Primer pair for identifying bemisia tabaci single female line based on mtCOXIII gene and method for identifying bemisia tabaci single female line

Abstract

The invention discloses a primer pair for identifying a bemisia tabaci single female line based on an mtCOXIII gene and a method for identifying the bemisia tabaci single female line, and belongs to the technical field of agricultural biological detection. The sequence of the primer pair for identifying the single female line of the bemisia tabaci based on the mtCOXIII gene is as shown in SEQ ID NO. 1 and SEQ ID NO. 2. According to the invention, a primer pair for amplifying a differential base sequence is developed according to the differential base of the mitochondrial mtCOXIII gene in the mtDNA of the bemisia tabaci of C-and C + strains, and then a method for identifying the single female line of the bemisia tabaci based on PCR-RFLP is developed, so that different strains of the bemisia tabaci can be rapidly, accurately and intuitively identified, and the method has the advantages of high specificity, high specificity and high accuracy. And a foundation is laid for the identification of the heat-resistant single female line of the bemisia tabaci, the population dynamic identification of the bemisia tabaci and the research on biology and invasion mechanisms.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural biological detection, and particularly relates to a primer pair for identifying the monogynous line of Bemisia tabaci based on the mtCOXIII gene and a method for identifying the monogynous line of Bemisia tabaci. Background Art

[0002] High temperature tolerance refers to the ability of insects or animals to adapt to temperature, or the ability to maintain normal physiological activities under high temperature conditions. High temperature tolerance is also called heat resistance. As global temperatures continue to rise, climate warming has become a problem affecting the survival of some species. Most insects are cold-blooded animals, so temperature changes have a great impact on their survival. In the heat waves of global warming, many agricultural pests have shortened their life cycles. Continuous high temperatures cause some larvae to lose water balance and cannot eat normally, resulting in restricted growth and development, and eventually death.

[0003] Bemisia tabaci (Gennadius), a member of the family Aleyrodidae in the order Hemiptera, is a highly destructive agricultural insect. The pest is considered a species complex containing at least 44 cryptic species that differ in many biological characteristics. Among them, the MEAM1 and MED cryptic species have become global invasive crop pests. One of the key factors that enabled the whitefly to spread rapidly around the world and become an important pest is its strong resistance to temperature changes.

[0004] Therefore, rapid and accurate identification of different strains of whitefly, especially heat-resistant strains, is of great significance for population dynamics monitoring, biological research, and invasion mechanism research of whitefly. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to provide a primer pair for identifying the monogynous lineage of Bemisia tabaci based on the mtCOXIII gene and a method for identifying the monogynous lineage of Bemisia tabaci.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A primer pair for identifying the monogynous lineage of Bemisia tabaci based on the mtCOXIII gene, wherein the sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0008] The primer pair is used to identify the monogynous lineage of Bemisia tabaci based on the PCR-RFLP method for identifying the monogynous lineage of C- and C+ strains of Bemisia tabaci.

[0009] A method for identifying monogynous lines of Bemisia tabaci comprises extracting genomic DNA of the to-be-tested Bemisia tabaci as a template, using the above primer pair to perform PCR amplification, using a restriction endonuclease to digest the PCR amplification product, and performing agarose gel electrophoresis on the product obtained by the digestion to detect the length of the fragment and the number of bands; the restriction endonuclease is at least one of Pcil, MaeIII, AflIII and HpyCH4V.

[0010] Based on the above scheme, the method was used to identify the monogynous lines of Bemisia tabaci of the C- and C+ strains.

[0011] On the basis of the above scheme, when the restriction endonuclease used was Pcil, the agarose gel electrophoresis pattern showed a band with a fragment length of 400bp, indicating that the tested whitefly was a C+ strain; the agarose gel electrophoresis pattern showed two bands of 301bp and 103bp, indicating that the tested whitefly was a C- strain.

[0012] On the basis of the above scheme, when the restriction endonuclease used was HpyCH4V, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 297 bp and 103 bp, indicating that the tested whitefly was a C+ strain.

[0013] On the basis of the above scheme, the amplification system of the PCR amplification is: 2 μL of genomic DNA solution, 1 μL of 10 μM forward and antisense primers, 12.5 μL of Premix Taq, and DEPC water is added to 25 μL;

[0014] The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.

[0015] Based on the above scheme, the restriction endonuclease digestion conditions are: 37° C., 60 minutes.

[0016] Advantages of the technical solution of the present invention

[0017] According to the invention, a primer pair for amplifying a mitochondrial mtCOXIII gene containing the differential base sequence in the mtDNA of C- and C+ strains of whiteflies is developed, genomic DNA of the whitefly to be tested is used as a template, PCR amplification is performed by using the primer pair, a restriction endonuclease is used to digest the amplified product, and the length of the digested fragment and the number of bands are detected by agarose gel electrophoresis, thereby achieving the purpose of distinguishing the monogynous lines of C- and C+ strains of whiteflies.

[0018] The method for identifying the monogynous strain of Bemisia tabaci based on PCR-RFLP can quickly, accurately and intuitively identify different strains of Bemisia tabaci, laying a foundation for the identification of heat-resistant monogynous strains of Bemisia tabaci, the identification of population dynamics of Bemisia tabaci, and the study of biology and invasion mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the agarose gel electrophoresis diagram of the PCR product in Example 2 before digestion and after digestion by HpyCH4V and Pcil respectively (wherein, M: Marker 2000, from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp);

[0020] Figure 2 is an agarose gel electrophoresis diagram of the PCR product in Example 3 after HpyCH4V digestion (wherein wells 1 to 5 are the C- strain of Bemisia tabaci in Shouguang area of ​​Shandong Province, and wells 6 to 10 are the C+ strain of Bemisia tabaci in Shouguang area of ​​Shandong Province);

[0021] Figure 3 is an agarose gel electrophoresis diagram of the PCR product in Example 4 after HpyCH4V digestion (wherein wells 1 to 5 are the C- strain of Bemisia tabaci in Lingshui area of ​​Hainan Province, and wells 6 to 10 are the C+ strain of Bemisia tabaci in Lingshui area of ​​Hainan Province);

[0022] Figure 4 is an agarose gel electrophoresis diagram of the PCR product in Example 5 after Pcil digestion (wherein wells 1 to 5 are the C- strain of Bemisia tabaci in Shouguang area of ​​Shandong Province, and wells 6 to 10 are the C+ strain of Bemisia tabaci in Shouguang area of ​​Shandong Province);

[0023] Figure 5 It is the agarose gel electrophoresis diagram of the PCR product in Example 6 after Pcil digestion (wherein wells 1 to 5 are the C- strain of Bemisia tabaci in Lingshui area of ​​Hainan Province, and wells 6 to 10 are the C+ strain of Bemisia tabaci in Lingshui area of ​​Hainan Province). DETAILED DESCRIPTION

[0024] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention will be further described in detail below in conjunction with specific examples and with reference to data. The following examples are intended to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0025] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The experimental materials, reagents, drugs, etc. used in the following examples, unless otherwise specified, can all be purchased through general channels.

[0026] In the following examples, the HpyCH4V and Pcil endonuclease (PciI, also known as PscI or BspLU11I) were purchased from NEB Biotechnology, Premix Taq (Ex Taq) was purchased from Takara, autoclaved STE (TNE) buffer (pH 8.0) was purchased from Solarbio, Proteinase K was purchased from Ecoray Biotechnology, and other reagents and consumables were all common commercially available products.

[0027] The whitefly in the following examples is the Q-type whitefly (MED cryptic species).

[0028] Example 1

[0029] Obtaining differential loci of mtCOXIII gene in different strains (C- and C+) of Bemisia tabaci

[0030] (1) Bemisia tabaci were collected from Shouguang (SG) in Shandong Province and Lingshui (LS) in Hainan Province, and the expression of the microRNAs in the genome of the whitefly was investigated according to the results of [Li H, Wei X, Ding T, Chu D. Genome-Wide Profiling of Cardinium-Responsive MicroRNAs in the Exotic Whitefly, Bemisia tabaci (Gennadius) Biotype Q. Front Physiol. 2018 Nov 12;9:1580.doi:10.3389 / fphys.2018.01580.PMID:30483149;PMCID:PMC6241202.] were tested separately according to the method described in

[14] . The strains were divided into C- strain and C+ strain. The monogynous lines C+ and C- with the same genetic background were constructed for the whiteflies collected from Shouguang, Shandong Province (SG) and Lingshui, Hainan Province (LS). The two strains had significant differences in biological characteristics, such as high temperature resistance.

[0031] (2) Based on the above method, the mitochondrial genomes of two strains (C- and C+) of Bemisia tabaci were constructed and analyzed using the molecular software SnapGene. 5.2 The mitochondrial genome sequences of the two strains were compared, and it was found that there was only one base difference in the mtCOXIII gene sequences of the two strains, and the different base in the C- strain was the recognition site of the restriction endonuclease Pcil (enzyme cutting site 5'-^CATGT-3', "^" indicates the enzyme cutting site), and the site can also be recognized by two enzymes: MaeIII (enzyme cutting site 5'-^GTNAC-3'; "^" indicates the enzyme cutting site; N represents any nucleotide, A, T, C or G) and AflIII (enzyme cutting site 5'-^CRYGT-3'; "^" indicates the enzyme cutting site; R represents purine, A or G; Y represents pyrimidine, C or T); the different base in the C+ strain is the recognition site of the restriction endonuclease HpyCH4V (enzyme cutting site 5'-^TG^CA-3', "^" indicates the enzyme cutting site).

[0032] Example 2

[0033] The method for identifying the monogynous lineage of Bemisia tabaci based on PCR-RFLP is as follows:

[0034] (1) Extraction of whitefly genomic DNA

[0035] A single female whitefly was placed in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis solution, which was a high-pressure sterilized STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After being fully ground and homogenized with a sealed pipette tip, it was placed in a PCR instrument at 65°C for 15 minutes and 95°C for 10 minutes to obtain the whitefly genomic DNA solution.

[0036] (2) PCR amplification of a partial fragment of the mtCOXIII gene of Bemisia tabaci

[0037] The genomic DNA solutions of Bemisia tabaci from Hainan Lingshui C- strain (LSC-), Shandong Shouguang C- strain (SGC-), Hainan Lingshui C+ strain (LSC+), Shandong Shouguang C+ strain (SGC+) were used as templates for PCR amplification to obtain PCR amplification products.

[0038] Sense primer: 5'-CCAGACATAGAAACGGGATCCAT-3' (SEQ ID NO. 1);

[0039] Antisense primer: 5'-ATCAGATAGAGTATTCAAACCCGT-3' (SEQ ID NO. 2).

[0040] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL of 10 μM forward and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL;

[0041] PCR amplification conditions: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 2 minutes; 4°C, ∞.

[0042] (3) Detect the PCR amplification product obtained in step (2) by agarose gel electrophoresis (e.g. Figure 1 Lanes 1-4).

[0043] The PCR amplification products were sequenced to obtain the PCR amplification product sequences of the Hainan Lingshui C- strain and the Shandong Shouguang C- strain as shown in SEQ ID NO.3, and the PCR amplification product sequences of the Hainan Lingshui C+ strain and the Shandong Shouguang C+ strain as shown in SEQ ID NO.4.

[0044] SEQ ID NO.3(5'→3')

[0045] CCAGACATAGAAACGGGATCCATTTGACCCCCCTTCAAAGTTACTCAGATAAGGTTTATAGACATTCCTTTATTAAACACTATAGTTTTACTAATATCGGGATTTTTCATTACCTGGGCTCATTACGATTTAACTATAAACAGATTTAAAAATTCAAGAATTAGCTTAGTAATTTCTATTCTATTAGGAATTTATTTTTT AATAATTCAAGGATATGAGTATGTAAATTCAAGAATTAGATTTAATGATAGTGTATTTGGGAACTCGTTTTTTATTTTAACTGGATTCCATGGGTTACATGTAATAATTGGTCTGATCTTTTTAATTGTAATGATAGTTCAATTGATTGAAAAGAAATTTAGATTGATAAATCTAAACGGTTTTGAATACTCTATCTGAT

[0046] SEQ ID NO.4(5'→3')

[0047] CCAGACATAGAAACGGGATCCATTTGACCCCCCTTCAAAGTTACTCAGATAAGGTTTATAGACATTCCTTTATTAAACACTATAGTTTTACTAATATCGGGATTTTTCATTACCTGGGCTCATTACGATTTAACTATAAACAGATTTAAAAATTCAAGAATTAGCTTAGTAATTTCTATTCTATTAGGAATTTATTTTTT AATAATTCAAGGATATGAGTATGTAAATTCAAGAATTAGATTTAATGATAGTGTATTTGGGAACTCGTTTTTTATTTTAACTGGATTCCATGGGTTGCATGTAATAATTGGTCTGATCTTTTTAATTGTAATGATAGTTCAATTGATTGAAAAGAAATTTAGATTGATAAATCTAAACGGTTTTGAATACTCTATCTGAT

[0048] (4) digesting the PCR amplification product obtained in step (3) with restriction endonucleases HpyCH4V and PciI, respectively, to obtain digestion products;

[0049] Enzyme digestion system: rCutSmart Buffer (HpyCH4V enzyme) or r 3.1 (PciI enzyme) 2 μL, PCR amplification product 5 μL, HpyCH4V or PciI endonuclease 1 μL, DEPC water to 20 μL.

[0050] Reaction conditions: Place in PCR instrument at 37°C for 60 minutes.

[0051] (5) Separate the enzyme cleavage products obtained in step (4) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphism.

[0052] The results showed that the restriction endonuclease HpyCH4V digestion results showed that there was a band with a fragment length of 400 bp on the imaging film of Hainan Lingshui C- strain (LSC-) and Shandong Shouguang C- strain (SGC-), and the electrophoresis patterns of Hainan Lingshui C+ strain (LSC+) and Shandong Shouguang C+ strain (SGC+) showed that the tested samples had two bands of 297 bp and 103 bp (such as Figure 1The restriction endonuclease PciI digestion results showed that the Hainan Lingshui C+ strain (LSC+) and Shandong Shouguang C+ strain (SGC+) had a band with a fragment length of 400 bp on the imaging film, and the Hainan Lingshui C- strain (LSC-) and Shandong Shouguang C- strain (SGC-) electrophoretic patterns showed that the tested samples had two bands of 301 bp and 103 bp (including sticky terminal bases) (as shown in lanes 6-9). Figure 1 Lanes 11-14).

[0053] Example 3

[0054] The method for identifying the monogynous lineage of Bemisia tabaci based on PCR-RFLP is as follows:

[0055] (1) Extraction of whitefly genomic DNA

[0056] Five female whiteflies were randomly selected from the two monogynous lines C- and C+ of Shouguang, Shandong Province, established in the laboratory and placed in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis solution, the alkaline lysis solution being high-pressure sterilized STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). The mixture was fully ground and homogenized with a sealed pipette tip and placed in a PCR instrument at 65°C for 15 min; and 95°C for 10 min to obtain the whitefly genomic DNA solution.

[0057] (2) PCR amplification of a partial fragment of the mtCOXIII gene of Bemisia tabaci

[0058] The genomic DNA solutions of Bemisia tabaci from Shandong Shouguang C- strain (SGC-) and Shandong Shouguang C+ strain (SGC+) were used as templates for PCR amplification to obtain PCR amplification products.

[0059] Sense primer: 5'-CCAGACATAGAAACGGGATCCAT-3' (SEQ ID NO. 1);

[0060] Antisense primer: 5'-ATCAGATAGAGTATTCAAACCCGT-3' (SEQ ID NO. 2).

[0061] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL of 10 μM forward and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL;

[0062] PCR amplification conditions: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 2 minutes; 4°C, ∞.

[0063] (3) digesting the PCR amplification product obtained in step (2) with restriction endonuclease HpyCH4V to obtain a digestion product;

[0064] Enzyme digestion system: rCutSmart Buffer 2μL, PCR amplification product 5μL, HpyCH4V endonuclease 1μL, DEPC water to 20μL.

[0065] Reaction conditions: Place in PCR instrument at 37°C for 60 minutes.

[0066] (4) Separate the enzyme cleavage products obtained in step (3) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphism.

[0067] The results showed that the imaging film of the Shandong Shouguang C- strain had a band of 400 bp in length on the spotting wells 1 to 5; the electrophoresis pattern of the Shandong Shouguang C+ strain showed that the tested sample had two bands of 297 bp and 103 bp (such as Figure 2 ).

[0068] Example 4

[0069] The method for identifying the monogynous lineage of Bemisia tabaci based on PCR-RFLP is as follows:

[0070] The two monogyne lines C- and C+ established in the laboratory in Lingshui, Hainan were used as test samples, and their genomic DNA was extracted; the detection method was the same as that in Example 3.

[0071] The agarose gel electrophoresis results were imaged on a UV gel imager, showing that the imaging film of wells 1 to 5, which were the Hainan Lingshui C- strain, had a band with a fragment length of 400 bp; the electrophoresis map of wells 6 to 10, which were the Hainan Lingshui C+ strain, showed that the tested sample had two bands of 297 bp and 103 bp (such as Figure 3 ).

[0072] Example 5

[0073] The method for identifying the monogynous lineage of Bemisia tabaci based on PCR-RFLP is as follows:

[0074] Two monogynous lines C- and C+ from Shouguang, Shandong Province, established in the laboratory were used as test samples, and their genomic DNA was extracted; except that the restriction endonuclease used in step (3) was PciI and its corresponding 10xBuffer was r3.1, the remaining steps were the same as in Example 3.

[0075] The results of agarose gel electrophoresis were imaged on a UV gel imager. The imaging film of the C- strain of Shandong Shouguang showed that there were two bands with fragment lengths of 301 bp and 103 bp (including the sticky terminal bases) on the imaging film of the sample wells 1 to 5. The electrophoresis map of the C+ strain of Shandong Shouguang showed that the tested sample had a band with a length of 400 bp (such as Figure 4 ).

[0076] Example 6

[0077] The method for identifying the monogynous lineage of Bemisia tabaci based on PCR-RFLP is as follows:

[0078] The two monogyne lines C- and C+ established in the laboratory were used as test samples to extract their genomic DNA. The remaining steps were the same as those in Example 3, except that the restriction endonuclease used in step (3) was PciI and its corresponding 10xBuffer was r3.1.

[0079] The agarose gel electrophoresis results were imaged on a UV gel imager, showing that the imaging film of wells 1 to 5, which were the C- strain of Lingshui, Hainan, had two bands with fragment lengths of 301 bp and 103 bp (including the sticky terminal bases); the electrophoresis map of wells 6 to 10, which were the C+ strain of Lingshui, Hainan, showed that the tested sample had only one band with a length of 400 bp (such as Figure 5 ).

[0080] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A primer pair for identifying the monogynous lineage of Bemisia tabaci based on the mtCOXIII gene, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. Use of the primer pair according to claim 1 in identifying the monogynous line of Bemisia tabaci, characterized in that: The PCR-RFLP method was used to identify the monogynous lines of C- and C+ strains of Bemisia tabaci.

3. A method for identifying the monogynous lineage of Bemisia tabaci, characterized in that: Extract the genomic DNA of the whitefly to be tested as a template, use the primer pair of claim 1 to perform PCR amplification, use a restriction endonuclease to digest the PCR amplification product, and perform agarose gel electrophoresis to detect the length of the fragment and the number of bands of the product obtained by digestion; the restriction endonuclease is at least one of Pcil, MaeIII, AflIII and HpyCH4V.

4. The method for identifying the monogynous line of Bemisia tabaci according to claim 3, characterized in that: The method was used to identify monogynous lines of Bemisia tabaci of the C- and C+ strains.

5. The method of the monogynous line of Bemisia tabaci according to claim 4, characterized in that: When the restriction endonuclease used was Pcil, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C+ strain; the agarose gel electrophoresis pattern showed two bands of 301 bp and 103 bp, indicating that the tested whitefly was a C- strain.

6. The method for identifying the monogynous line of Bemisia tabaci according to claim 4, characterized in that: When the restriction endonuclease used was HpyCH4V, the agarose gel electrophoresis pattern showed a band with a fragment length of 400 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 297 bp and 103 bp, indicating that the tested whitefly was a C+ strain.

7. The method for identifying the monogynous lineage of Bemisia tabaci according to any one of claims 3 to 6, characterized in that: The amplification system of the PCR amplification is: 2 μL of genomic DNA solution, 1 μL of 10 μM forward and reverse primers, 12.5 μL of Premix Taq, and DEPC water to make up to 25 μL; The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.

8. The method for identifying the monogynous line of Bemisia tabaci according to claim 7, characterized in that: The restriction endonuclease digestion conditions are: 37° C., 60 minutes.

Images