Primer pair for identifying bemisia tabaci single female line based on mtCOXI gene and method for identifying bemisia tabaci single female line

Abstract

The invention discloses a primer pair for identifying a bemisia tabaci single female line based on an mtCOXI gene and a method for identifying the bemisia tabaci single female line, and belongs to the technical field of agricultural biological detection. The sequence of the primer pair for identifying the single female line of the bemisia tabaci based on the mtCOXI gene is as shown in SEQ ID NO.1 and SEQ ID NO.2. According to the invention, a primer pair for amplifying a differential base sequence is developed according to the differential base of the mitochondrial mtCOXI gene in the mtDNA of the bemisia tabaci of C-and C + strains, and then a method for identifying the single female line of the bemisia tabaci based on PCR-RFLP is developed, so that different strains of the bemisia tabaci can be rapidly, accurately and intuitively identified, and the method has a wide application prospect. And a foundation is laid for the identification of the heat-resistant single female line of the bemisia tabaci, the population dynamic identification of the bemisia tabaci and the research on biology and invasion mechanisms.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural biological detection, and particularly relates to a primer pair for identifying Bemisia tabaci monogyne lines based on the mtCOXI gene and a method for identifying Bemisia tabaci monogyne lines. Background Art

[0002] Heat tolerance refers to an insect or animal's ability to adapt to temperature or maintain normal physiological activities in high temperatures. Heat tolerance, also known as heat resistance, is a critical issue for the survival of some species as global temperatures continue to rise. Most insects are cold-blooded, so temperature fluctuations significantly impact their survival. During global warming heatwaves, many agricultural pests experience shortened life cycles. Sustained high temperatures disrupt the water balance of some larvae, preventing them from feeding properly. This leads to restricted growth and development, and ultimately death.

[0003] Bemisia tabaci (Gennadius), a member of the Aleyrodidae family of the order Hemiptera, is a highly destructive agricultural insect. It is considered a species complex consisting of at least 44 cryptic species, which differ in many biological characteristics. Among them, the MEAM1 and MED cryptic species have become globally invasive crop pests. One of the key factors behind the whitefly's rapid global spread and emergence as a significant pest is its strong resistance to temperature fluctuations.

[0004] Therefore, rapid and accurate identification of different strains of whitefly, especially heat-resistant strains, is of great significance for population dynamics monitoring, biological research and invasion mechanism research of whitefly. Summary of the Invention

[0005] In view of the problems existing in the prior art, the present invention aims to provide a primer pair for identifying Bemisia tabaci monogyne based on the mtCOXI gene and a method for identifying Bemisia tabaci monogyne.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A primer pair for identifying monogynous lines of Bemisia tabaci based on the mtCOXI gene, wherein the sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0008] The primer pair is used to identify the monogynous lines of Bemisia tabaci based on the PCR-RFLP method for identifying the monogynous lines of C- and C+ strains of Bemisia tabaci.

[0009] A method for identifying monogynous lines of Bemisia tabaci comprises extracting genomic DNA of the to-be-tested Bemisia tabaci as a template, performing PCR amplification using the above-mentioned primer pair, enzymatically digesting the PCR amplification product using a restriction endonuclease, and performing agarose gel electrophoresis on the product obtained by the enzymatic digestion to detect the length of the fragment and the number of bands; the restriction endonuclease is Earl.

[0010] Based on the above protocol, the method was used to identify the monogynous lines of Bemisia tabaci of the C- and C+ strains.

[0011] Based on the above scheme, the agarose gel electrophoresis pattern showed a band with a fragment length of 474 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 411 bp and 66 bp, indicating that the tested whitefly was a C+ strain.

[0012] On the basis of the above scheme, the amplification system of the PCR amplification is: 2 μL of genomic DNA solution, 1 μL each of 10 μM forward and antisense primers, 12.5 μL of Premix Taq, and DEPC water is added to 25 μL.

[0013] Based on the above scheme, the reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.

[0014] Based on the above scheme, the restriction endonuclease digestion conditions are: 37° C., 60 minutes.

[0015] Advantages of the technical solution of the present invention

[0016] The invention develops a primer pair for amplifying the differential base sequence of the mitochondrial mtCOXI gene in the mtDNA of the C- and C+ strains of Bemisia tabaci based on the differential base sequence. The genomic DNA of the test whitefly is used as a template, PCR amplification is performed using the primer pair, the amplified product is digested with a restriction endonuclease, and the length of the digested fragment and the number of bands are detected by agarose gel electrophoresis. The purpose of distinguishing the monogyne lines of the C- and C+ strains of Bemisia tabaci is thereby achieved.

[0017] The PCR-RFLP-based method for identifying monogynous strains of Bemisia tabaci can quickly, accurately and intuitively identify different strains of Bemisia tabaci, laying a foundation for the identification of heat-resistant monogynous strains of Bemisia tabaci, the identification of population dynamics of Bemisia tabaci, and the study of biology and invasion mechanisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1is an agarose gel electrophoresis diagram of the PCR product in Example 3 before and after digestion with Ear1 (wherein, M: Marker 2000, from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 100 bp);

[0019] Figure 2 1 is an agarose gel electrophoresis diagram of the PCR product in Example 4 after Ear1 digestion (wherein wells 1 to 5 are for Bemisia tabaci C- strain in Shouguang area of ​​Shandong Province, and wells 6 to 10 are for Bemisia tabaci C+ strain in Shouguang area of ​​Shandong Province);

[0020] Figure 3 This is an agarose gel electrophoresis diagram of the PCR product in Example 5 after Ear1 digestion (wells 1 to 5 are for the C- strain of Bemisia tabaci from Lingshui, Hainan Province, and wells 6 to 10 are for the C+ strain of Bemisia tabaci from Lingshui, Hainan Province). DETAILED DESCRIPTION

[0021] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. Below, in conjunction with specific examples, the present invention will be further described in detail with reference to data. The following examples are merely for illustration of the present invention and are not intended to limit the scope of the present invention in any way.

[0022] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. The experimental materials, reagents, and drugs used in the following examples, unless otherwise specified, can all be purchased through general channels.

[0023] In the following examples, the Earl endonuclease (also known as Eam1104l or Bst6l or Ksp632I) was purchased from Yugong Biotechnology Co., Ltd., Premix Taq (Ex Taq) was purchased from Takara Co., Ltd., autoclaved STE (TNE) buffer (pH 8.0) was purchased from Solarbio, Proteinase K was purchased from Aikerui Biological Co., Ltd., and other reagents and consumables were all common commercial products.

[0024] The whitefly in the following examples is the Q-type whitefly (MED cryptic species).

[0025] Example 1

[0026] Obtaining differential loci in the mtCOXI gene of different strains (C- and C+) of Bemisia tabaci

[0027] (1) Bemisia tabaci were collected from Shouguang, Shandong (SG) and Lingshui, Hainan (LS) respectively. The results were as follows [Li H, Wei X, Ding T, Chu D. Genome-Wide Profiling of Cardinium-Responsive MicroRNAs in the Exotic Whitefly, Bemisia tabaci (Gennadius) Biotype Q. Front Physiol. 2018 Nov 12;9:1580.doi:10.3389 / fphys.2018.01580.PMID:30483149;PMCID:PMC6241202.] The above-mentioned whiteflies were tested separately according to the method described in [1]. They were divided into whitefly C- strain and C+ strain. According to the method described in [12;9:1580.doi:10.3389 / fphys.2018.01580.PMID:30483149;PMCID:PMC6241202.], and the monogyne lines C+ and C- with the same genetic background were constructed for whiteflies collected from Shouguang, Shandong Province (SG) and Lingshui, Hainan Province (LS), respectively. These two lines had significant differences in biological characteristics, such as high temperature resistance.

[0028] (2) Based on the mitochondrial genomes of two strains (C- and C+) of Bemisia tabaci established by the above method, the mitochondrial genome sequences of the two strains were compared using the molecular software SnapGene 5.2. It was found that there was only one base difference in the mtCOXI gene sequence of the two strains, and the differential base in the C+ strain was the recognition site of the restriction endonuclease Earl (enzyme cutting sites 5'-CTCTTCN^-3'; 3'-GAGAAGNNNN^-5').

[0029] Example 2

[0030] The primer pair for identifying the monogynous lineage of Bemisia tabaci based on the mtCOXI gene is as follows:

[0031] Sense primer: 5′-ATGAAAGTTTGAGCTTTTTCGACT-3′ (SEQ ID NO. 1);

[0032] Antisense primer: 5'-ACCTAGAATTGATGAAACACCTGC-3' (SEQ ID NO. 2).

[0033] Example 3

[0034] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0035] (1) Extraction of whitefly genomic DNA

[0036] A single female whitefly was placed in a 0.2 mL centrifuge tube containing 30 μL of alkaline lysis solution, which was autoclaved STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After being thoroughly ground and homogenized with a sealed pipette tip, the tube was placed in a PCR instrument at 65°C for 15 minutes and 95°C for 10 minutes to obtain the whitefly genomic DNA solution.

[0037] (2) PCR amplification of a partial fragment of the mtCOXI gene of Bemisia tabaci

[0038] PCR amplification products were obtained by using genomic DNA solutions of Bemisia tabaci from Hainan Lingshui C- strain (LSC-), Shandong Shouguang C- strain (SGC-), Hainan Lingshui C+ strain (LSC+), and Shandong Shouguang C+ strain (SGC+) as templates.

[0039] Sense primer: 5′-ATGAAAGTTTGAGCTTTTTCGACT-3′ (SEQ ID NO. 1);

[0040] Antisense primer: 5'-ACCTAGAATTGATGAAACACCTGC-3' (SEQ ID NO. 2).

[0041] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL each of 10 μM forward and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL.

[0042] PCR amplification conditions: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 2 minutes; 4°C, ∞.

[0043] (3) Detect the PCR amplification product obtained in step (2) by agarose gel electrophoresis (e.g. Figure 1 shown in lanes 1-4).

[0044] The PCR amplification products were sequenced to obtain the PCR amplification product sequences of the Hainan Lingshui C- strain and the Shandong Shouguang C- strain as shown in SEQ ID NO.3, and the PCR amplification product sequences of the Hainan Lingshui C+ strain and the Shandong Shouguang C+ strain as shown in SEQ ID NO.4.

[0045] SEQ ID NO.3(5'→3')

[0046] ATGAAAGTTTGAGCTTTTTCGACTAACCATAAAGATATTGGTGTTTTATATTTTATTTTTGGTGTTTGGAGAGGATTAATTGGAACTTCTTTTAGTATAATTATTCGCTCTGAGCTTATAAATGTTGGGTCTTTTATATCAAATGAGCATTTATATAATGTTGTTGTAACTTCTCATGCTTTTATTATGATTTTTTTTATAACAATGCCACTAGTTATTGGTGGTTTTGGTAATTGGCTTATCCCTCTGATAATTGGTGCTCCTGACATAGCTTTTCCTCGTATGAACAACTTGAGGTTTTGACTTTTAGTTCCTTCATTAATTTTTATGTTGGTAAGAATGATTGTTAGGACAGGAGCTGGTACTGGCTGGACTGTTTATCCTCCCCTGTCTTTAAGATTAACTCATAGAGGCTTATCAGTTGATTTATTAATTTTTTCTTTGCACATTGCAGGTGTTTCATCAATTCTAGGT

[0047] SEQ ID NO.4(5’→3’)

[0048] ATGAAAGTTTGAGCTTTTTCGACTAACCATAAAAGATATTGGTGTTTTATATTTTATTTTTGGTGTTTGAAGAGGATTAATTGGAACTTCTTTAGTATAATTCGCTCTGAGCTTATAAATGTTGGGTCTTTTATATCAAATGAGCATTTATATAATGTTGTTGTAACTTCTCATGCTTTTATTATGATTTTTTTTATAACAATGCCACTAGTTATTGGTGGTTTTGGTAATTGG CTTATCCCTCTGATAATTGGTGCTCCTGACATAGCTTTTCCTCGTATGAACAACTTGAGGTTTTGACTTTTAGTTCCTTCATTAATTTTTATGTTGGTAAGAATGATTGTTAGGACAGGAGCTGGTACTGGCTGGACTGTTTATCCTCCCCTGTCTTTAAGATTAACTCATAGAGGCTTATCAGTTGATTTATTAATTTTTTCTTTGCACATTGCAGGTGTTTCATCAATTCTAGGT

[0049] (4) digesting the PCR amplification product obtained in step (3) with the restriction endonuclease Ear1 to obtain a digestion product;

[0050] Enzyme digestion system: 10×CutOne Buffer 2μL, PCR amplification product 5μL, Earl endonuclease 1μL, DEPC water to 20μL.

[0051] Reaction conditions: Place in PCR instrument at 37°C for 60 minutes.

[0052] (5) Separate the enzyme-digested products obtained in step (4) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphism.

[0053] The results showed that the enzyme digestion results of the restriction endonuclease Earl showed a band with a fragment length of 474 bp on the imaging film of the Hainan Lingshui C- strain (LSC-) and Shandong Shouguang C- strain (SGC-), and the electrophoresis patterns of the Hainan Lingshui C+ strain (LSC+) and Shandong Shouguang C+ strain (SGC+) showed that the tested samples had two bands of 411 bp and 66 bp (including sticky terminal bases) (such as Figure 1 shown in lanes 6-9).

[0054] Example 4

[0055] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0056] (1) Extraction of whitefly genomic DNA

[0057] Five female whiteflies were randomly selected from two monogynous lines (C- and C+) in Shouguang, Shandong Province, established in the laboratory. They were placed in 0.2 mL centrifuge tubes containing 30 μL of alkaline lysis solution, which consisted of autoclaved STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). The slurry was thoroughly ground with a sealed pipette tip and placed in a PCR instrument at 65°C for 15 min and 95°C for 10 min to obtain the whitefly genomic DNA solution.

[0058] (2) PCR amplification of a partial fragment of the mtCOXI gene of Bemisia tabaci

[0059] PCR amplification was performed using the genomic DNA solutions of Bemisia tabaci from Shandong Shouguang C- strain (SGC-) and Shandong Shouguang C+ strain (SGC+) as templates to obtain PCR amplification products.

[0060] Sense primer: 5′-ATGAAAGTTTGAGCTTTTTCGACT-3′ (SEQ ID NO. 1);

[0061] Antisense primer: 5'-ACCTAGAATTGATGAAACACCTGC-3' (SEQ ID NO. 2).

[0062] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL each of 10 μM forward and antisense primers, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL.

[0063] PCR amplification conditions: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 2 minutes; 4°C, ∞.

[0064] (3) digesting the PCR amplification product obtained in step (2) with restriction endonuclease Ear1 to obtain a digestion product;

[0065] Enzyme digestion system: 10×CutOne Buffer 2μL, PCR amplification product 5μL, Earl endonuclease 1μL, DEPC water to 20μL.

[0066] Reaction conditions: Place in PCR instrument at 37°C for 60 minutes.

[0067] (4) Separate the enzyme-digested products obtained in step (3) by agarose gel electrophoresis, image them on a UV gel imager, and observe their polymorphism.

[0068] The results showed that the imaging film of the Shandong Shouguang C- strain had a band of 474 bp in length on the spotting wells 1 to 5; the electrophoresis pattern of the Shandong Shouguang C+ strain showed that the tested sample had two bands of 411 bp and 66 bp (including the sticky terminal bases) (such as Figure 2 ).

[0069] Example 5

[0070] The method for identifying monogynous lines of Bemisia tabaci based on PCR-RFLP is as follows:

[0071] The two monogyne lines C- and C+ from Lingshui, Hainan Province, established in the laboratory were used as test samples, and their genomic DNA was extracted; the detection method was the same as that in Example 4.

[0072] The results of agarose gel electrophoresis were imaged on a UV gel imager. The imaging film of wells 1 to 5, which were the C- strain of Lingshui, Hainan, had a band of 474 bp in length. The electrophoresis pattern of wells 6 to 10, which were the C+ strain of Lingshui, Hainan, showed that the tested sample had two bands of 411 bp and 66 bp (including the sticky terminal bases) (e.g. Figure 3 )

[0073] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above-disclosed technical content to modify or modify the present invention into equivalent embodiments. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the present invention.

Claims

1. A primer pair for identifying the monogynous lineage of Bemisia tabaci based on the mtCOXI gene, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. Use of the primer pair according to claim 1 in identifying the monogynous line of Bemisia tabaci, characterized in that: The PCR-RFLP method was used to identify the monogynous lines of C- and C+ strains of Bemisia tabaci.

3. A method for identifying the monogynous lineage of Bemisia tabaci, characterized in that: Extract the genomic DNA of the whitefly to be tested as a template, use the primer pair of claim 1 to perform PCR amplification, use restriction endonuclease to digest the PCR amplification product, and perform agarose gel electrophoresis to detect the length of the fragment and the number of bands of the product obtained by digestion; the restriction endonuclease is Earl.

4. The method for identifying the monogynous line of Bemisia tabaci according to claim 3, characterized in that: The method was used to identify monogynous lines of Bemisia tabaci of the C- and C+ strains.

5. The method for identifying the monogynous line of Bemisia tabaci according to claim 4, characterized in that: The agarose gel electrophoresis pattern showed a band with a fragment length of 474 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 411 bp and 66 bp, indicating that the tested whitefly was a C+ strain.

6. The method for identifying the monogynous lineage of Bemisia tabaci according to any one of claims 3 to 5, characterized in that: The amplification system of the PCR amplification is: 2 μL of genomic DNA solution, 1 μL of 10 μM forward and antisense primers, 12.5 μL of Premix Taq, and DEPC water to make up to 25 μL.

7. The method for identifying the monogynous lineage of Bemisia tabaci according to claim 6, characterized in that: The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.

8. The method for identifying the monogynous line of Bemisia tabaci according to claim 8, characterized in that: The restriction endonuclease digestion conditions are: 37° C., 60 minutes.

Images