Molecular marker related to laying number in later laying period of chickens and application of molecular marker

Abstract

The invention provides a molecular marker related to the laying number in the later laying period of chickens and application of the molecular marker, and belongs to the technical field of gene detection. The molecular marker is an SNP molecular marker, and corresponds to the 80454682nd site from the 5'terminal on a chromosome 1 of chicken reference genome Galusgallus 7.0 W version sequence information, and the basic group at the site is A / G. The application of the molecular marker comprises the following steps: (1) extracting genome DNA of a chicken to be detected; (2) detecting the genotype of the SNP site at the 80454682th site from the 5'terminal on the No.1 chromosome of the chicken to be detected; and (3) according to the genotype detection result in the step (2), judging the laying number level of the to-be-detected chicken in the later laying period. According to the method, effective selection is carried out in the early stage of the chickens, the breeding process of the chickens with high egg yield in the middle and later periods is accelerated, the breeding efficiency is improved, and the method has remarkable application value and potential economic benefits.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a molecular marker related to the number of eggs laid by chickens in the late egg-laying period and an application thereof. Background Art

[0002] The number of eggs laid by chickens is one of the important economic traits to measure their production performance, which directly affects the economic benefits and market supply of the laying hen industry. Especially with the extension of the laying hen breeding cycle, the egg-laying performance in the middle and late stages of egg-laying has attracted much attention from producers and breeders. Studies have shown that there may be certain differences in the regulatory basis of egg-laying performance at different stages, and the selection of egg-laying numbers in the early or peak stages of egg-laying does not necessarily mean that high egg-laying numbers can be obtained in the middle and late stages of egg-laying. The number of eggs laid is jointly regulated by genetic and environmental factors. The egg-laying performance in the middle and late stages of egg-laying varies significantly in the population, and has great potential for genetic improvement.

[0003] Traditional breeding methods require individual testing of the entire flock, and their shortcomings include: it consumes a lot of manpower and time to carry out testing, which is costly; trait testing can only be completed in the middle and late stages of egg-laying, and early selection is not possible; testing can only be performed on hens, and rooster selection needs to be based on the test results of siblings or offspring, which reduces the accuracy of selection. In contrast, using genetic variations such as SNP molecular markers for trait selection can achieve early and accurate trait selection, thereby accelerating the selection process of target traits at the genetic level.

[0004] Therefore, the discovery and verification of molecular markers related to egg production in chickens and the establishment of molecular breeding technology are of vital importance to improving the breeding efficiency of this trait. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to the number of eggs laid in the late laying period of chickens and its application, aiming to solve the technical problems of high cost and low accuracy of traditional breeding methods for the number of eggs laid by chickens in the prior art.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a molecular marker related to the number of eggs laid in a chicken in the late egg-laying period. The molecular marker is a SNP molecular marker corresponding to the 80454682nd position from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, where the base is A / G.

[0008] The present invention also provides an application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens as described in the above technical solution, wherein the application method comprises the following steps:

[0009] (1) Extracting genomic DNA from the chicken to be tested;

[0010] (2) detecting the genotype of the SNP site at position 80454682 from the 5' end on chromosome 1 of the tested chicken;

[0011] (3) According to the genotype detection result in step (2), the egg production level of the tested chicken in the late egg-laying period is determined.

[0012] Furthermore, the detection in step (2) is specifically performed by sequencing the amplification products of the in vitro nucleic acid amplification primer pair of the genotype.

[0013] Furthermore, the upstream primer of the in vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 2, and the downstream primer of the in vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 3.

[0014] Furthermore, the genotype in step (3) is GG, AG or AA.

[0015] The present invention also provides the application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens as described in the above technical solution, wherein the application is to detect the genotype of the SNP site in identifying or assisting in identifying the number of eggs laid in the late egg-laying period of chickens.

[0016] The present invention also provides the application of the molecular marker related to the number of eggs laid by chickens in the late egg-laying period as described in the above technical scheme, which is the application in preparing products for identifying or assisting in identifying the number of eggs laid by chickens in the late egg-laying period by detecting the genotype of the SNP site.

[0017] The present invention also provides the application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens as described in the above technical solution, wherein the application is the application in chicken breeding or the preparation of chicken breeding products by detecting the genotype of the SNP site.

[0018] The present invention also provides a product, which is a substance containing the SNP molecular marker described in claim 1, specifically a product for detecting the genotype of the SNP site related to the number of eggs laid in the late egg-laying period of a chicken, a product for identifying or assisting in identifying the number of eggs laid in the late egg-laying period of a chicken, and a product for chicken breeding.

[0019] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0020] There is a significant correlation between the single nucleotide polymorphism (SNP) molecular markers covered by the present invention and the number of eggs laid in the middle and late stages of egg production in chickens, which represents an innovative molecular marker technology. By accurately detecting the genotype of the individual chicken to be tested at this specific site, chickens carrying the dominant genotype can be identified; using this technology, effective selection can be carried out in the early stages of chickens, thereby accelerating the breeding process of chickens with high egg production in the middle and late stages. This early selection method not only improves the efficiency of breeding, but also has significant application value and potential economic benefits because it can quickly screen out individuals with excellent traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the results of the whole genome association analysis in Example 1 of the present invention. DETAILED DESCRIPTION

[0022] The invention provides a molecular marker related to the number of eggs laid in a chicken in the late egg-laying period. The molecular marker is a SNP molecular marker corresponding to the 80454682nd position from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, where the base is A / G.

[0023] The present invention also provides an application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens as described in the above technical solution, wherein the application method comprises the following steps:

[0024] (1) Extracting genomic DNA from the chicken to be tested;

[0025] (2) detecting the genotype of the SNP site at position 80454682 from the 5' end on chromosome 1 of the tested chicken;

[0026] (3) According to the genotype detection result in step (2), the egg production level of the tested chicken in the late egg-laying period is determined.

[0027] In the present invention, the detection in step (2) is specifically carried out by sequencing the amplification product of the in vitro nucleic acid amplification primer pair of the genotype.

[0028] In the present invention, the upstream primer of the in vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 2, and the downstream primer of the in vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 3.

[0029] The SEQ ID NO: 2 of the present invention is specifically CTTCTATGCCATGCCATGCTAT; the SEQ ID NO: 3 is specifically GACAAACATCCCATCCCACAG.

[0030] The in vitro nucleic acid amplification primer pair of the present invention is designed and synthesized based on the upstream and downstream DNA sequence information of the chr1:80454682 site published in the Ensemble database, namely SEQ ID NO:1, to perform PCR amplification. The SEQ ID NO:1 is:

[0031] GCTCTTTGCATCCAGGTAGCGTTGCTGTGGCAGGGACAGGACTTGTGCTGGGGCATGACTTGGCAGTATGGGAGGCTGTTCCCAGGTTTCCTCAATACCCACCCTTTGCTGAGCAGAGAGGGGAGG TTTCTAAGAAAGGGCATTGATCTGGGAAGGGCATTGATCTGGGGATTCTATGTTCTTCTATGCCATGCCATGCTATACTACGCAATGCTGTAGGAAGAAGGTTCCCACCCACTTACTCAGACAAG / ATGATGTAGGATTGGCTTACCCTGTGGGATGGGATGTTTGTCTGCTGATGTATTCAAGTCTCTCCTTCCCCCCTCCACCCCGCCTCCCCTTTTATTTTTCTAGAGGAGTTAGAAATTGGCTTGATTCACAATGTCTTTTATTATCTTTAGATCATTAGAAGAAGGGCCTGGACCCTTAGGGAAAATGATCTCAACGATATCATCATGATTTAGGTAAATGCGCAGCCCAGGAGGCAGGATGGGCCAAAGC.

[0032] In the present invention, the genotype in step (3) is GG, AG or AA.

[0033] The relationship between the genotype of the present invention and the number of eggs laid in the late egg-laying period of the chicken is that the genotype GG corresponds to a large number of eggs; the genotype AG corresponds to a medium number of eggs; and the genotype AA corresponds to a small number of eggs.

[0034] The present invention also provides the application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens as described in the above technical solution, wherein the application is to detect the genotype of the SNP site in identifying or assisting in identifying the number of eggs laid in the late egg-laying period of chickens.

[0035] The present invention also provides the application of the molecular marker related to the number of eggs laid by chickens in the late egg-laying period as described in the above technical scheme, which is the application in preparing products for identifying or assisting in identifying the number of eggs laid by chickens in the late egg-laying period by detecting the genotype of the SNP site.

[0036] The present invention also provides the application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens as described in the above technical solution, wherein the application is the application in chicken breeding or the preparation of chicken breeding products by detecting the genotype of the SNP site.

[0037] The present invention also provides a product, which is a substance containing the SNP molecular marker described in claim 1, specifically a product for detecting the genotype of the SNP site related to the number of eggs laid in the late egg-laying period of a chicken, a product for identifying or assisting in identifying the number of eggs laid in the late egg-laying period of a chicken, and a product for chicken breeding.

[0038] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example 1

[0040] Determination of SNP molecular markers associated with egg number in the middle and late stages of egg laying in chickens

[0041] (1) Experimental animals: 160 white Leghorn chickens were used as experimental subjects. They were allowed free access to food and water during the feeding period. The feeding conditions strictly followed the relevant provisions of the industry standard (NY / T 33-2004).

[0042] (2) Phenotypic determination: Count the number of eggs laid by individual chickens between 400 and 500 days of age.

[0043] (3) Extraction of genomic DNA: 0.5 mL of subwing venous blood was collected from all test chickens using an anticoagulant vacuum blood collection tube. Whole-genomic DNA was extracted using the phenol-chloroform extraction method. Agarose gel electrophoresis was performed on qualified DNA samples to further evaluate the purity and integrity of the DNA samples. The sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was between 1.8 and 2.0, and the integrity was good. Qualified DNA samples were stored at -20 degrees for future use.

[0044] (4) Genome resequencing: DNA samples of all experimental chickens were sent to BGI, and individual whole genome resequencing was performed using the DNBSEQ sequencing platform according to standard operating procedures, with a sequencing depth of approximately 15×. BWA and GATK software were used for sequence alignment and genotype extraction. After SNP call rate and MAF quality control, 7,498,204 SNPs were obtained and used for subsequent analysis.

[0045] (5) Genome-wide association analysis: Pedigree data, phenotypic data, and genomic SNP site data were collated, and GCTA software was used to perform genome-wide association analysis. The univariate mixed linear model was:

[0046] y=Xb+jα+u+e;

[0047] Among them, y represents the phenotypic value; b represents the fixed effect (including group effect and cage effect); X represents the corresponding relationship matrix; J represents the additive genotype of the SNP site to be detected; α represents the additive SNP effect; u represents the random animal effect, which obeys Where G represents the additive relationship matrix of the genome, represents additive genetic variance; e represents compliance The residual effect of , where I represents the identity matrix, The R package qvalue was used to calculate the genome-wide FDR value, with FDR < 0.01 as the significance threshold (P = 3.78E-07).

[0048] GWAS analysis results Figure 1 As shown, based on Figure 1 It can be seen that the number of eggs laid in the middle and late stages of egg laying in chickens is significantly associated with the 0.14Mb region on chromosome 1 (chr1:80402120-80541002). All sites in the genome-related region were further verified, and the chr1:80454682 site was determined as a candidate site. The genetic marker data affecting the number of eggs laid in the late stages of egg laying in chickens are shown in Table 1:

[0049] Table 1 Genetic marker data affecting the number of eggs laid in the late egg-laying period of chickens

[0050]

[0051]

[0052] Example 2

[0053] Correlation between different genotypes of chr1:80454682 and egg production in late laying period of chickens

[0054] (1) Experimental animals: 160 white Leghorn chickens, fed in the same manner as in Example 1.

[0055] (2) Phenotypic determination: Same as Example 1.

[0056] (3) Extraction of genomic DNA: Same as Example 1.

[0057] (4) Genotyping of specific gene loci: Same as Example 1.

[0058] (5) Identification of phenotypic dominant genotypes: At the chr1:80454682 locus, the average number of eggs laid by individuals with the GG genotype was 77.63, the average number of eggs laid by individuals with the AG genotype was 75.82, and the average number of eggs laid by individuals with the AA genotype was 35.15. The phenotypes of the GG and GA genotypes were significantly higher than that of the AA genotype. However, the AG genotype would separate into individuals with the GG genotype in the hybrid offspring and could not be stably inherited. Based on this, it can be seen that the GG genotype is the dominant genotype for this trait.

[0059] Table 2 is a data table showing the correlation between individuals with different genotypes at the chr1:80454682 SNP locus and the number of eggs laid by chickens at 400-500 days of age.

[0060] Table 2 Correlation data between different genotypes of chicken chr1:80454682 SNP locus and the number of eggs produced by chickens at 400-500 days of age

[0061]

[0062] ab: Different letters in the shoulders indicate significant phenotypic differences among the groups.

[0063] Example 3

[0064] Establishment of molecular marker detection method for chr1:80454682 locus and its application in breeding

[0065] Establishment of molecular marker detection method: Based on the upstream and downstream DNA sequence information of chr1:80454682 site published in the Ensemble database, namely SEQ ID NO:1, a primer pair was designed and synthesized for PCR amplification. SEQ ID NO:1 is specifically:

[0066] GCTCTTTGCATCCAGGTAGCGTTGCTGTGGCAGGGACAGGACTTGTGCTGGGGCATGACTTGGCAGTATGGGAGGCTGTTCCCAGGTTCCTCAATACCCACCCTTTGCTGAGCAGAGAGGGGAGGTTTCTAAGAAAGGGCA TTGATCTGGGAAGGGCATTGATCTGGGGATTCTATGTTCTTCTATGCCATGCCATGCTATACTACGCAATGCTGTAGGAAGAAGGTTCCCACCCACTTACTCAGACAAG / ATGATGTAGGATTGGCTTACCCTGTGGGATGG GATGTTTGTCTGCTGATGTATTCAAGTCTCTCCTTCCCCCCTGCACCCCGCCTCCCCTTTTATTTTTCTAGAGGAGTTAGAAATTGGCTGATTCACAATGTCTTTTATTATCTTTAGATCATTAGAAGAAGGGCCTGGACCCTTAGGGAAAATGATCTCAACGATATCATCATGATTTAGGTAAATGCGCAGCCCAGGAGGCAGGATGGGCCAAAGC

[0067] The primer sequence information is detailed in Table 3, the polymerase chain reaction (PCR) amplification system is detailed in Table 4, and the PCR amplification conditions are detailed in Table 5. The amplified products were analyzed by first-generation sequencing technology to determine the genotype of the 80454682 site located on chromosome 1 (chr1). The genotype results include GG, AG, and AA.

[0068] Table 3 Primer sequence information

[0069] Primer name sequence Corresponding number of sequence list Upstream primer CTTCTATGCCATGCCATGCTA SEQ ID NO:2 Downstream primer GACAAACATCCCATCCCACA SEQ ID NO:3

[0070] Table 4 Polymerase chain reaction (PCR) amplification system

[0071]

[0072]

[0073] Table 5 PCR amplification conditions

[0074]

[0075] (2) Breeding strategy based on chr1:80454682 molecular marker to increase egg production in late laying period

[0076] The present invention selected 190 pure-line individuals of Beijing oily chicken as breeding objects, aiming to increase the number of eggs laid in the late egg-laying period. At 3 weeks of age, blood samples were collected from all individuals, and genomic DNA was extracted according to step (3) of Example 1. The target site sequence was amplified using specific primers SEQ ID NO: 2 and SEQ ID NO: 3, and genotyping was performed using first-generation sequencing technology.

[0077] Among the genotypes obtained, there were 94 individuals with GG genotype, 83 individuals with AG genotype, and 13 individuals with AA genotype. Based on the dominant genotype of egg production in the late egg-laying period, the present invention selected individuals with GG genotype for subsequent breeding. After being raised to the egg-laying period, the number of eggs produced at 400-500 days of age was counted at 500 days of age. The correlation results between individuals with different genotypes at the chr1:80454682 SNP site and the number of eggs produced are shown in Table 6.

[0078] Based on Table 6, it can be seen that the average number of eggs laid by individuals with the GG genotype is 52.74, the average number of eggs laid by individuals with the AG genotype is 55.81, and the average number of eggs laid by individuals with the AA genotype is 38.85.

[0079] Table 6 Correlation results between different genotypes of chicken chr1:80454682 SNP locus and egg production

[0080]

[0081] ab: Different letters in the shoulders indicate significant phenotypic differences among the groups.

[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the specific implementation methods of the present invention can still be modified or replaced by equivalents. Any modification or equivalent replacement that does not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A molecular marker associated with the number of eggs laid in the late egg-laying period of chickens, characterized in that: The molecular marker is a SNP molecular marker, corresponding to the 80454682nd position from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, where the base is A / G.

2. An application of the molecular marker related to the number of eggs laid in the late egg-laying period of chickens according to claim 1, characterized in that: The method steps of the application are: (1) Extracting genomic DNA from the chicken to be tested; (2) detecting the genotype of the SNP site at position 80454682 from the 5' end on chromosome 1 of the tested chicken; (3) According to the genotype detection result in step (2), the egg production level of the tested chicken in the late egg-laying period is determined.

3. The use of a molecular marker related to the number of eggs laid in the late egg-laying period of a chicken according to claim 2, characterized in that: The detection in step (2) is specifically performed by sequencing the amplification product of the in vitro nucleic acid amplification primer pair of the genotype.

4. The use of a molecular marker related to the number of eggs laid in the late egg-laying period of a chicken according to claim 3, characterized in that: The upstream primer of the in vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 2, and the downstream primer of the in vitro nucleic acid amplification primer pair is shown as SEQ ID NO:

3.

5. The use of molecular markers related to egg production in late egg-laying period of chickens according to claim 2, characterized in that: The genotype in step (3) is GG, AG or AA.

6. An application of the molecular marker related to the number of eggs laid in the late egg-laying period of a chicken according to claim 1, characterized in that: The application is to detect the genotype of the SNP site in identifying or assisting in identifying the number of eggs laid by chickens in the late egg-laying period.

7. An application of the molecular marker related to the number of eggs laid in chickens in the late egg-laying period according to claim 1, characterized in that: The application is the use of detecting the genotype of the SNP site in the preparation of a product for identifying or assisting in identifying the number of eggs laid by chickens in the late egg-laying period.

8. An application of the molecular marker related to the number of eggs laid in chickens in the late egg-laying period according to claim 1, characterized in that: The application is to detect the genotype of the SNP site in chicken breeding or to prepare chicken breeding products.

9. A product, characterized in that The product is a substance containing the SNP molecular marker described in claim 1, specifically a product for detecting the genotype of the SNP site related to the number of eggs laid in the late egg-laying period of a chicken, a product for identifying or assisting in identifying the number of eggs laid in the late egg-laying period of a chicken, and a product for chicken breeding.

Images