High-body siniperca chuatsi matching breeding method

Abstract

The invention belongs to the technical field of siniperca chuatsi breeding, and particularly relates to a high-body siniperca chuatsi matching breeding method which comprises the processes of individual marking, character measurement, genetic relationship identification, breeding file establishment for matching breeding, filial generation cultivation and new family parent update construction. The invention further comprises a duplex PCR primer pair combination for matching and breeding of the siniperca chuatsi. According to the high-body siniperca chuatsi matching breeding method, close mating of high-body siniperca chuatsi can be effectively avoided, the genetic diversity of high-body siniperca chuatsi groups is kept and improved, and germplasm degeneration of high-body siniperca chuatsi In addition, specific molecular markers are utilized to assist breeding, a breeding file is established, and the genetic distance of the population is analyzed in combination with various parameters in the file, so that the dominant population is selectively reserved, and the offspring with excellent germplasm is copulated.

Description

Technical Field

[0001] The invention belongs to the technical field of mandarin fish breeding, and relates to a method for breeding high-bodied mandarin fish in pairs. Background Art

[0002] The Greater Mandarin Fish (Siniperca chuatsi), also known as the Mandarin Fish, belongs to the family Sinipercaidae of the order Perciformes and is a commercial fish endemic to the freshwater basins of eastern China. This fish has a laterally flattened body, a thick back and a thin belly, a large mouth, and a prominent lower jaw. Its body color is typically brownish-yellow with irregular black patches or markings. It is a typical carnivorous fish that primarily feeds on small fish and shrimp, and has high economic and nutritional value.

[0003] In artificial aquaculture, the greater mandarin fish is highly adaptable and can survive in a variety of aquatic environments. However, it has high water quality requirements, requiring fresh, oxygen-rich water. Aquaculture techniques include pond culture, cage culture, and flow-through aquaculture, with particular attention paid to feed administration, disease prevention, and growth cycle management. Artificial formula feeds or live bait are commonly used as food sources.

[0004] In artificial breeding, the greater mandarin fish typically reaches sexual maturity at 2-3 years old. Hormone induction or environmental manipulation can be used to promote spawning. The breeding season typically falls between spring and summer, and artificial induction and incubation techniques can effectively improve fertilization and hatching rates.

[0005] Inbreeding often occurs during artificial breeding and reproduction of greater mandarin fish, leading to declines in offspring. A scientific method is urgently needed to guide the selection of reserve broodstock for breeding and pairing. Summary of the Invention

[0006] The present invention aims to provide a dual PCR primer pair combination for breeding of tall mandarin fish. The primer pair combination information is as follows:

[0007] Group 1:

[0008] GTG1 F(SEQ ID NO.1)CGCCTTTACGTCAGTG

[0009] GTG1 R(SEQ ID NO.2)CAATATCCTCCGTCTCA

[0010] GTG2 F(SEQ ID NO.3)CTGCTTTGTTGTGAAATT

[0011] GTG2 R(SEQ ID NO.4)GAGACTCAAGGCAGGTTA

[0012] Group 2:

[0013] GTG3 F (SEQ ID NO.5) CCCAGCAAGTGACTACAA

[0014] GTG3 R (SEQ ID NO.6) GGCCAGCCATGAGGTT

[0015] GTG4 F (SEQ ID NO.7) TTCAGGCAGGCTCCAC

[0016] GTG4 R (SEQ ID NO.8) CAGTACATCCCACTAGACAAA

[0017] Group 3:

[0018] GTG5 F (SEQ ID NO.9) TTGGGAATTGTAGAGGAAA

[0019] GTG5 R (SEQ ID NO.10) GCCAGTTGAAGGCAGAC

[0020] GTG6 F (SEQ ID NO.11) AGGACAACTTCTTGGAG

[0021] GTG6 R (SEQ ID NO.12) TTTCGGTACTGATAGTAAA

[0022] Group 4:

[0023] GTG7 F (SEQ ID NO.13) AATCCCTGAACTCTGCTT

[0024] GTG7 R (SEQ ID NO.14) CAACATTAACGCCTCTGT

[0025] GTG8 F (SEQ ID NO.15) TTGTTATGCCTGACGAGAC

[0026] GTG8 R (SEQ ID NO.16) GTGCTGTTCATTGGGTGA

[0027] Group 5:

[0028] GTG9 F (SEQ ID NO.17) TCGCCGCTGAGGAGTAG

[0029] GTG9 R (SEQ ID NO.18) AAACCAGAGGTCTCCCAAAT

[0030] GTG10 F(SEQ ID NO.19)GCTGCCGTCACTGAAAGT

[0031] GTG10 R(SEQ ID NO.20)CGCAAATATGGGAGGAG

[0032] Another object of the present invention is to provide a method for breeding tall mandarin fish, characterized by comprising the following steps:

[0033] 1. Marking of candidates: Select a group of Siniperca chuatsi broodstock and inject the PIT marker into these candidate Siniperca chuatsi broodstock;

[0034] 2. Trait measurement and broodstock selection: Measure the length or weight of each candidate broodstock marked in step 1, and select female individuals with a body length greater than 24 cm and male individuals with a body length greater than 22 cm as candidate broodstock;

[0035] 3. Phylogenetic relationship identification: DNA of each reserve broodstock selected in step 2 was extracted, and primer pairs were designed for 10 microsatellite loci of Siniperca chuatsi. The primer pairs included five sets of dual PCR primer pairs for PCR amplification of DNA from each individual. The primer pairs were used in pairs, with GTG1 and GTG2 used in combination; GTG3 and GTG4 used in combination; GTG5 and GTG6 used in combination; GTG7 and GTG8 used in combination; and GTG9 and GTG10 used in combination. Specific information is shown in Table 1 below.

[0036] Based on the amplification results, a cluster development tree was constructed to analyze the relative genetic distance between each individual and identify the kinship relationship;

[0037] 4. Establish a breeding file: Based on the closeness of the relationship of all reserve broodstock and the individual traits, select male and female individuals with a body length range exceeding the average body length of the reserve broodstock group, or a weight range exceeding the average weight of the reserve broodstock group, with distant genetic relationships and good traits to form a pairing combination. One female individual is paired with three candidate male individuals for pairing and breeding, and the offspring are raised to sexual maturity;

[0038] 5. Parental updating: Based on the breeding archives, cluster analysis is performed on the reserve broodstock selected in step 4 and all the offspring obtained in step 4 each year. Male and female individuals whose body length exceeds the average body length of the reserve broodstock population or whose weight exceeds the average weight of the reserve broodstock population, and whose genetic relationship is not the same branch or adjacent branches as determined by the cluster development tree, are selected to form paired combinations. Each female individual is paired with three candidate male individuals for pairing and breeding to construct new families and update the parents. The number of new families constructed is large, and it is reasonably estimated that there are approximately 100-300 pairs, and there is no backcrossing.

[0039] Table 1 Dual primer pair combination information

[0040]

[0041] The PCR amplification reaction chemicals described in step 3 include 3 μL of 10× PCR Buffer, 2 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl2, 1 μL each of upstream and downstream primers, 0.5 μL of 5 U / μL Taq enzyme, 2 μL of DNA template, and 10.5 μL of ultrapure water.

[0042] The PCR amplification reaction procedure described in step 3 is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 29 s, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0043] The advantages and beneficial effects of the present invention over the prior art include:

[0044] 1. The method of the present invention can effectively avoid the phenomenon of inbreeding during the artificial propagation of greater mandarin fish; it can effectively pass on the excellent traits of greater mandarin fish reserve broodstock to the next generation, thereby improving the genetic diversity of the population, thereby facilitating the selective retention of dominant groups and mating to produce offspring with excellent germplasm; it can also avoid the problem of high efficiency and low cost in the random pairing method of artificial propagation of greater mandarin fish in breeding excellent traits, and more accurately and purposefully improve the excellent traits of the offspring.

[0045] 2. The duplex PCR system of the present invention saves half the time and reagents compared to traditional PCR. The duplex PCR system simultaneously amplifies two pairs of primers during a single PCR amplification reaction, while traditional PCR reactions only amplify one pair of primers. The duplex PCR primer pairs provided by the present invention are well-matched pairs that have been screened through repeated experiments by the inventors and do not form primer dimers.

[0046] 3. Compared to the random pairing method used in traditional artificial breeding of Siniperca chuatsi, the microsatellite repeat sequences provided by the present invention are tri- or tetra-base, making them more stable for pairing and breeding than the di-base microsatellite sequences used in other existing Siniperca chuatsi breeding techniques. Furthermore, the microsatellite primers described in the present invention are tri- or tetra-base, which allows for more accurate data analysis than traditional di-base microsatellite primers. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 : Schematic diagram of the cluster development tree constructed in Example 3 of the present invention;

[0048] Figure 2-Figure 6These are all peak graphs of genotyping results read by capillary electrophoresis detection; they are used to illustrate the detection results of amplification product length and concentration, where the X-axis represents: PCR amplification product length, unit: bp, and the Y-axis represents PCR amplification product concentration, unit: "Counts" (counts) or "Counts per Second (CPS)", that is, counts per second;

[0049] Figure 2 : Genotyping result peak diagram of the first primer pair combination in the present invention;

[0050] Figure 3 : Genotyping result peak diagram of the second primer pair combination in the present invention;

[0051] Figure 4 : Genotyping result peak diagram of the third primer pair combination in the present invention;

[0052] Figure 5 : Genotyping result peak diagram of the fourth primer pair combination in the present invention;

[0053] Figure 6 : Peak diagram of genotyping results of the fifth primer pair combination in the present invention. DETAILED DESCRIPTION

[0054] Example 1 DNA extraction of Siniperca chuatsi

[0055] The PIT marker was injected into the broodstock of the greater mandarin fish raised by Wuhan Zhongke Ruihua Ecological Technology Co., Ltd., and the fin rays of each fish were clipped and sampled. The fin ray DNA of each individual greater mandarin fish to be tested was extracted using the tissue genomic DNA extraction kit (spin column type) from Beijing Biotech Biotechnology Co., Ltd. After eluting the DNA, 1-2 μL of DNA was taken with a pipette, 2-3 μL of 5× loading buffer was added, and the mixture was pipetted and mixed. The DNA was then detected by 1% agarose gel electrophoresis (voltage 120V, current 165A, time time 30min). After testing, the qualified DNA samples were stored in a refrigerator at -20℃ for future use.

[0056] Example 2 Selecting reserve broodstock of Siniperca chuatsi

[0057] The body length of the reserve broodstock group of Siniperca chuatsi raised by Wuhan Zhongke Ruihua Ecological Technology Co., Ltd. was measured, and 10 female individuals with a body length of 24 to 35 cm and 10 male individuals with a body length of 22 to 28 cm were selected as reserve broodstock experimental subjects. The specific information is shown in Table 2 below:

[0058] Table 2 Body length of reserve broodstock of Siniperca chuatsi

[0059] individual Body length (cm) Individual 1 (female) 24 Individual 2 (female) 26 Individual 3 (female) 32 Individual 4 (female) 26 Individual 5 (female) 27 Individual 6 (female) 32 Individual 7 (female) 35 Individual 8 (female) 28 Individual 9 (female) 30 Individual 10 (female) 33 Individual 11 (male) 26 Instance 12 (male) 25 Instance 13 (male) 22 Instance 14 (male) 28 Instance 15 (male) 28 Individual 16 (male) 25 Individual 17 (male) 26 Individual 18 (male) 23 Individual 19 (male) 28 Instance 20 (male) 24

[0060] Example 3 Screening and application of microsatellite loci in Siniperca chuatsi

[0061] The 20 parent individuals selected above were taken, and the DNA of each mandarin fish and adapters containing different barcodes were placed in pairs on a plate. ApeKI restriction endonuclease was used for enzymatic digestion, and T4 ligase was used to ligate the adapters to the sticky ends generated by enzyme digestion at both ends of the fragments. The samples containing different barcodes were mixed and then passed through a fragment length screening column to filter out the unreacted adapters. PCR primers were added and PCR amplification was performed. The amplified samples were subjected to high-throughput sequencing, and the original raw GBS data were processed, including parsing raw reads, filtering according to quality and adapters, demultiplexing (separating the multiplexed reads from different or the same lane according to the index to generate a fastq file corresponding to the sample), establishing a MockReference, establishing a Mock Reference through Reads clustering, performing reads mapping and standard alignment, using BWA-mem and SAMtools for alignment and assembly, parsing the output content, generating a variants matrix, genomic variation detection and identification of the genotype of each variant site of the individual, and obtaining a simplified genome of mandarin fish.

[0062] Bioinformatics tools, such as MISA software, are used to analyze the genomic sequences obtained by sequencing to identify microsatellite loci. The inventors of this application have found through research that microsatellite loci with a repeating unit of three or four nucleotides are more stable than microsatellite loci with a repeating unit of two bases, thereby focusing on identifying repeat sequences from single nucleotides to three or four nucleotides. In this embodiment, microsatellite loci with a repeating type of three or four nucleotides, a number of repetitions greater than 5 times, and a length of 70-500bp are selected as amplification targets for primer design, as shown in the following SEQ ID NO.21 to SEQ ID NO.30. For the selected microsatellite loci, primers on both sides are designed. Primer design is completed online using the Primer-BLAST tool of NCBI. After synthesizing the primers, the genomic DNA of the greater mandarin fish is amplified using the PCR method to verify the microsatellite loci. The PCR reaction conditions are optimized, and the PCR products are detected by electrophoresis using agarose gel electrophoresis or capillary electrophoresis to ensure that a stable and uniform target fragment is amplified.

[0063] Using the simplified genome of Siniperca chuatsi sequenced by the Siniperca chuatsi breeding farm of Wuhan Zhongke Ruihua Ecological Technology Co., Ltd. as the data source, microsatellite sequences were searched in the simplified genome, and 500 microsatellites were initially found. Using all the found microsatellites, primer pairs were designed targeting sequences at both ends of the following sites. The site sequences targeted by the primer pairs are shown below as SEQ ID NO. 21 to SEQ ID NO. 30;

[0064] The sequence corresponding to the primer pair GTG1F and GTG1R is SEQ ID NO.21:

[0065] ctttattgatccccgaggggaaactcttttgttacagcagctcgcctttacgtcagtgcacacaggaatagaagtactagcaaaaagtataatacactataatacaggtcagaaaataaattaagtaccaagtgggtttaccggttgatgataataa taataatacagtataaggtaatagtgcatgtactgtcaagttaagtgtagcttattaaggttataatgagacggaggatattgcacagcagtaataaaggtatgaataatatcaatatcaataaatagggaatttttatactaaaatattgcagagta

[0066] The sequence corresponding to the primer pair GTG2F and GTG2R is SEQ ID NO.22:

[0067] ctacaaattatgcaaaacaaagcattaaaaatcataagcttaatgaaacctctctgtcctgaatgaggactttcataaacataacaaacagctgctttgttgtgaaattgcgcggagaatggaatcattaaaaaattattagttcatgataattattatt attattattaataacctgccttgagtctcaatctttggtggtaacaataaattaaggtcaaatcaaatgcattttacatcccaaaccaaaccaacaaagtacaaaaacaatagtgttgaacttacatgagatgaaaaacaatatgcctgcagcaaag

[0068] The sequence corresponding to the primer pair GTG3F and GTG3R is SEQ ID NO.23:

[0069] tacttccttgagtcaaacttatttctggttagcagtatataaatcaatgcacacggtatatttaaatacaggtaactgttgcaaaaatacttcatgctgtgctagttaagtctcagtggtgaaacgaaccccagcaagtgactacaaacaaataataataataatacaatacaattatgtgatctctgtgcgctgagactccttgtctcacctgatagtaacaacctcatggctggccatgctctcagcaaatgatacactaaaaactcaaaatgcagacaacagtattaggatgccaattgcatgtaaaaatgg

[0070] The sequence SEQ ID NO.24 corresponding to the primer pair GTG4F and GTG4R:

[0071] gtctgttatatctttgtgtgtttttgggcctaaagatgaacatgtttttatcgttactttggtgcagtgtacacagcaatgagacagtgaaattcttagtcttcaggcaggctccaccttgttacagtcatgtaggatatgatataataaatgatgatgatgatgtacaatgttgtaaacaaggtcatgaacaaggttaaaggttagaatagcctaattggcaaaatatcatttgttccttctggcgactttgtctagtgggatgtactgaactttgcagcctctaggagctacttttgaagctctagagtccag

[0072] The sequence SEQ ID NO.25 corresponding to the primer pair GTG5F and GTG5R:

[0073] tagcttgccagttgaaggcagacctgtaaaaaatgacacaactgccatgagaaaagggcaaaagcatttgtttttattgcacttcgtccattagtatattgcattttggtagcacataacaattgagaaaaatgttataccataattatatattattattattattattaagtactgcaggatttcattgtttattgtcagccattcagctctgtttaccagcactgcaccccgtaggtacccagtatttacaaaaatacttacagtataatttatttgtcctttcctctacaattcccaactgtaactcccttgttc

[0074] The sequence SEQ ID NO.26 corresponding to primer pair GTG6F and GTG6R:

[0075] ttaaatttttctatgatgttgtcaatatgatacccgaatttcggtactgatagtaaaaaatatatatttatatttatatatttataccttagtttgagaaatataaaccttttttttcaaatcacttttttgttcactcaaaaaaggaatacaacaacaacaacaagaaaaaaaaacctttgctttgctttgtaaattttttttcttgtttccagttcttgtctccaagaagttgtcctgacaaatgcaagaactttgccaaaataaaattctataaatttggcaaaattatgacttagatgaagaaatatctga

[0076] The sequence SEQ ID NO.27 corresponding to primer pair GTG7F and GTG7R:

[0077] gctttagtgtcattttatgtttttttttctttcaacattaacgcctctgtcgaggcataagccacagaactaccatattattatctgttaaattggttcaacagatttacccgctaatcttccagatttttgtgggattgggagggatacttattattattattattattattatttagttttttgccaagcagagttcagggattagctgatttgtatgaatagaagttgaacagcactgcaggtttttttccccataaatgaaattgttgcgatggtctatagtgagtgcaaaataaggagcttgctacatagtttataatt

[0078] The sequences corresponding to primer pair GTG8F and GTG8R, SEQ ID NO.28:

[0079] gtgaaagggcaaaggatggcgggacgcgtctgcgtaaagcaaagtgctgttcattgggtgagttataataagctgtccgtctgaaaataaagacaagtgggacatttcaaaatcaacaaaagtccagacatgttagtgataaaattaggctaataataataataataataataataatagcatgataaattctgtgtctcgtcaggcataacaacacgaacattctcattgcctatacatagaggaaaaggggcgattgtaaaaaaatcaaggggcccactttgcacgtttgcatgacccccctctatttttaaaacagtaatttat

[0080] The sequences corresponding to primer pair GTG9F and GTG9R, SEQ ID NO.29:

[0081] atattaaagtccctgtttatgtaacgttataccgcgtcttcttgtattcttcacagcagagttggtccagactgtgaacacctagctagttagcagctacgagtcagactaaagtaaattaaaatagcctaaaaccagaggtctcccaaatagtagtagtagtagtagcaatgttaaataaacaggagtttttatttcttttctgcgctagcaaacacaacacacagcctttcagtaactattattctgcaggatgagcttatctacacactttgtggctgactaaagtaacgtaactactcctcagcggcgaccagc <00002​​​​​​The DNA of the 20 reserve broodstock individuals described in Example 2 was PCR amplified. The PCR amplification reaction chemicals included 3 μL of 10×PCR Buffer, 2 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each upstream and downstream primer, 0.5 μL of 5 U / μL Taq enzyme, 2 μL of DNA template, and 12.5 μL of ultrapure water. The procedure of the PCR amplification reaction was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 29 s, 35 cycles; extension at 72°C for 10 min; storage at 4°C. A total of 10 pairs of microsatellite primers with high polymorphism and clear bands were screened. These 10 pairs of microsatellite primers were randomly combined in pairs to form a double PCR combination, and the DNA of the above 20 individuals was PCR amplified again. The above 10 pairs of primers were PCR amplified for each individual to be tested.

[0085] The PCR amplification system consisted of 3 μL of 10× PCR Buffer, 2 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl, 1 μL each of upstream and downstream primers, 0.5 μL of 5 U / μL Taq enzyme, 2 μL of DNA template, and 10.5 μL of ultrapure water. The PCR amplification procedure was as follows: 94°C pre-denaturation for 3 min; 35 cycles of 94°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 29 s; 72°C extension for 10 min; and storage at 4°C. Primer combinations that showed unstable amplification were removed, and duplex PCR primer pairs that showed stable amplification were screened. The specific information is shown in Table 3 below.

[0086] Table 3 Grouped primer pairs and corresponding PCR annealing temperature settings

[0087]

[0088]

[0089] The above primer pair combinations were used to perform PCR amplification on the DNA of the above 20 individuals. Each primer pair combination was used to perform PCR amplification on all individuals. The kits or reagents used included: DNA extraction kit, common PCR amplification system. The detection instrument was: capillary electrophoresis instrument. The amplification test results of each group are as follows Figures 2 to 6 As shown. The X-axis represents the length of the amplified product in bp; the Y-axis represents the concentration of the amplified product in counts (i.e., counts per second, the value of the vertical axis reflects the number of signals received per unit time, usually used to represent the intensity of the fluorescent signal or the amount of detected DNA fragments); the detection of high concentrations of the following fragments indicates the closeness of the kinship of the individual to be tested; Figure 2 There are three peaks, with values ​​of 91, 109, and 175 respectively; Figure 3 There are three peaks, with values ​​of 123, 152, and 157 respectively; Figure 4 There are 4 peaks, with values ​​of 258, 267, 283, and 286 respectively; Figure 5 There are three peaks, with values ​​of 171, 188, and 191 respectively; Figure 6 There are three peaks in the data, and their values ​​are 167, 188, and 191 respectively. The above results are used to draw the individual cluster development tree using MEGA software. The specific cluster development tree is as follows: Figure 1 As shown, F1 represents the first female individual, F2 represents the second female individual, F3 represents the third female individual, and so on. M1 represents the first male individual, M2 represents the second male individual, M3 represents the third male individual, and so on.

[0090] Based on the cluster development tree and the traits of each individual (body length is used in this embodiment), a breeding pairing table is drawn. The specific breeding pairing information is shown in Table 4 below:

[0091] Table 4: Information on breeding pairing of reserve broodstock

[0092] individual Recommended pairing individuals Individual 1 (female) Individual 15, Individual 17 Individual 2 (female) Individual 15, Individual 17 Individual 3 (female) Individual 14, Individual 11 Individual 4 (female) Individual 15, Individual 17 Individual 5 (female) Individual 15, Individual 17 Individual 6 (female) Individual 14, Individual 11 Individual 7 (female) Individual 14, Individual 11 Individual 8 (female) Individual 14, Individual 11 Individual 9 (female) Individual 14, Individual 11 Individual 10 (female) Individual 15, Individual 17, Individual 12

[0093] Example 4 Comparison of Breeding Pairing of Siniperca chuatsi and Traditional Artificial Breeding Method of Siniperca chuatsi

[0094] The method of the present application is as follows: In the spring of 2022-2023, the 20 above-mentioned mandarin fish were induced to spawn, and the pairing method adopted the breeding pairing scheme of Example 3. Experimental group 1 used individual 1 and individual 15 for pairing breeding, experimental group 2 used individual 8 and individual 14 for pairing breeding, and experimental group 3 used individual 10 and individual 17 for pairing breeding;

[0095] The control group used traditional sperm and egg mixing for paired breeding (i.e., all sperm and eggs were mixed together, and then fertilized and bred). After the resulting offspring were raised for two months, the body length of the offspring of the high-bodied mandarin fish fry in each experimental group was measured and the average body length was calculated. The measurement results are shown in Table 5 below:

[0096] Table 5 Average body length measurement results of this embodiment

[0097] Experimental groups Experimental Group 1 Experimental Group 2 Experimental Group 3 control group Average body length (cm) 8.9 9.2 8.2 7.3

[0098] The experimental results prove that the present invention can effectively improve the excellent traits of offspring compared with traditional technologies.

[0099] Example 5: Updating Parents

[0100] In the second year after successful breeding, a cluster tree was constructed using the six parents and all offspring with females greater than 24 cm and males greater than 22 cm. A total of six parents and 40 offspring were included. The cluster tree construction method was as follows: DNA was extracted from the above individuals and all DNA was amplified by PCR. The PCR amplification reaction reagents included 3 μL of 10× PCR Buffer, 2 μL of 2.5 mmol / L dNTPs, 3 μL of 2 mmol / L MgCl, 1 μL each of upstream and downstream primers, 0.5 μL of 5 U / μL Taq enzyme, 2 μL of DNA template, and 10.5 μL of ultrapure water. The PCR amplification reaction procedure was: 94°C pre-denaturation for 3 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 29 s, and 72°C extension for 10 min; storage at 4°C. The duplex PCR primer combination was the same as in Example 3.

[0101] The above primer combination was used to perform PCR amplification on the DNA of the above 46 individuals (i.e., the aforementioned 6 parents and 40 offspring). The PCR products were electrophoresed on a capillary electrophoresis instrument. The electrophoresis results were used to draw a cluster tree of the individuals using MEGA software. The specific cluster tree construction method is described in Example 3. The optimal pairing combination was selected according to the method described in Example 4.

[0102] By using the breeding pairing table provided by the present invention, the phenomenon of inbreeding of the greater mandarin fish can be effectively avoided, and the excellent traits of the greater mandarin fish reserve broodstock can be inherited to the offspring.

Claims

1. A dual PCR primer pair combination for breeding of Siniperca chuatsi, characterized in that: The sequences of the dual primer pairs are specifically: SEQ ID Nos. 1 to 4 of the first group GTG1 and GTG2, SEQ ID Nos. 5 to 8 of the second group GTG3 and GTG4, SEQ ID Nos. 9 to 12 of the third group GTG5 and GTG6, SEQ ID Nos. 13 to 16 of the fourth group GTG7 and GTG8, and SEQ ID Nos. 17 to 20 of the fifth group GTG9 and GTG10.

2. Use of the dual primer pair combination according to claim 1 in the mating and breeding of higher-bodied mandarin fish.

3. Use of the dual primer pair combination according to claim 1 in the identification and differentiation of higher-bodied mandarin fish varieties.

4. A method for breeding high-bodied mandarin fish, characterized in that: The following steps are involved: 1) Marking of candidates: Select and inject PIT markers into candidates for parent fish of Siniperca chuatsi; 2) Trait measurement and broodstock selection: Measure the body length of each of the marked reserve broodstock to be selected in step 1, and select female individuals with a body length greater than 24 cm and male individuals with a body length greater than 22 cm as reserve broodstock; 3) Phylogenetic identification: extracting DNA from each reserve broodstock selected in step 2, performing PCR amplification on the DNA of each reserve broodstock using any one of the five groups of dual PCR primer pairs described in claim 1, constructing a cluster development tree based on multiple groups of amplification results, analyzing the relative genetic distances between each reserve broodstock individual, and performing phylogenetic identification; 4) Establishing breeding files: According to the closeness of the relationship of all reserve broodstock and the characteristics of each reserve broodstock, select male and female individuals with a body length range exceeding the average body length of the reserve broodstock population, or a weight range exceeding the average weight of the reserve broodstock population, and select male and female individuals that are not in the same branch or adjacent branches according to the cluster development tree to form a pairing combination. One female individual is paired with three candidate male individuals for pairing and breeding, and the offspring are nurtured to sexual maturity to complete this pairing breeding.

5. The method for breeding of mandarin fish according to claim 4, characterized in that: In the step 3), each set of primer pairs is used in combination of two, wherein GTG1 and GTG2 are used simultaneously; GTG3 and GTG4 are used simultaneously; GTG5 and GTG6 are used simultaneously; GTG7 and GTG8 are used simultaneously; and GTG9 and GTG10 are used simultaneously.

6. The method for breeding of mandarin fish according to claim 4, characterized in that: The PCR amplification system described in step 3) includes 3 μL of 10×PCR Buffer, 2 μL of 2.5 mmol / L dNTP, 3 μL of 2 mmol / L MgCl2, 1 μL of each upstream and downstream primer, 0.5 μL of 5 U / μL Taq enzyme, 2 μL of DNA template, and 10.5 μL of ultrapure water.

7. The method for breeding of mandarin fish according to claim 4, characterized in that: The procedure of the PCR amplification reaction described in step 3) is: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 29 seconds, 35 cycles; extension at 72°C for 10 minutes; and storage at 4°C.

8. The method according to any one of claims 4 to 7, characterized in that: The method also includes: 5) parental updating: selecting male and female individuals whose body length exceeds the average body length of the reserve parent fish group or whose weight exceeds the average weight of the reserve parent fish group from the reserve parent fish selected in step 4) and all offspring every year according to the breeding archives, and forming a pairing combination of the male and female individuals whose kinship is not the same branch or adjacent branches according to the cluster development tree, and selecting three candidate male individuals for each female individual for pairing and breeding, so as to construct a new family and update the parents.

Images