Method for deacidifying oil and producing 1, 3-diglyceride

Abstract

The invention relates to the technical field of grease processing, in particular to a method for deacidifying grease and producing 1, 3-diglyceride. The method for deacidifying the grease and producing the 1, 3-diglyceride comprises the following steps: (1) adding lipase ALA into the grease rich in long-chain fatty acid to partially hydrolyze the long-chain fatty acid to obtain a mixture with the content of the 1, 3-diglyceride exceeding 50% and the content of free fatty acid exceeding 40%; (2) adding glycerol and a catalyst rhizopus oryzae lipase into the mixture, and carrying out esterification reaction at 30-40 DEG C; and (3) after the reaction is finished, adding water liquid and separating the oleic acid, the catalyst and the glycerol, so that the oleic acid is degreased, and the 1, 3-diglyceride oil is obtained.

Description

Technical Field

[0001] The invention relates to the technical field of oil processing, and in particular to a method for deacidifying oil and producing 1,3-diacylglycerol. Background Art

[0002] In nature, whether it is from animals or plants, the crude oil contains a certain amount of free fatty acids. The content of these free fatty acids is affected by many factors, including the source type of the oil, freshness and extraction process, so there is a significant fluctuation in its content. Compared with other oil components, free fatty acids have poor oxidative stability and are very susceptible to oxidation reactions when they come into contact with oxygen, light or metal ions. Once the oxidation process starts, the oil will quickly deteriorate, produce unpleasant odors, and generate lipid oxides that are harmful to the human body. Therefore, in order to ensure the safety of oil products during use and storage, the content of free fatty acids must be reduced to below the safety standard. The process of removing free fatty acids from oils is called "deacidification". At present, the commonly used deacidification methods mainly include alkali refining deacidification, physical deacidification and enzymatic deacidification.

[0003] Alkali refining and deacidification is a traditional technology that achieves the purpose of deacidification by chemically reacting alkaline compounds with free fatty acids to produce soap substances. However, this process may lead to the loss of some neutral oils, so it is more suitable for oils with relatively low free fatty acid content. In addition, the by-product of alkali refining, soap stock, needs to be treated through further acidification and water washing steps, and its waste liquid discharge may pollute the environment, so the application of this method is gradually being restricted.

[0004] The physical deacidification method is carried out under high temperature and high vacuum conditions, and the free fatty acids are separated by distillation. Since the deacidification temperature required by this method is often over 240°C, it is not suitable for deacidification of heat-sensitive oils and fats.

[0005] In contrast, enzymatic deacidification uses lipase catalysis to bind free fatty acids to specific acyl receptors and deacidify under relatively mild reaction conditions. Enzymatic deacidification has the characteristics of simple operation, low energy consumption, and low water consumption. In addition, enzymatic deacidification is efficient and environmentally friendly, and the enzyme has the characteristics of specificity, which will not cause the possibility of secondary pollution.

[0006] Taking all factors into consideration, enzymatic deacidification has become an important means to improve the quality of oil products due to its high efficiency and environmental protection. With the enhancement of environmental awareness and the advancement of technology, enzymatic deacidification is expected to become the mainstream choice of oil deacidification process in the future.

[0007] In addition, the preparation method of 1,3-diacylglycerol generally adopts the hydrolysis method. The limiting factors of the hydrolysis method for preparing 1,3-diacylglycerol are that the activity of the sn-2 position selective lipase is not high or the selectivity is not high, or the enzyme activity is high but the by-product fatty acid content is very high, which seriously affects the quality of diacylglycerol. Summary of the invention

[0008] In order to overcome the shortcomings of the prior art, the present invention provides a method for deacidifying oils and producing 1,3-diacylglycerol. First, the long-chain fatty acids in oleic acid are partially hydrolyzed with ALA fatty acids to obtain a mixture with a 1,3-diacylglycerol content of more than 50% and a free fatty acid content of more than 40%, and then the mixture is reacted with glycerol under the catalysis of Rhizopus oryzae lipase to obtain 1,3-diacylglycerol. No other by-products are generated during the reaction process, which not only achieves the purpose of deacidification of oils and fats, but also obtains high-purity and high-quality 1,3-diacylglycerol oil.

[0009] The technical scheme of the present invention is as follows: A method for deacidifying oil and producing 1,3-diglyceride, comprising the following steps:

[0010] (1) adding lipase ALA to a fat rich in long-chain fatty acids to partially hydrolyze the long-chain fatty acids to obtain a mixture having a 1,3-diacylglycerol content exceeding 50% and a free fatty acid content exceeding 40%;

[0011] (2) adding glycerol and a catalyst, Rhizopus oryzae lipase, to the mixture to carry out an esterification reaction at 30-40° C.;

[0012] (3) After the reaction is completed, water is added to separate the oleic acid, the catalyst and the glycerol, thereby deesterifying the oleic acid and obtaining 1,3-diacylglycerol oil.

[0013] The mass ratio of the mixture to the glycerol is 1:3; the concentration of the ROL lipase is 0.5 mg / ml, and the added volume is 1 / 10 of the total volume.

[0014] The esterification reaction time is 24 hours.

[0015] The method for deacidifying oil and producing 1,3-diacylglycerol also includes a method for preparing the Rhizopus oryzae lipase, comprising the following steps:

[0016] 1) selecting a nucleotide sequence of Rhizopus oryzae lipase, and synthesizing a Rhizopus oryzae lipase DNA fragment according to the selected nucleotide sequence of Rhizopus oryzae lipase by gene synthesis;

[0017] 2) Design primers using the selected Rhizopus oryzae lipase nucleotide sequence as a template, amplify the target fragment using the PCR method using the synthesized Rhizopus oryzae lipase DNA fragment as a template; select pHBM vector to construct pHBM905BDM-ROL plasmid;

[0018] 3) The pHBM905BDM-ROL plasmid was electroporated into Pichia pastoris GS115 competent cells to obtain BDM-ROL strains, and the strains were shaken and fermented simultaneously to produce ROL lipase.

[0019] The selected nucleotide sequence of the Rhizopus oryzae lipase is shown in SEQ ID NO:1.

[0020] The primer sequences are: Primer F: gttcctgtttctggtaaatctggatcttcc; Primer R: caaacagcttccttcgttgatatcaaagtaactc.

[0021] The beneficial effects of the present invention are as follows: the technical solution described in the present invention first utilizes sn-2 selective lipase (ALA) to partially hydrolyze long-chain fatty acids to obtain a mixture with a 1,3-diacylglycerol content exceeding 50% and a free fatty acid content exceeding 40%. Then, a sn-2 position-specific lipase, namely, Rhizopus oryzae lipase (ROL), is utilized to effectively remove free fatty acids from oils and fats without affecting valuable functional components such as diacylglycerol. In this way, high-purity 1,3-diacylglycerol oil is produced in the process of enzymatic removal of fatty acids from oleic acid, which not only significantly improves the utilization rate of oil resources, but also maintains the original composition of oils and fats, thereby enhancing oxidative stability. In addition, the reaction products are easy to separate and purify, which optimizes the overall production process and shows extremely high application potential.

[0022] Existing deacidification methods mainly include alkali refining deacidification (neutralization reaction of alkaline substances with free fatty acids), physical deacidification (vacuum distillation) and enzymatic deacidification, which consume a lot of energy and water resources, and the reaction is uncontrollable. The conditions of the present invention are mild and easy to control.

[0023] The present invention utilizes free fatty acids in the hydrolyzate as substrates to further produce diglycerides, thereby realizing the recycling of by-products. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1a -c are the reaction TLC test diagrams of 50ml reaction system, 500ml reaction system and 5L reaction system respectively. Reaction result diagrams: ac) are the reaction TLC test diagrams of 50ml reaction system, 500ml reaction system and 5L reaction system respectively;

[0025] Figure 2a-c are the 1,3-diacylglycerol content curves obtained from the 50ml reaction system, 500ml reaction system, and 5L reaction system, respectively.

[0026] Figure 3a ) is the PCR detection graph of the target gene (SEQ ID NO: 1); Figure 3b ) Back-expansion image of the vector pHBM905BDM.

[0027] Figure 4 : SDS-PAGE image of ROL shake flask expression and fermentation, lanes 1-6 are ROL expressed in shake flasks by the screened positive colonies, and lane 7 is the sample of 30L ROL fermentation diluted five times.

[0028] Figure 5 : Standard protein BSA standard curve determination. DETAILED DESCRIPTION

[0029] In order to make the purpose of the invention, the technical scheme and the technical effect of the present invention more clear, the present invention is further described below in conjunction with specific implementation methods. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] The method for deacidifying oil and producing 1,3-diglyceride of the present invention comprises the following steps:

[0031] 1. Adding lipase ALA to oils and fats rich in long-chain fatty acids to partially hydrolyze the long-chain fatty acids to obtain a mixture having a 1,3-diacylglycerol content exceeding 50% and a free fatty acid content exceeding 40%, wherein the mixture also contains diester oil, triester oil and monoglyceride;

[0032] 2. Take the oil mixture and glycerol in a mass ratio of 1:3 and mix them thoroughly. Add ROL lipase with a concentration of 0.5 mg / ml, and the added volume is 1 / 10 of the total volume. Perform esterification reaction at 30°C and 40°C. After the esterification reaction is completed, the content of free fatty acids, 1,3-diaceryl, 1,2-diaceryl, triglyceride and monoglyceride in the sample is determined by thin layer chromatography. Figure 1a -c, which are the thin layer detection diagrams of 50ml reaction system, 500ml reaction system and 5L reaction system respectively; Figure 2a -c are the 1,3-diacylglycerol content curves obtained from the 50ml reaction system, 500ml reaction system, and 5L reaction system, respectively.

[0033] Among them, the following Examples 1-3 are the experimental process and related parameters of a 50ml reaction system, Examples 4-6 are the experimental process and related parameters of a 500ml reaction system, and Examples 7-8 are the experimental process and related parameters of a 5L reaction system.

[0034] Embodiment 1:

[0035] Take 1.125g of a long-chain fatty acid-rich oil mixture and 3.375g of glycerol, place them in a 150ml conical flask, mix and preheat to 30°C, then add 500μl of 0.5mg / ml Rhizopus oryzae lipase ROL, stir at a magnetic stirring speed of 400r / min, and the total reaction time is 48h.

[0036] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 50.2% to 27.1%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 18.5% to 30.7%.

[0037] Embodiment 2:

[0038] Take 1.125g of a long-chain fatty acid-rich oil mixture and 3.375g of glycerol, place them in a 150ml conical flask, mix and preheat to 40°C, then add 500μl of 0.5mg / ml Rhizopus oryzae lipase ROL, stir magnetically at a speed of 400r / min, and the total reaction time is 48h.

[0039] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 50.2% to 22.3%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 18.5% to 35.9%.

[0040] Embodiment 3:

[0041] Take 11.25g of a long-chain fatty acid-rich oil mixture and 33.75g of glycerol, place them in a 250ml conical flask, mix them and preheat them to 30°C, then add 5ml of 0.5mg / ml Rhizopus oryzae lipase ROL, stir them at a magnetic stirring speed of 400r / min, and the total reaction time is 48h.

[0042] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 50.2% to 22.6%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 37.1% to 54.0%.

[0043] Embodiment 4:

[0044] Take 11.25g of a long-chain fatty acid-rich oil mixture and 33.75g of glycerol, place them in a 250ml conical flask, mix and preheat to 40°C, then add 5ml of 0.5mg / ml Rhizopus oryzae lipase ROL, stir magnetically at a speed of 400r / min, and the total reaction time is 48h.

[0045] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate decreased from the initial 50.2% to 17.5%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate increased, among which the diglyceride content increased from the original 37.1% to 60.3%.

[0046] Embodiment 5:

[0047] Take 112.5g of a long-chain fatty acid-rich oil mixture and 337.5g of glycerol, place them in a 1L conical flask, mix them and preheat them to 30°C, then add 50ml of 0.5mg / ml Rhizopus oryzae lipase ROL, stir them at a magnetic stirring speed of 400r / min, and the total reaction time is 48h.

[0048] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 50.2% to 24.4%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 8.9% to 35.6%.

[0049] Embodiment 6:

[0050] Take 112.5g of a long-chain fatty acid-rich oil mixture and 337.5g of glycerol, place them in a 1L conical flask, mix them and preheat them to 40°C, then add 50ml of 0.5mg / ml Rhizopus oryzae lipase ROL, stir them at a magnetic stirring speed of 400r / min, and the total reaction time is 48h.

[0051] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 50.2% to 18.1%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 8.9% to 42.2%.

[0052] Embodiment 7:

[0053] 1125g of a long-chain fatty acid-rich oil mixture and 3375g of glycerol were placed in a 10L reactor, mixed and preheated to 30°C, and then 500ml of 0.5mg / ml Rhizopus oryzae lipase ROL was added. The magnetic stirring speed was 400r / min, and the total reaction time was 48h.

[0054] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 39.7% to 16.3%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 29.9% to 72.3%.

[0055] Embodiment 8:

[0056] 1125g of a long-chain fatty acid-rich oil mixture and 3375g of glycerol were placed in a 10L reactor, mixed and preheated to 40°C, and then 500ml of 0.5mg / ml Rhizopus oryzae lipase ROL was added. The magnetic stirring speed was 400r / min, and the total reaction time was 48h.

[0057] After the reaction, the free fatty acids, 1,3-diglycerides, 1,2-diglycerides, triglycerides and monoglycerides in the samples were detected by thin layer chromatography. The free fatty acid content in the hydrolyzate was reduced from the initial 39.7% to 7.8%, while the triglyceride, diglyceride and monoglyceride contents in the hydrolyzate were increased, among which the diglyceride content was increased from the original 29.9% to 80.8%.

[0058] Embodiment nine:

[0059] The method for deacidifying oil and producing 1,3-diacylglycerol of the present invention also includes a method for preparing Rhizopus oryzae lipase, comprising the following steps:

[0060] The nucleotide sequence of Rhizopus oryzae lipase was downloaded from NCBI as SEQ ID NO: 1.

[0061] The Rhizopus oryzae lipase DNA fragment was synthesized according to SEQ ID NO: 1 by gene synthesis.

[0062] 3. Using SEQ ID NO: 1 as a template, design primers as follows:

[0063] Primer F: gttcctgtttctggtaaatctggatcttcc;

[0064] Primer R: caaacagcttccttcgttgatatcaaagtaactc;

[0065] The target fragment was amplified by PCR with the synthesized Rhizopus oryzae lipase DNA fragment as a template, and the pHBM vector was selected to construct the pHBM905BDM-ROL plasmid. The target gene PCR detection diagram is shown in the figure. Figure 1a ) as shown; b) PCR reverse amplification diagram of vector pHBM905BDM as shown Figure 1b ) as shown.

[0066] 4. The competent cell of Pichia pastoris GS115 was electroporated to obtain BDM-ROL strain, and the flask was shaken and fermented at the same time. The target protein was detected by west blot. The SDS-PAGE diagram is shown in Figure 2, wherein lanes 1-6 are ROL expressed in shake flasks of the screened positive colonies, and lane 7 is a sample of 30L ROL fermentation diluted five times to obtain a large amount of Rhizopus oryzae lipase (ROL lipase).

[0067] 5. The BDM-ROL strain was expressed and fermented in a shake flask using conventional expression and fermentation methods, and ROL lipase was collected. The standard protein BSA was measured and the standard curve was shown in FIG3 .

[0068] 1) Selecting a nucleotide sequence of Rhizopus oryzae lipase from NCBI, as shown in SEQ ID NO: 1, and synthesizing a Rhizopus oryzae lipase DNA fragment using a gene synthesis method according to the selected nucleotide sequence of Rhizopus oryzae lipase;

[0069] 2) Primers were designed using the selected Rhizopus oryzae lipase nucleotide sequence as a template, the primer sequences being: Primer F: gttcctgtttctggtaaatctggatcttcc; Primer R: caaacagcttccttcgttgatatcaaagtaactc.

[0070] The target fragment was amplified by PCR with the synthesized Rhizopus oryzae lipase DNA fragment as a template; pHBM vector was selected to construct pHBM905BDM-ROL plasmid; the target gene PCR detection diagram is shown in Figure 3a ) shown; the PCR reverse amplification diagram of the vector pHBM905BDM is shown Figure 3b )

[0071] 3) The pHBM905BDM-ROL plasmid was electroporated into Pichia pastoris GS115 competent cells to obtain BDM-ROL strains, and the flask was shaken and fermented to produce ROL lipase. The target protein was detected by west blot, and its SDS-PAGE diagram is shown in Figure 2, where lanes 1-6 are ROL expressed by the positive colonies screened out by shaking flasks, and lane 7 is a sample of 30L ROL fermentation diluted five times to obtain a large amount of Rhizopus oryzae lipase (ROL lipase).

[0072] 4) Collect ROL lipase and measure its standard protein BSA standard curve as follows Figure 5 shown.

[0073] The above content is a further detailed description of the present invention in combination with specific preferred implementation methods, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, without departing from the concept of the present invention, its architecture can be flexible and can derive a series of products. Just making a few simple deductions or substitutions should be regarded as belonging to the scope of patent protection of the present invention determined by the submitted claims.

Claims

1. A method for deacidifying oil and producing 1,3-diglyceride, characterized in that: The steps include: (1) adding lipase ALA to oils and fats rich in long-chain fatty acids to partially hydrolyze the long-chain fatty acids, thereby obtaining a mixture having a 1,3-diacylglycerol content exceeding 50% and a free fatty acid content exceeding 40%; (2) adding glycerol and a catalyst, Rhizopus oryzae lipase, to the mixture to carry out an esterification reaction at 30-40° C.; (3) After the reaction is completed, water is added to separate the oleic acid, the catalyst and the glycerol, thereby deesterifying the oleic acid and obtaining 1,3-diacylglycerol oil.

2. The method for deacidifying oil and producing 1,3-diglyceride as claimed in claim 1, characterized in that: The mass ratio of the mixture to the glycerol is 1:3; the concentration of the ROL lipase is 0.5 mg / ml, and the added volume is 1 / 10 of the total volume.

3. The method for deacidifying oil and producing 1,3-diglyceride as claimed in claim 1, characterized in that: The esterification reaction time is 24 hours.

4. The method for deacidifying oil and producing 1,3-diglyceride according to any one of claims 1 to 3, characterized in that: Also included is a method for preparing the Rhizopus oryzae lipase, comprising the following steps: 1) selecting a nucleotide sequence of Rhizopus oryzae lipase from NCBI, and synthesizing a Rhizopus oryzae lipase DNA fragment according to the selected nucleotide sequence of Rhizopus oryzae lipase by gene synthesis; 2) Design primers using the selected Rhizopus oryzae lipase nucleotide sequence as a template, amplify the target fragment using the PCR method using the synthesized Rhizopus oryzae lipase DNA fragment as a template; select pHBM vector to construct pHBM905BDM-ROL plasmid; 3) The pHBM905BDM-ROL plasmid was electroporated into Pichia pastoris GS115 competent cells to obtain BDM-ROL strains, and the strains were shaken and fermented simultaneously to produce ROL lipase.

5. The method for deacidifying oil and producing 1,3-diglyceride as claimed in claim 4, characterized in that: The selected nucleotide sequence of the Rhizopus oryzae lipase is shown in SEQ ID NO:

1.

6. The method for deacidifying oil and producing 1,3-diglyceride as claimed in claim 4, characterized in that: The primer sequences are: Primer F: gttcctgtttctggtaaatctggatcttcc; Primer R: caaacagcttccttcgttgatatcaaagtaactc.

Images