Detection kit for rapidly detecting JAK2 V617F mutation and detection method thereof

Abstract

The invention provides a detection kit for rapidly detecting JAK2V617F mutation and a detection method thereof. The nucleotide sequence of an upstream primer RPA-F for RPA amplification is SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8, and the nucleotide sequence of a downstream primer RPA-R for RPA amplification is SEQ ID NO.9 or SEQ ID NO.10; the nucleotide sequence of the crRNA is as shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4. The detection kit disclosed by the invention is high in JAK2V617F mutation detection sensitivity and strong in specificity, and the detection method is simple and easy to operate on the basis of a tubular RPA-CRISPR / LwaCas13a technology.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a detection kit and a detection method thereof for rapidly detecting JAK2 V617F mutation. Background Art

[0002] Myeloproliferative neoplasms (MPNs) are a group of chronic clonal diseases originating from bone marrow hematopoietic stem cells, also known as myeloproliferative diseases, mainly including chronic myeloid leukemia (CML), polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF), etc. JAK2 (Janus kinase 2) is a non-receptor tyrosine kinase that plays an important role in cell signal transduction. V617F is a mutation site of the JAK2 gene, located at position 617 of the pseudokinase JH2 region of the JAK2 kinase gene region, in which valine (V) is replaced by phenylalanine (F) (G→T). This mutation leads to enhanced JAK2 protein kinase activity, which continuously stimulates the proliferation and differentiation of hematopoietic cells. JAK2 V617F mutation is closely related to the occurrence of various blood diseases. About 95% of PV patients, 50% to 60% of ET patients, and 40% to 50% of PMF patients have JAK2 V617F mutation. The World Health Organization (WHO) included JAK2V617F mutation in the diagnostic criteria for MPN in 2016. JAK2 V617F gene mutation detection can assist doctors in disease diagnosis. At the same time, regular detection of JAK2 V617F mutation can also monitor minimal residual disease (MRD) and efficacy, and observe recurrence of the disease.

[0003] At present, the detection methods of JAK2 V617F mainly include the following: fluorescence quantitative PCR, allele-specific PCR, digital PCR, and gene sequencing. However, traditional methods for detecting JAK2 V617F mutations, such as Sanger sequencing and allele-specific primer qualitative PCR, generally have the disadvantages of being time-consuming, labor-intensive, easy to contaminate, and low in sensitivity, which limits their promotion and application in clinical practice; the quantitative PCR method based on TaqMan-MGB probe to detect JAK2 V617F mutations has a sensitivity of about 0.5%, which is limited in the application of dynamic monitoring of patients with low mutation load. Next-generation sequencing (NGS) technology can detect multiple target genes at the same time with high sensitivity, but NGS instruments and reagents are expensive, complicated to operate, time-consuming, and data analysis and interpretation require strong professionalism. It is currently mostly used for screening gene mutation maps of newly diagnosed patients, and is not suitable for dynamic tracking detection of MPN patients with JAK2 V617F single gene mutations.

[0004] In recent years, the CRISPR / Cas system composed of clustered regularly interspaced short palindromic repeats (CRISPR) and its associated proteins (Cas) has rapidly emerged in the field of molecular diagnosis. Commonly used CRISPR detection systems mainly include Cas9, Cas12 and Cas13. Among them, Cas12 and Cas13 are widely studied and applied because of their unique trans-cleavage properties. Specifically, when the target DNA or RNA sequence is recognized by combining Cas12 or Cas13 protein with artificial in vitro synthesized crRNA, the trans-cleavage property of Cas protein can be activated, and the DNA or RNA molecules in the non-specific cleavage reaction can be marked and modified to achieve accurate and efficient detection of the target. Combined with nucleic acid isothermal amplification technologies such as recombinase polymerase amplification (RPA), the detection sensitivity of CRISPR / Cas technology has been significantly improved. However, since the purpose of pre-amplification is to increase the number of targets, and the Cas enzyme, as a nuclease, is intended to cut the target, the two are mutually exclusive. Mixing the amplification system with the CRISPR / Cas detection system will affect the detection sensitivity. If the "two-step method" is used to separate the amplification system and the CRISPR / Cas detection system, the amplified product needs to be manually transferred to the CRISPR / Cas detection system. This operation is prone to some problems, such as aerosol contamination, increased false positives, cumbersome operation steps and long detection time. Therefore, it is urgent to develop a rapid one-tube RPA-CRISPR / Cas detection technology to achieve convenient and sensitive detection of JAK2 V617F gene mutations. Summary of the invention

[0005] The present invention provides a detection kit and a detection method for rapidly detecting JAK2 V617F mutation, which have the characteristics of high sensitivity and strong specificity for JAK2 V617F mutation detection, and are based on one-tube RPA-CRISPR / LwaCas13a technology, so that the detection system and the detection method are easy to operate.

[0006] The technical solution of the present invention is implemented as follows: an RPA amplification primer and crRNA for rapid detection of JAK2 V617F mutation, the RPA amplification primer comprising an upstream primer RPA-F and a downstream primer RPA-R for RPA amplification, the nucleotide sequence of the upstream primer RPA-F is SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8, and the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO.9 or SEQ ID NO.10; the nucleotide sequence of the crRNA is SEQID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0007] Furthermore, the nucleotide sequence of the upstream primer RPA-F is SEQ ID NO.7, the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO.10; and the nucleotide sequence of the crRNA is SEQ ID NO.4.

[0008] The crRNA is used to specifically identify the JAK2 V617F mutation, and the 9th base and the 11th base from the 3' end of the crRNA sequence are artificial mismatches.

[0009] SEQ ID NO.7 and SEQ ID NO.10 are both single-stranded DNA molecules. The downstream primer RPA-R2 (corresponding to SEQ ID NO.10) adds a T7 promoter sequence at the 5' end based on the conventional RPA primer, so that during amplification, the sample DNA can be transcribed into RNA using T7 RNA polymerase to be recognized by CRISPR / LwaCas13a and trans-cleave the ssRNA reporter molecule.

[0010] A detection kit for rapidly detecting JAK2 V617F mutation, comprising the RPA amplification primer and crRNA.

[0011] Furthermore, it also includes a ssRNA reporter molecule, the nucleotide sequence of the ssRNA reporter molecule is such as SEQ ID NO: 11, specifically FAM-UUUUU-BHQ1.

[0012] The ssRNA reporter molecule is a single-stranded RNA probe U5 double-labeled with a fluorescent group and a quencher group. The 5' end of the single-stranded RNA probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher group BHQ1. The nucleotide sequence of the single-stranded RNA probe U5 is as shown in SEQ ID NO: 11, specifically FAM-UUUUU-BHQ1.

[0013] The ssRNA reporter molecule is a single-stranded RNA probe U5 modified with a fluorescent group FAM and a quenching group BHQ1 at both ends. The reporter molecule can emit a fluorescent signal when detecting the JAK2 V617F gene mutation, but does not emit a fluorescent signal when detecting the wild type, thereby achieving the purpose of identifying whether the JAK2V617F gene has a mutation in one reaction.

[0014] Furthermore, the detection kit includes 200-800nM of the RPA amplification primer, 500nM ssRNA reporter molecule, 0.25-2U / μL T7 RNA polymerase, 25-200nM LwaCas13a, 100-800nM of the crRNA, 0.5-4mM rNTP mix, 1U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix and 14mM MgOAc.

[0015] Furthermore, the detection kit includes 400nM of the RPA amplification primer, 500nM ssRNA reporter molecule, 1U / μL T7 RNA polymerase, 50nM LwaCas13a, 100nM of the crRNA, 2mM rNTP mix, 1U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix and 14mM MgOAc.

[0016] A method for rapidly detecting JAK2 V617F mutation comprises the following steps:

[0017] (1) extracting the sample to be tested using a blood genomic DNA extraction kit to obtain a DNA template;

[0018] (2) mixing the DNA template with the detection kit to obtain a detection system;

[0019] (3) incubating the detection system;

[0020] (4) During the incubation process, signals are collected at set intervals to determine the type of sample to be tested.

[0021] Furthermore, in step (4), a FAM fluorescence signal is collected at a wavelength of 465-510 nm, and the type of the sample to be tested is determined by observing the FAM fluorescence. If it is green fluorescence and there is a significant difference compared with the negative control, it is judged that the sample contains the JAK2 V617F gene mutation. If it does not emit light and the fluorescence value is not significantly different from the negative control, it is judged that the sample does not contain the JAK2 V617F gene mutation.

[0022] Furthermore, in step (3), the incubation conditions are: incubation at 37° C. for 15-30 min.

[0023] Furthermore, in step (4), the time is set to 30-60s.

[0024] Beneficial effects of the present invention:

[0025] The detection kit of the present invention is a one-step RPA-CRISPR / LwaCas13a technology integrated in a single tube. After the extracted DNA template is added to the detection system, there is no need to open the cover, and RPA amplification and CRISPR detection are performed in one tube, which effectively avoids the transfer operation and aerosol contamination risk of the two-step CRISPR reaction. There is no need to use precise and expensive instruments and equipment. Samples with a mutation frequency as low as 0.1% can be detected within 15-30 minutes at 37°C, achieving rapid, simple, highly sensitive and highly specific detection of JAK2 V617F mutations, and can be applied to the rapid diagnosis of myeloproliferative diseases and the monitoring of disease progression and efficacy.

[0026] In addition, the present invention optimizes the detection system of the detection kit, and uses CRISPR detection technology to greatly improve the detection sensitivity and specificity, avoiding false detection and missed detection, making it easier for doctors to treat patients, reducing the requirements for application scenarios such as detection equipment, simplifying the operation steps, and eliminating the need for professional personnel, making the detection of JAK2 V617F gene mutations easier to promote and more conducive to assisting doctors in disease diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 This is a diagram showing the screening results of using different crRNAs to detect JAK2 V617F gene mutations;

[0029] Figure 2 The fluorescence ratio of F617 to V617 was detected by different combinations of upstream primer RPA-F and downstream primer RPA-R when incubated for 30 min;

[0030] Figure 3 This is the reaction system and temperature optimization results for detecting the JAK2 V617F gene mutation using the detection kit of this application.

[0031] Figure 4 This is a graph showing the sensitivity test results of the detection kit of this application for detecting JAK2 V617F gene mutation. DETAILED DESCRIPTION

[0032] The present application is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present application, not for limiting the scope of the present application. The examples provided below can be used as a guide for further improvements by ordinary technicians in the technical field, and do not constitute a limitation of the present application in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] The LwaCas13a in the following embodiments is a product of Tolo Harbour Company, with the item number being 32117-01.

[0035] The T7 RNA polymerase in the following examples is a product of New England Biolabs, with the product number M0251.

[0036] The rNTP mix in the following examples is a product of New England Biolabs, with a product number of N0466L.

[0037] The recombinant RNase inhibitor in the following examples is a product of Solebio, with the product number R8061.

[0038] The RPA lyophilized powder, RPA resuspension (RPA Basic E-mix) and 280 mM magnesium acetate (MgOAc) in the following examples are TwistDx TM Product, item number: TABAS03KIT.

[0039] The ssRNA reporter molecules (ie, fluorescence quenching probes) in the following examples were commissioned to be synthesized by Shanghai Shenggong Company.

[0040] The primers and crRNA preparation templates in the following examples were commissioned to be synthesized by Jiangsu Saisuofei Company.

[0041] Note: The crRNA described in the present invention is prepared by in vitro transcription. Specifically, crRNA in vitro transcription mainly includes three steps: annealing hybridization reaction, transcription, and RNA purification, as follows:

[0042] (1) Annealing hybridization reaction: used to produce double-stranded DNA templates to be transcribed. Specifically, the 10 μL annealing reaction system contains 1 μL chemically synthesized crRNA preparation template (100 μM), 1 μL T7 promoter primer (sequence: GAAATTAATACGACTCACTATAGGG) (100 μM), 1 μL Standard Taq buffer (10×) (purchased from New England Biolabs, catalog number B9014), and 7 μL enzyme-free sterile water (purchased from Solebao, catalog number R1600); the reaction system is denatured at 95°C for 5 minutes on an ABIPCR instrument (Thermo, model: Veriti96), and then annealed to 4°C at a gradient cooling rate of 0.1°C / s.

[0043] (2) Transcription: Using HiScribe TM The annealing reaction product was transcribed using the T7 Rapid Efficient RNA Synthesis Kit (purchased from New England Biolabs, catalog number E2040) according to the manufacturer's instructions and incubated in a metal bath at 37°C for 8 to 12 hours.

[0044] (3) RNA purification: Use deoxyribonuclease (purchased from Promega, catalog number M6101) to degrade the excess DNA in the transcription product. Then, according to the manufacturer's instructions, use RNA Clean & Concentrator-5 Kit (purchased from ZYMO, catalog number R1013) to purify the transcribed RNA to complete the preparation of crRNA. The crRNA prepared above was purified by One After quantification using an OD-1000 spectrophotometer (Wuyi Technology, model: OD1000+), the samples were stored at -80°C for a long term for subsequent use.

[0045] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0046] The following examples used GraphPad Prism statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Two-tailed Student t test was used, P < 0.001 (***), P < 0.01 (**), P < 0.05 (*), ns means P > 0.05, there is no significant difference.

[0047] 1. Design and synthesize target crRNA

[0048] The JAK2 gene sequence (Gen bank number: NM_001322198.2) was obtained from GenBank, and the detection site was selected from the V617F mutation region of the sequence. According to the characteristics of the JAK2 V617F gene mutation, multiple LwaCas13a protein crRNAs were independently designed. The crRNAs are: SEQ NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ NO.4 in Sequence Table 1.

[0049] 2. Design and synthesis of RPA amplification primers

[0050] According to the JAK2 gene sequence obtained from GenBank (Gen bank number: NM_001322198.2), the upstream primer RPA-F and the downstream primer RPA-R for RPA amplification were designed, and a T7 promoter sequence was added to the 5' end of the downstream primer to generate an ssRNA sequence that can be recognized and sheared by LwaCas13a. The upstream primer RPA-F pair is SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8 in Sequence Table 1; the downstream primer RPA-R pair is SEQ ID NO.9 and SEQ ID NO.10 in Sequence Table 1.

[0051] Table 1 crRNA sequences and RPA primer sequences

[0052]

[0053] Note: Bold bases with gray background are mutation sites, bold italic bases with underlines are artificial mismatch bases, straight lines are repeated sequences, and wavy lines are T7 primer complementary sequences.

[0054] 3. DNA Extraction

[0055] DNA was extracted using a blood genomic DNA extraction kit (Hangzhou Biori Technology Co., Ltd., catalog number: BSC06) according to the kit instructions, and the extracted DNA was stored at -20°C.

[0056] IV. RPA-CRISPR / LwaCas13a reaction

[0057] The detection kit was prepared, including 400nM RPA amplification primer, 500nM ssRNA reporter, 1U / μL T7 RNA polymerase, 50nM LwaCas13a, 100nM crRNA, 2mM rNTP mix, 1U / μL recombinant RNase inhibitor, 1×RPBABasic E-mix, and 14mM MgOAc. After that, DNA template was added to the detection kit, and the reaction was carried out at 37°C for 30 minutes on the Bio-Rad CFX96 fluorescence quantitative PCR instrument, and FAM fluorescence signals were collected at a wavelength of 465-510nm every 1 minute.

[0058] 5. Interpretation of results

[0059] The type of sample to be tested is determined by observing the FAM fluorescence. If there is FAM fluorescence and there is a significant difference compared with the negative control, it is judged that the sample contains the JAK2 V617F gene mutation. If there is no luminescence and the fluorescence value is not significantly different from the negative control, it is judged that the sample does not contain the JAK2 V617F gene mutation.

[0060] Screening RPA amplification primers and crRNA: The RPA amplification primers F1 to F4, R1 to R2 and crRNA1-4 prepared above were screened (sequences are shown in Table 1). Figure 1 As shown, Figure 1 (A) is the curve of the relative fluorescence units of F617 and V617 detected by different crRNAs versus the number of cycles, with one minute as one cycle; Figure 1 (B) is the fluorescence ratio of F617 to V617 detected by different crRNAs at 30 cycles (i.e., incubation for 30 min); the fluorescence detection results show that the designed crRNA4 has the best effect, and its fluorescence ratio of F617 to V617 is the highest (9.30 times); Figure 2 As shown, the combination of RPA amplification primers RPA-F3 and RPA-R2 had the best effect, and the fluorescence ratio of detecting F617 to V617 was the highest (25.75 times), so crRNA4, primer pairs RPA-F3 and RPA-R2 were selected for the one-tube RPA-CRISPR / LwaCas13a reaction.

[0061] Optimization of reaction system and temperature of the detection kit (one-tube RPA-CRISPR / LwaCas13a):

[0062] In order to further improve the detection efficiency of the one-tube RPA-CRISPR / LwaCas13a reaction system, the present invention optimizes the key components such as rNTP mix, T7 RNA polymerase, RPA amplification primer, LwaCas13a, and crRNA concentration one by one, and optimizes the incubation temperature during detection. Figure 3 As shown in Figure 1, AE is the relative fluorescence unit of the endpoint obtained by reacting different concentrations of LwaCas13a, rNTP mix, T7 RNA polymerase, crRNA and RPA amplification primer for 30 minutes, and Figure F is the relative fluorescence unit of the endpoint obtained by reacting at different incubation temperatures for 30 minutes. The results show that the one-tube RPA-CRISPR / LwaCas13a reaction system has the best detection performance under the conditions of 2mM rNTPmix, 1U / μL T7 RNA polymerase, 400nM RPA amplification primer, 50nM LwaCas13a, 100nM crRNA, and 37°C.

[0063] Sensitivity test of the detection kit (one-tube RPA-CRISPR / LwaCas13a)

[0064] In order to determine the sensitivity of the one-tube RPA-CRISPR detection of JAK2 V617F gene mutation, JAK2 V617F wild-type blood DNA was used to dilute the JAK2 V617F gene mutation blood DNA (mutation rate was 85.5% by NGS sequencing) into five gradients with mutation rates of 50%, 5%, 1%, 0.1%, and 0.01% as templates, and the detection was performed separately according to the detection system after component optimization. The results are shown in Figure 4 As shown, the fluorescence signal of the template with a mutation rate of more than 0.1% after 30 minutes of amplification was significantly higher than that of the wild-type group, indicating that the JAK2 V617F gene mutation detection system based on RPA-CRISPR / Cas established in the present invention can detect samples with a mutation rate of 0.1% and has high sensitivity.

[0065] Clinical sample validation of the test kit (one-tube RPA-CRISPR / LwaCas13a)

[0066] In order to explore the clinical applicability of this method, 22 clinical samples were collected in this application and tested respectively according to the detection system after component optimization. The results are shown in Table 2. The results show that all samples were accurately identified. The detection results of clinical samples by the method described in this application are completely consistent with those of the qPCR method, indicating that this method can not only meet the needs of clinical detection, but also has the advantages of short detection time and convenient operation.

[0067] Table 2 qPCR method and the clinical sample validation results of the present application for detecting JAK2 V617F gene mutation

[0068]

[0069] The qPCR method used in the study to detect the JAK2 V617F gene mutation was used as a control for the one-tube RPA-CRISPR / LwaCas13a detection method. The qPCR reaction system specifically includes: 4μL Taq buffer (5×), 0.8μL TaqMaster PCR Mix, 0.8μL upstream primer PCR-F (10μM), 0.8μL downstream primer PCR-R (10μM), 0.8μL probe PCR-P (10μM), and water is added to 20μL. The qPCR reaction conditions are as follows: ① UNG enzyme activation: 50℃ reaction for 2min; ② Hot start DNA polymerase activation: 95℃ reaction for 2min; ③ Amplification cycle: including 40 temperature control cycles, including 94℃ denaturation reaction for 30s and 55℃ annealing extension for 30s.

[0070] The above qPCR reaction was carried out on a desktop real-time fluorescence PCR instrument ABI-7500Fast. Among them, the upstream primer PCR-F is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No.12, and the sequence is 5'-GAAGCAGCAAGTATGATGAGC-3'; the downstream primer PCR-R is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No.13, and the sequence is 5'-GACACCTAGCTGTGATCCTG-3'; the nucleotide sequence of the probe PCR-P is SEQ ID No.14, and its 5' end is connected to the fluorescent group FAM, and the 3' end is connected to the fluorescent quenching group MGB, and the sequence is 5'-FAM-TCCACAGAAACATAC-MGB-3'.

[0071] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. An RPA amplification primer and crRNA for rapid detection of JAK2 V617F mutation, characterized in that: The RPA amplification primers include an upstream primer RPA-F and a downstream primer RPA-R for RPA amplification, the nucleotide sequence of the upstream primer RPA-F is SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8, and the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO.9 or SEQ ID NO.10; the nucleotide sequence of the crRNA is SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

2. The RPA amplification primer and crRNA according to claim 1, characterized in that: The nucleotide sequence of the upstream primer RPA-F is SEQ ID NO.7, and the nucleotide sequence of the downstream primer RPA-R is SEQ ID NO.10; the nucleotide sequence of the crRNA is SEQ ID NO.

4.

3. A detection kit for rapid detection of JAK2 V617F mutation, characterized in that: Comprising the RPA amplification primer and crRNA according to claim 1 or 2.

4. The detection kit according to claim 3, characterized in that: It also includes a ssRNA reporter molecule, the nucleotide sequence of which is SEQ ID NO: 11, specifically FAM-UUUUU-BHQ1.

5. The detection kit according to claim 3, characterized in that: The detection kit includes 200-800nM of the RPA amplification primer, 500nM ssRNA reporter molecule, 0.25-2U / μL T7 RNA polymerase, 25-200nM LwaCas13a, 100-800nM of the crRNA, 0.5-4mM rNTP mix, 1U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix and 14mM MgOAc.

6. The detection kit according to claim 3, characterized in that: The detection kit includes 400nM of the RPA amplification primer, 500nM ssRNA reporter molecule, 1U / μL T7 RNA polymerase, 50nM LwaCas13a, 100nM of the crRNA, 2mM rNTP mix, 1U / μL recombinant RNase inhibitor, 1×RPA Basic E-mix and 14mM MgOAc.

7. A method for rapidly detecting JAK2 V617F mutation, characterized in that: The following steps are involved: (1) extracting the sample to be tested using a blood genomic DNA extraction kit to obtain a DNA template; (2) mixing the DNA template with the detection kit according to any one of claims 3 to 6 to obtain a detection system; (3) incubating the detection system; (4) During the incubation process, signals are collected at set intervals to determine the type of sample to be tested.

8. The detection method according to claim 7, characterized in that: In step (4), the FAM fluorescence signal is collected at a wavelength of 465-510 nm. The type of the sample to be tested is determined by observing the FAM fluorescence. If it is green fluorescence and there is a significant difference compared with the negative control, it is judged that the sample contains the JAK2V617F gene mutation. If it is not luminescent and the fluorescence value is not significantly different from the negative control, it is judged that the sample does not contain the JAK2 V617F gene mutation.

9. The detection method according to claim 7, characterized in that: In step (3), the incubation conditions are: incubation at 37° C. for 15-30 min.

10. The detection method according to claim 7 or 8, characterized in that: In step (4), set the time to 30-60s.

Images