATCAATTTTGCAACAAATTGATACCACTTTGAATGAATGTCAAGCTCTCATTCTTGCTCCTACTCGAGAGTTGGCCCAACAGATCCAAAGGTAGTCCTTTCATTAGGTGATTACATGCATGCGCAGTGCCATGCTTGCATCGGTGGTACCTCTGTGAGGGCTGATATCAGCAAGCTTGAGATGGGAACGCA CATTGTTGCCGGAACTCCTGGCCGAGTTCTTGATATGATTGCTCGGCGTGCTTTACGCACCGACCACATCAAAATATTTGTTTTAGACGAAGCTGATGAAATGCTGTCTAGAGGTTTTAAGGACCAAATCTATGATGTTTTTAAGAGACTAGAGACGGATGTTCAGGTCATTCTGTTATCGGCCACCATGCCACAAGATGTATTAGAAGTCACCAAGAAATTTATGCGTGACCCCATCAG SEQ ID NO. 4 >ATCGCTCAAGCACAGTCTGGTACTGGTAAACCGCTACCTTCTCTATCTCAATTCTTCAACAAATTGATACTAGCATGAATGAATGCCAAGCTCTCATTCTTGCTCCCACTCGAGAATTGGCTCAACAGATTCAAAGGTGGTCCTCTCATTAGGTGATTACATGCATGCGCAATGCCATGCTTGTATCGGTGGAACCTCAGTGAGGGCTGATATCAGCAAGCTTGAAATGGGCACCCA CATCGTTGCCGGAACTCCCGGAAGAGTTTCGGATATGATTGCAAGGCGTGCTTTACGTACGGACCACATTAAAATATTTGTTCTAGATGAAGCTGATGAAATGCTCTCTAGAGGTTTTAAGGACCAAATCTACGATGTTTTTAAAAGACTAGAAACGGATGTTCAGGTCATTCTATTATCGGCCACCATGCCACAAGACGTATTAGAAGTCACCAAGAAATTTATGCGTGACCCCGTCAG Example 2 Lethal effects of dsRNA (dseIF4A-1) on Tetranychus viridis and Tetranychus urticae 1. Test method Peach leaves were cut into 17 mm diameter leaf discs using a hole punch and washed five times with nuclease-free water. 30–50 adult female mites were transferred to the discs. After the female mites laid 30–50 eggs, they were removed and 20 μL of dsRNA (250 ng / μL) in a Tween solution (the dsRNA was evenly mixed in the Tween solution to a final concentration of 0.005%) was evenly pipetted onto all spider mite eggs, completely immersing them in the dsRNA-Tween solution. After the eggs hatched, they were continued to be reared on the peach leaf discs. GUS was used as a negative control. The discs were placed on 0.25% agar gel to maintain moisture and prevent the escape of T. viciae and T. urticae. Mites were collected on day 4 post-hatching (at the stage of molting from prenymph to postnymph) for target gene expression analysis. Eight days after hatching (the second day of adulthood), spider mites were used to assess biological changes in the mite population. Three replicates were set up per group. After dsRNA treatment, the mites were placed in an artificial climate chamber (temperature 25 ± 1°C, humidity 50%-60%, photoperiod L:D = 16:8). The number of dead hawthorn spider mites and two-spotted spider mites in each replicate was counted, and mortality rates were calculated for both dsRNA and control treatments. On the second day of adulthood, 10 female mites were randomly selected from each replicate in each treatment group and individually reared on 17 mm leaf trays. The final number of eggs laid was recorded, and the average egg mass per female was calculated.

[0029] 2. Test results According to the statistical results, after being treated with dseIF4A-1, both the hawthorn spider mite and the two-spotted spider mite showed a melanized phenotype compared with the control group ( Picture 1 ), the mortality rates of hawthorn spider mite and two-spotted spider mite increased significantly, reaching 95.35% and 69.36% respectively ( Picture 2 The reproductive capacity was significantly reduced. The average number of eggs laid by each female two-spotted spider mite in the dseIF4A-1 treatment group was 4.70, while the average number of eggs laid by each female two-spotted spider mite in the dsGUS control group was 39.30. This indicates that dseIF4A-1 can induce a strong RNAi effect in the bodies of two-spotted spider mites, leading to the death of two-spotted spider mites and a decrease in reproductive capacity.

[0030] Example 3 dsRNA (dseIF4A-1) inhibits the growth of hawthorn spider mites and two-spotted spider mites EIF4A-1 Gene expression 1. Experimental methods Two hundred spider mites were collected on day four post-hatching (at the stage of molting from prenymph to postnymph) for target gene expression analysis, with three biological replicates collected for each treatment. RNA was extracted from T. viciae and T. urticae. 1 μg of total RNA was reverse-transcribed into cDNA and diluted 10-fold to serve as a template for quantitative real-time PCR (qPCR). Relative quantitative real-time PCR analysis was performed using primers P3 and P4. The qPCR system consisted of 7.76 μL of RNase-free water, 10 μL of 2× SYBR Green (SYBR® Green Realtime PCR MasterMix), 0.32 μL of a 10 μM forward primer, 0.32 μL of a 10 μM reverse primer, and 1.6 μL of cDNA template. The qPCR reaction was performed using a Bio-Rad C1000 Real-Time PCR system (BIO-RAD, USA). The reaction conditions were 95°C for 30 s; 40 cycles of 95°C for 5 s, 60°C for 30 s, and three technical replicates were analyzed for each biological replicate.

[0031] 2. Experimental results After eggs were treated with dseIF4A-1 solution, the relative expression levels of eIF4A-1 gene in T. viciae and T. urticae decreased by 67.39% and 36.34%, respectively ( Picture 3 ), indicating that dseIF4A-1 solution immersion treatment can cause a strong RNAi effect in the bodies of hawthorn spider mites and two-spotted spider mites, resulting in a significant decrease in the expression of the eIF4A-1 gene in the bodies, and then leading to the death of hawthorn spider mites and two-spotted spider mites or inhibition of reproduction.

[0032] The above example is based on the transcriptome library of hawthorn spider mite and two-spotted spider mite, and a gene with high lethality and reproductive impact was screened out - eIF4A-1 genes, and developed the use of eIF4A-1 This technique uses dsRNA of the gene (dseIF4A-1) to control hawthorn spider mites and two-spotted spider mites by soaking their eggs. In this example, hawthorn spider mites and two-spotted spider mites eggs were soaked in 20 μL of a solution of dseIF4A-1 and dsGUS synthesized in a kit until the solution was absorbed and dried. The eggs were left on peach leaves until they hatched, and the mortality rates of hawthorn spider mites and two-spotted spider mites were observed and recorded. Finally, fluorescence quantitative PCR (qPCR) was used to detect and analyze the presence of these two mites. eIF4A- 1 The expression levels of the gene changed in T. viciae and T. urticae after treatment with dseIF4A-1 and dsGUS. The results showed that soaking eggs in exogenous dseIF4A-1 solution had a significant lethal effect on T. viciae and T. urticae.

[0033] The above content is a further detailed description of the present invention in combination with a specific preferred embodiment. It cannot be considered that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, they can make several simple deductions or substitutions without departing from the present invention, which should be regarded as belonging to the scope of patent protection determined by the submitted claims of the present invention.

Claims

1. A method for preventing and controlling hawthorn spider mites and two-spotted spider mites eIF4A-1 The target gene is characterized in that Said eIF4A-1 The nucleotide sequences of the target genes are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. A dsRNA for controlling hawthorn spider mite and two-spotted spider mite, characterized in that: Using the method as claimed in claim 1 eIF4A-1 The target gene synthesizes dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A dsRNA for controlling hawthorn spider mite and two-spotted spider mite according to claim 2, characterized in that: The preparation of the dsRNA comprises the following steps: S1, using the cDNA sequences of two spider mites as templates, synthesized eIF4A-1 Gene fragments; S2, eIF4A-1 The gene fragment was used as a template to design a primer pair containing the T7 promoter sequence; S3, obtaining the dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

4. A dsRNA for controlling hawthorn spider mite and two-spotted spider mite according to claim 3, characterized in that: The S1 is specifically: eIF4A-1 The primer pairs were designed based on the DNA sequence of the gene, and the cDNA sequences of hawthorn spider mite and two-spotted spider mite were used as templates for PCR amplification. eIF4A-1 Gene fragment.

5. A method as claimed in claim 1 eIF4A-1 The use of a target gene or the dsRNA according to claim 2, characterized in that: The application includes any of the following: 1) As claimed in claim 1 eIF4A-1 Use of the target gene or the dsRNA according to claim 2 in controlling hawthorn spider mites and two-spotted spider mites; 2) As claimed in claim 1 eIF4A-1 Use of the target gene or the dsRNA according to claim 2 in preventing hawthorn spider mites and two-spotted spider mites and / or preparing products for preventing and controlling hawthorn spider mites and two-spotted spider mites; 3) As claimed in claim 1 eIF4A-1 Use of the target gene or the dsRNA according to claim 2 in promoting the death of hawthorn spider mites and two-spotted spider mites and / or in preparing products that promote the death of hawthorn spider mites and two-spotted spider mites.

6. A method for controlling hawthorn spider mites and two-spotted spider mites, characterized in that: The method is to introduce the dsRNA of claim 2 into the bodies of the hawthorn spider mite and the two-spotted spider mite.

Images