Molecular marker primer for detecting oblique length of adult chicken body and application of molecular marker primer

Abstract

The invention belongs to the technical field of molecular markers, and particularly discloses a molecular marker primer for detecting the oblique length of an adult chicken body and application of the molecular marker primer for detecting the oblique length of the adult chicken body. Phenotype determination and whole genome re-sequencing of the oblique body length of the adult chicken (300 days old) are carried out, whole genome association analysis is carried out, and the excavated site Chr1: 169650555 has extremely high genetic correlation with the oblique body length and can be effectively used for molecular marker-assisted selective breeding of the oblique body length character of the chicken; individuals with TT (long oblique length), TC (medium oblique length) and CC (short oblique length) genotypes at molecular markers Chr1: 169650555 are directionally selected as breeding hens, and the genetic selection progress of specific oblique length requirements of chicken breeding strains can be rapidly improved.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, in particular to a primer for detecting molecular markers of oblique elongation of adult chickens and application thereof. Background Art

[0002] The oblique length of the chicken body, that is, the straight-line distance from the shoulder end to the ischial tuberosity of the chicken, can intuitively reflect the longitudinal growth of the chicken body. It is an important indicator for evaluating the growth and development of chickens and affecting the consistency of slaughter. Therefore, it is one of the important breeding traits in broiler and laying hen breeding. For broilers, the oblique length of the body is closely related to slaughter performance. Individuals with larger oblique length of the body tend to have a larger body cavity and muscle attachment area, which means that they may have more muscle mass and a higher slaughter rate. Studies have shown that in broiler breeds, the oblique length of the body is significantly positively correlated with meat production traits such as carcass weight, full eviscerated weight, half eviscerated weight, breast muscle weight, and leg muscle weight. Therefore, the measurement of the oblique length of the body can be used as an important auxiliary indicator for evaluating the slaughter performance of broilers, which is helpful for breeding individuals with excellent slaughter performance in vivo; for laying hens, the oblique length of the body is also related to egg-laying performance. Appropriate oblique length of the body helps laying hens maintain good reproductive system development and physiological function. For example, laying hens with moderate body length have relatively large abdominal cavity space, which is conducive to the development and normal function of reproductive organs such as ovaries and fallopian tubes, thus providing a physiological basis for increasing egg production and egg quality.

[0003] Genetically, the oblique length of chickens is a complex trait controlled by multiple genes, and its heritability at different stages is between 0.2-0.3, which is a medium heritability trait. For the selection of this trait, the current chicken breeding practice is still mainly based on phenotypic selection, which is easily affected by environmental factors, and there is a certain uncertainty in the progress of genetic selection.

[0004] For example, Chinese patent publication No. CN111926086A discloses a molecular marker that affects the oblique length of chickens and its application. It also develops molecular markers related to oblique length based on genome-wide association analysis (GWAS) for auxiliary selection, focusing on the selection of body oblique length at 150 days of age, which is close to the sexual maturity of chickens, and is not aimed at the selection of body oblique length at 300 days of age (which is the stage of full sexual maturity of chickens, i.e., adult chickens). The marker loci involved (Chr5:16402009; TC mutation; Gallus_gallus.GRCg6a) (p=7.17E-06) cannot reach the significance threshold at the whole genome level: 5.00E-08~5.00E-09 (0.05 / 1000000SNPs-0.05 / 10000000SNPs), which may be due to insufficient genetic effect.

[0005] Therefore, developing relevant molecular markers with significant genetic effects to assist in the selection of body skew length can quickly improve the progress of genetic selection for body skew length in chicken breeding lines, improve the carcass consistency of the lines, and also help promote the selection of broiler slaughter traits and laying hens reproductive traits. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a primer for detecting molecular markers of oblique elongation in adult chickens and application thereof.

[0007] To achieve the above object, the present invention is implemented according to the following technical solutions: The first technical solution provided by the present invention is a primer for detecting a molecular marker of oblique elongation in an adult chicken, comprising: Upstream primer, sequence F: 5′-CAGCAAGTCCTGTGGTCCAT -3′; Downstream primer, sequence: R: 5′-GCCAACTGGCTCAGTGGTAT -3′; Among them, the specific chromosome position of the molecular marker site in the genome is determined after comparison with the chicken 7.0 reference genome GRCg7b as the reference genome. The molecular marker is Chr1:169650555, located at 169650555 bp of chicken chromosome 1, which is a T / C mutation.

[0008] The second technical solution provided by the present invention is an application of the above-mentioned primers in assisted selection breeding of adult chickens with oblique elongation, comprising the following steps: S1. Extracting genomic DNA from the chicken to be tested; S2, using the primers to perform PCR amplification on the genomic DNA of the chicken to be tested, and obtaining a PCR amplification product after the PCR amplification reaction program is completed; S3. Using the downstream primers to perform Sanger sequencing on the PCR amplification product; and directional selecting individuals with the molecular marker Chr1:169650555 site having the genotype of TT, TC or CC as breeder chickens.

[0009] Furthermore, the PCR amplification reaction system is: 500 ng genomic DNA, 25 μL 2X Pro TaqMaster Mix (dye plus), 1 μL upstream primer with a concentration of 0.2 μM, 1 μL downstream primer with a concentration of 0.2 μM, and enzyme-free sterile water is added to a total reaction system of 50 μl; the PCR reaction program is 94°C 30s; 98°C 10s, 60°C 30s, 72°C 1min, 35 cycles; 72°C 2min.

[0010] Compared with the prior art, the present invention conducts a 19th generation group of 587 AH distantly related deep hybridization resource groups constructed by the Animal Science Institute of Guangdong Academy of Agricultural Sciences to breed adult chickens (300 days old). Phenotypic determination and whole-genome resequencing (average sequencing depth of individuals>10×) related to traits such as body oblique length, body weight, shank length and shank circumference were performed. Further whole-genome association analysis revealed that the site Chr1:169650555 (GRCg7b) was highly genetically correlated with body oblique length, with a genome-wide significance of 5.09E-12, and the explained phenotypic variation variance was 3.09%. The genetic effect was significant, so it can be effectively used for molecular marker-assisted selection breeding of chicken body oblique length traits. By directional selection of individuals with the genotypes of TT (long body oblique length), TC (medium body oblique length) and CC (short body oblique length) at the molecular marker Chr1:169650555 site as breeding chickens, the genetic selection progress for specific body oblique length requirements of chicken breeding lines can be rapidly improved, the carcass consistency of the lines can be improved, and it is also conducive to promoting the selection of broiler slaughter traits and laying hen reproductive traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is the QQ-plot of the genome-wide association analysis of body length in the 19th generation of 572 chickens (154 roosters and 418 hens) of the AH distantly related deep hybridization resource group at 300 days of age.

[0012] Figure 2 The potential and genome-wide significant loci and the gene regions where the physical positions are located are related to chromosome 1 of the 19th generation population of the AH distantly related deep hybridization system resource group at 300 days of age; Figure 3 The potential and genome-wide significant loci and the gene regions where the physical positions are located are related to chromosome 4 of the 19th generation population of the AH distantly related deep hybridization system resource group of 572 chickens (154 roosters and 418 hens) at 300 days of age; Figure 4 The potential and genome-wide significant loci and the gene regions where the physical positions are located are related to chromosome 27 of the 19th generation population of the AH distantly related deep hybridization system resource group at 300 days of age; Figure 5 The genome-wide significant loci for body oblique length in the 19th generation of 572 chickens (154 roosters and 418 hens) of the AH distantly related deep hybridization resource group at 300 days of age were analyzed.

[0013] Figure 6The phenotypic statistics of the 300-day-old elongated body population corresponding to different genotypes at the Chr1:169650555 (GRCg7b) site in male and female populations.

[0014] Figure 7 Genotyping for the Chr1:169650555 (GRCg7b) locus: a is the TT genotype; b is the TC genotype; c is the CC genotype. DETAILED DESCRIPTION

[0015] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0016] The chicken used in this embodiment is the 19th generation group of the distant full-sib deep hybrid system resource group (AH resource group) constructed by the Animal Science Institute of Guangdong Academy of Agricultural Sciences based on Huiyang Bearded Chicken and HQLA specialized strains. The AH resource group has been constructed by the Animal Science Institute of Guangdong Academy of Agricultural Sciences since 2010, and has been continuously hybridized and subcultured for 19 generations. Its F0 generation includes pure Huiyang Bearded Chicken (small size, good meat flavor) and High Quality Chicken Line A (HQLA) (fast growth rate, high feed conversion, and larger size than Huiyang Bearded Chicken). The F1 generation is obtained by reciprocal crosses of the F0 generation, and the F2-F19 generations are subcultured by random mating within the group, which belongs to the dominant resource group for mining domestic chicken growth traits.

[0017] Example 1: Mining of molecular marker site Chr1:169650555 (GRCg7b) for detecting the elongation of adult chicken body The 19th generation population of 587 chickens (167 roosters and 420 hens) of the AH distantly related deep hybridization resource group was subjected to phenotypic measurements such as body length at 300 days of age, body weight at 300 days of age, shank length at 300 days of age, and shank circumference at 300 days of age. At the same time, blood samples were collected from each individual for whole-genome resequencing (average sequencing depth>10×). After excluding 14 individuals with genetic correlation greater than 0.7 and 1 individual with no phenotypic record, the genome data of 572 individuals (154 roosters and 418 hens) were retained and population SNP quality control was performed using VCFtools. The quality control conditions were: "--notchr W --not-chr Z --min-alleles 2 --max-alleles 2 --maf 0.05 --max-missing 0.95 --hwe 1E-05", and 9,633,861 high-quality autosomal SNPs were obtained for genome-wide association analysis. Based on 9633861 high-quality autosomal SNPs, a mixed linear model of GCTA was used, with PC1-PC10 as quantitative covariates and sex as discrete covariate, to conduct a genome-wide association analysis on body length at 300 days of age, and the phenotypic variance explained proportion (pve) of each SNP was estimated. The results are shown in the figure. Figure 1-Figure 5 As shown, Figure 1 This is the QQ-plot of the genome-wide association analysis of body length in the 19th generation of 572 (154 roosters and 418 hens) AH distantly related deep hybridization resource group at 300 days of age; Figure 2 The potential and genome-wide significant loci and the gene regions where the physical positions are located are related to chromosome 1 of the 19th generation population of the AH distantly related deep hybridization system resource group at 300 days of age; Figure 3 The potential and genome-wide significant loci and the gene regions where the physical positions are located are related to chromosome 4 of the 19th generation population of the AH distantly related deep hybridization system resource group of 572 chickens (154 roosters and 418 hens) at 300 days of age; Figure 4 The potential and genome-wide significant loci and the gene regions where the physical positions are located are related to chromosome 27 of the 19th generation population of the AH distantly related deep hybridization system resource group at 300 days of age; Figure 5 The genome-wide significant loci for body length in the 19th generation of 572 AH distantly related deep hybridized chickens (154 roosters and 418 hens) at 300 days of age were obtained. Figure 1-Figure 5 It can be seen that with 5.190027e-09 (Bonferroni correction; 0.05 / 9633861) as the significance threshold, the results showed that a total of 409 SNPs were significantly correlated with the body length at 300 days of age; among them, the site Chr1:169650555 (GRCg7b) had the highest correlation with the body length at 300 days of age, with a significance of 5.09E-12, and the variance of phenotypic variation that could be explained was 3.09%. The genetic effect of this site is a typical additive effect, that is, in the phenotype of body oblique length at 300 days of age, the genotype AA group (rooster: 23.183± 0.725 cm; hen: 20.638± 0.921 cm) > genotype AG group (rooster: 22.282± 0.973 cm; hen: 19.976± 0.802 cm) > genotype GG group (rooster: 21.832± 0.952 cm; hen: 19.561± 0.862 cm), A allele individuals correspond to longer body oblique length, G allele individuals correspond to shorter body oblique length (see Figure 6). Therefore, by eliminating the allele G at this locus, the body slant length of chickens can be significantly increased.

[0018] Example 2: Design and synthesis of primers for molecular markers detecting the body slant length of adult chickens Using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), upstream and downstream primers for amplifying locus Chr1:169650555 (GRCg7b) (rs313551736) were designed: The upstream primer sequence is F: 5’-CAGCAAGTCCTGTGGTCCAT-3’ (see SEQ ID NO.1); The downstream primer sequence is R: 5’-GCCAACTGGCTCAGTGGTAT-3’ (see SEQ ID NO.2); The upstream primer and the downstream primer were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0019] Example 3: Application of primers for molecular markers detecting the body slant length of adult chickens in the assisted selection breeding for improving the body slant length of adult chickens 1) Extract the blood samples of the adult chickens to be tested, and extract genomic DNA by the phenol-chloroform method; 2) Use the upstream primer and the downstream primer shown in SEQ ID NO.1 and SEQ ID NO.2 to perform PCR amplification on the genomic DNA of the Qingyuan partridge chickens to be tested. The PCR reagents, methods, and reaction procedures are all selected from Acclab Biotech Co., Ltd. (Changsha, China). The reaction system and reaction conditions are shown in Tables 1 and 2 below.

[0020] Table 1

[0021] *1: When the 2X Pro Taq Master Mix (dye plus) in the product is used for the first time, centrifuge it first and then use it to avoid loss of enzyme amount.

[0022] *2: Usually, it is recommended that the template addition amount is not higher than 500 ng; the template usage can be adjusted according to actual needs.

[0023] *3: The primers are usually used at a final concentration of 0.2 μM, and can be adjusted within the range of 0.2 - 1.0 μM according to the experimental results.

[0024] *4: The reaction system needs to be prepared on ice, and finally place the prepared reaction solution in a PCR instrument for reaction.

[0025] Table 2

[0026] After the PCR amplification reaction program is completed, the PCR amplification product is subjected to Sanger sequencing: Among them, the upstream primer: F: 5'-CAGCAAGTCCTGTGGTCCAT-3' (primer NCBI online comparison result: physical position is Chr1: 169650450-169650469); Downstream primer: R: 5'-GCCAACTGGCTCAGTGGTAT-3' (primer NCBI online alignment result: physical position is Chr1: 169650968-169650949); Considering that the distance between the upstream primer and the site Chr1:169650555 is relatively close (86 bp), close to the low-quality start end region of Sanger sequencing; and the distance between the downstream primer and the site Chr1:169650555 is 413 bp, belonging to the high-quality region of Sanger sequencing, the downstream primer is selected for Sanger sequencing during sequencing. The full length of the sequence of Sanger sequencing is as follows (see SEQ ID NO.3): TTTAGCGGAT CATGACTCTA AAAGGAACAA AGCAAAAACA CCCTAATATT TCCTCCACCGCCCTGTTGTC CCAAATGGCT GAGTCTAATC TATATAATAA GGAGTATAAC TTCCAGTCCA AGGAATTATTTGAACGTGAT GTGCTGAGAA GCGTACTGAA GACAGTGAAT AACCACCCTT CTCCCACTGA GCTGTTCACTGATTTTATCA TTATATTACT GCACTGTGTT TCTTTGGACC ACCAAGCTGA TTGATCCCAT CCAGCTACACTACGCCTAAA TGACTTTCAG TCTCTTGAAT TAAATGTCTC CTCAATTCAG AAATCACTTA TTTCACCAGAAGTGGGGCCT CTTCTGGCAG GCACCTGACA TAGACTGGGT CCCTTGGYGT GCAACACTGC TTTCATTATTTTGCAGGTCA TAGATTTTAA GAAGTGGACT CACCATGAGG CTTCAAGCCA ATGTCGTTTT TGCATGGACCACAGAACTTG CTGA; The total length of the Sanger downstream primer sequencing sequence is 494 bp, of which the 388th base (shaded base Y; T / C mutation, i.e., A / G mutation at the positive strand site) is the site Chr1:169650555 (GRCg7b) (rs313551736)-SNP marker; the molecular marker site Chr1:169650555 (GRCg7b) genotyping is as follows Figure 7 As shown by Figure 7 It can be seen that when the individual Sanger sequencing peak is TT (complementary genotype is AA) (see Figure 7 In a), the body of the individual at 300 days old is obliquely long and large. When the sequencing peak is TC (complementary genotype is AG) (see Figure 7 b), the individual is obliquely long and medium-sized at 300 days old. When the sequencing peak is CC (complementary genotype is GG) (see Figure 7 c), the body of the individual at 300 days of age is obliquely long and small. Therefore, in chicken breeding practice, by directional selection of individuals with the molecular marker Chr1:169650555 locus as TT (long oblique body length), TC (medium oblique body length) and CC (short oblique body length) genotypes as breeders, the genetic selection progress of the specific oblique body length requirements of chicken breeding lines can be quickly improved.

[0027] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A primer for detecting molecular markers of oblique elongation in adult chickens, characterized in that: include: Upstream primer, sequence F: 5′-CAGCAAGTCCTGTGGTCCAT -3′; Downstream primer, sequence: R: 5′-GCCAACTGGCTCAGTGGTAT -3′; Among them, the specific chromosome position of the molecular marker site in the genome is determined after comparison with the chicken 7.0 reference genome GRCg7b as the reference genome. The molecular marker is Chr1:169650555, located at 169650555bp of chicken chromosome 1, which is a T / C mutation.

2. Use of the primer for detecting molecular markers of oblique elongation in adult chickens as claimed in claim 1 in assisted selection breeding of oblique elongation in adult chickens, characterized in that: The following steps are involved: S1. Extracting genomic DNA from the chicken to be tested; S2, using the primers to perform PCR amplification on the genomic DNA of the chicken to be tested, and obtaining a PCR amplification product after the PCR amplification reaction program is completed; S3. Using the downstream primers to perform Sanger sequencing on the PCR amplification product; and directional selecting individuals with the molecular marker Chr1:169650555 site having the genotype of TT, TC or CC as breeder chickens.

3. The use according to claim 2, characterized in that: The PCR amplification reaction system is: 500 ng genomic DNA, 25 μL 2X Pro Taq Master Mix (dye plus), 1 μL upstream primer with a concentration of 0.2 μM, 1 μL downstream primer with a concentration of 0.2 μM, and enzyme-free sterile water is added to make the total reaction system 50 μl; the PCR reaction program is 94°C 30s; 98°C 10s, 60°C 30s, 72°C 1min, 35 cycles; 72°C 2min.

Images