Primer for a molecular marker for detecting the body slant length of adult chickens and its application

Abstract

The present invention belongs to the technical field of molecular markers, and specifically discloses a primer for detecting a molecular marker of adult chicken body slant length and its application. By performing phenotypic determination of chicken adult (300-day-old) body slant length and whole-genome resequencing on the 19th generation population of 587 AH distant deep hybridization line resource populations constructed by the Institute of Animal Science, Guangdong Academy of Agricultural Sciences, and conducting a genome-wide association analysis, it is found that the locus Chr1:169650555 has a very high genetic correlation with body slant length and can be effectively used for molecular marker-assisted selection breeding of chicken body slant length traits; by directionally selecting individuals with genotypes of TT (long body slant length), TC (medium body slant length), and CC (short body slant length) at the molecular marker locus Chr1:169650555 as breeding chickens, the genetic selection progress for specific body slant length requirements of chicken breeding lines can be rapidly improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, in particular to a primer for detecting a molecular marker of the body slant length of adult chickens and its application. Background Art

[0002] The body slant length of a chicken, that is, the straight-line distance from the shoulder end to the ischial tuberosity of the chicken, can intuitively reflect the longitudinal growth of the chicken body and is an important indicator for evaluating the growth and development of chickens and affecting slaughter consistency. Therefore, it is one of the important selective breeding traits in the breeding of broilers and laying hens. For broilers, the body slant length is closely related to slaughter performance. Individuals with a larger body slant length often have a larger body cavity and muscle attachment area, which means they may have more muscle mass and a higher slaughter rate. Research shows that in broiler breeds, the body slant length is significantly positively correlated with meat production traits such as carcass weight, eviscerated weight, semi-eviscerated weight, breast muscle weight, and leg muscle weight at a medium strength. Therefore, measuring the body slant length can be used as an important auxiliary indicator for evaluating the slaughter performance of broilers, which helps to select individuals with excellent slaughter performance in vivo; for laying hens, the body slant length is also related to egg production performance to a certain extent. Appropriate body slant length helps laying hens maintain good reproductive system development and physiological functions. For example, laying hens with a moderate body slant length have a relatively large abdominal cavity space, which is conducive to the development and normal function of reproductive organs such as the ovaries and oviducts, thus providing a physiological basis for increasing egg production and egg quality.

[0003] Genetically, the body slant length of chickens belongs to a complex trait controlled by multiple genes, and its heritability at different stages ranges from 0.2 to 0.3, belonging to a trait with medium heritability. For the selection and breeding of this trait, phenotypic selection is still mainly used in current chicken breeding practices, which is easily affected by environmental factors and there is a certain degree of uncertainty in genetic selection progress.

[0004] For example, a molecular marker affecting the body slant length of chickens and its application disclosed in Chinese Patent Publication No. CN111926086A also develops molecular markers related to body slant length based on genome-wide association analysis (GWAS) for assisted selection, focusing on the selection of body slant length at 150 days of age, which is in the stage close to the sexual maturity of chickens, rather than the selection of body slant length at 300 days of age (belonging to the stage of complete sexual maturity of chickens, that is, the adult stage of chickens); the marker locus involved (Chr5:16402009; TC mutation; Gallus_gallus.GRCg6a) (p = 7.17E-06) cannot reach the significance threshold at the genome-wide level: 5.00E-08~5.00E-09 (0.05 / 1000000 SNPs - 0.05 / 10000000 SNPs), and there may be a problem of insufficient genetic effect.

[0005] Therefore, developing relevant molecular markers with significant genetic effects for the assistant selection of body slant length can rapidly improve the genetic selection progress of body slant length in chicken breeding lines, enhance the carcass consistency of the lines, and at the same time is also conducive to promoting the breeding of broiler slaughter traits and laying hen reproductive traits. Summary of the Invention

[0006] To solve the above technical problems, the present invention provides a primer for detecting a molecular marker of adult chicken body slant length and its application.

[0007] To achieve the above object, the present invention is implemented according to the following technical scheme:

[0008] The first technical solution provided by the present invention is a primer for detecting a molecular marker of adult chicken body slant length, including:

[0009] Forward primer, with the sequence F: 5’-CAGCAAGTCCTGTGGTCCAT -3’;

[0010] Reverse primer, with the sequence R: 5’-GCCAACTGGCTCAGTGGTAT -3’;

[0011] Among them, the specific chromosomal position of the molecular marker in the genome is determined after alignment with the chicken 7.0 reference genome GRCg7b. The molecular marker is Chr1:169650555, located at the 169650555 bp of chicken chromosome 1, and is a T / C mutation.

[0012] The second technical solution provided by the present invention is an application of the above primer in the assistant selection breeding of adult chicken body slant length, including the following steps:

[0013] S1. Extract the genomic DNA of the chicken to be detected;

[0014] S2. Perform PCR amplification on the genomic DNA of the chicken to be detected using the primer. After the PCR amplification reaction program ends, obtain the PCR amplification product;

[0015] S3. Perform Sanger sequencing on the PCR amplification product using the reverse primer; Select individuals with the TT or TC or CC genotype at the Chr1:169650555 locus of the molecular marker as breeding chickens through directional selection.

[0016] Furthermore, the PCR amplification reaction system is as follows: 500 ng of genomic DNA, 25 μL of 2X Pro TaqMaster Mix (dye plus), 1 μL of upstream primer with a concentration of 0.2 μM, 1 μL of downstream primer with a concentration of 0.2 μM, and nuclease-free and sterile water is added to make the total reaction system 50 μl; the PCR reaction program is 94 °C for 30 s; 98 °C for 10 s, 60 °C for 30 s, 72 °C for 1 min, for 35 cycles; 72 °C for 2 min.

[0017] Compared with the prior art, in the present invention, phenotypic measurements and whole-genome resequencing (individual average sequencing depth >10×) related to traits such as body slant length, body weight, shank length, and shank circumference of the 19th generation population of the AH distant deep hybridization line resource population constructed by the Institute of Animal Science, Guangdong Academy of Agricultural Sciences, were carried out on 587 chickens. Further, through genome-wide association analysis, the locus Chr1:169650555 (GRCg7b) was found to have a very high genetic correlation with body slant length, with a genome-wide significance reaching 5.09E-12, and the phenotypic variation variance it could explain was 3.09%. The genetic effect was significant. Therefore, it can be effectively used for molecular marker-assisted selection breeding of chicken body slant length traits; by directionally selecting individuals with genotypes TT (long body slant length), TC (medium body slant length), and CC (short body slant length) at the locus Chr1:169650555 as breeding chickens, the genetic selection progress for the specific body slant length requirements of the chicken breeding line can be rapidly improved, the carcass consistency of the line can be increased, and at the same time, it is also beneficial to promoting the breeding of broiler slaughter traits and laying hen reproductive traits. Brief Description of the Drawings

[0018] Figure 1 It is a QQ-plot of the genome-wide association analysis of body slant length at 300 days of age for the 19th generation population of the AH distant deep hybridization line resource population of 572 chickens (154 roosters and 418 hens).

[0019] Figure 2 It is the potential and genome-wide significant loci and the gene regions where the physical positions are located related to chromosome 1 of the genome-wide body slant length at 300 days of age for the 19th generation population of the AH distant deep hybridization line resource population of 572 chickens (154 roosters and 418 hens);

[0020] Figure 3 It is the potential and genome-wide significant loci and the gene regions where the physical positions are located related to chromosome 4 of the genome-wide body slant length at 300 days of age for the 19th generation population of the AH distant deep hybridization line resource population of 572 chickens (154 roosters and 418 hens);

[0021] Figure 4For the 19th generation population of 572 (154 cocks and 418 hens) AH distant-related deep crossbred line resource population at 300 days of age, the potential and genome-wide significant loci and gene regions where the physical positions are located on chromosome 27 of the whole genome for body slanting length;

[0022] Figure 5 For the genome-wide significant loci of body slanting length of the 19th generation population of 572 (154 cocks and 418 hens) AH distant-related deep crossbred line resource population at 300 days of age.

[0023] Figure 6 For the statistical phenotypes of body slanting length of the 300-day-old population corresponding to different genotypes of the locus Chr1:169650555 (GRCg7b) in male and female populations.

[0024] Figure 7 For the genotyping of the locus Chr1:169650555 (GRCg7b): a is the TT genotype; b is the TC genotype; c is the CC genotype. Specific implementation manners

[0025] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention in combination with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0026] The chickens used in this embodiment are the 19th generation population of the distant-related full-sib deep crossbred line resource population (AH resource population) constructed by the Institute of Animal Science, Guangdong Academy of Agricultural Sciences based on Huiyang bearded chickens and the HQLA specialized strain. The AH resource population has been constructed by the Institute of Animal Science, Guangdong Academy of Agricultural Sciences since 2010 and has been continuously crossbred and subcultured for 19 generations. Its F0 generation includes pure-line Huiyang bearded chickens (smaller in size and better in meat flavor) and the specialized strain A of high-quality broilers (High Quality chicken Line A; HQLA) (fast growth rate, high feed conversion rate, and larger in size compared with Huiyang bearded chickens). The F1 generation is obtained by reciprocal crosses of the F0 generation, and the F2-F19 generations are subcultured by random mating within the population, belonging to a superior resource population for exploring chicken growth-related traits in China.

[0027] Example 1. Mining of the molecular marker locus Chr1:169650555 (GRCg7b) for detecting body slanting length of adult chickens

[0028] Phenotypic measurements such as body slant length at 300 days of age, body weight at 300 days of age, shank length at 300 days of age, and shank circumference at 300 days of age were carried out on the 19th generation population of 587 (167 roosters and 420 hens) AH distant deep crossbred line resource populations. At the same time, blood samples of each individual were collected for whole-genome resequencing (average sequencing depth > 10×); after excluding 14 individuals with genetic relatedness greater than 0.7 among individuals and 1 individual with no phenotypic records at all, 572 individuals (154 roosters and 418 hens) genomic data were retained and then population SNP quality control was performed using VCFtools. The quality control conditions were: "--notchr W --not-chr Z --min-alleles 2 --max-alleles 2 --maf 0.05 --max-missing 0.95 --hwe 1E-05", obtaining 9,633,861 high-quality autosomal SNPs for genome-wide association analysis;

[0029] Based on 9,633,861 high-quality autosomal SNPs, using the mixed linear model of GCTA, PC1-PC10 as quantitative covariates, and gender as a discrete covariate, genome-wide association analysis was performed on body slant length at 300 days of age, and at the same time, the proportion of phenotypic variance explained (pve) of each SNP was estimated; The results are as Figures 1 - 5 shown Figure 1 is the QQ-plot of genome-wide association analysis of body slant length at 300 days of age for the 19th generation population of 572 (154 roosters and 418 hens) AH distant deep crossbred line resource populations; Figure 2 is the gene region where the potential and genome-wide significant loci and physical positions related to chromosome 1 of the whole genome of body slant length at 300 days of age for the 19th generation population of 572 (154 roosters and 418 hens) AH distant deep crossbred line resource populations; Figure 3 is the gene region where the potential and genome-wide significant loci and physical positions related to chromosome 4 of the whole genome of body slant length at 300 days of age for the 19th generation population of 572 (154 roosters and 418 hens) AH distant deep crossbred line resource populations; Figure 4 is the gene region where the potential and genome-wide significant loci and physical positions related to chromosome 27 of the whole genome of body slant length at 300 days of age for the 19th generation population of 572 (154 roosters and 418 hens) AH distant deep crossbred line resource populations; Figure 5 are the genome-wide significant loci of body slant length at 300 days of age for the 19th generation population of 572 (154 roosters and 418 hens) AH distant deep crossbred line resource populations; From Figures 1 - 5It can be seen that with 5.190027e-09 (Bonferroni correction; 0.05 / 9633861) as the significance threshold, the results showed that a total of 409 SNPs were significantly associated with the body slant length at 300 days of age; among them, the locus Chr1:169650555 (GRCg7b) had the highest correlation with the body slant length at 300 days of age, with a significance of 5.09E-12, and the phenotypic variance explained was 3.09%. The genetic effect of this locus belongs to the typical additive effect, that is, in the phenotypic traits of the body slant length at 300 days of age, the genotype AA population (rooster: 23.183 ± 0.725 cm; hen: 20.638 ± 0.921 cm) > genotype AG population (rooster: 22.282 ± 0.973 cm; hen: 19.976 ± 0.802 cm) > genotype GG population (rooster: 21.832 ± 0.952 cm; hen: 19.561 ± 0.862 cm), and individuals with the A allele had a longer body slant length, while individuals with the G allele had a shorter body slant length (see Figure 6 ). Therefore, by eliminating the allele G at this locus, the body slant length of chickens can be significantly improved.

[0030] Example 2: Design and synthesis of primers for molecular markers for detecting the body slant length of adult chickens

[0031] Using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), upstream and downstream primers for amplifying the locus Chr1:169650555 (GRCg7b) (rs313551736) were designed:

[0032] The upstream primer sequence is F: 5’-CAGCAAGTCCTGTGGTCCAT-3’ (see SEQ ID NO.1);

[0033] The downstream primer sequence is R: 5’-GCCAACTGGCTCAGTGGTAT-3’ (see SEQ ID NO.2);

[0034] The upstream primer and the downstream primer were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0035] Example 3: Application of primers for molecular markers for detecting the body slant length of adult chickens in the assisted selection breeding for improving the body slant length of adult chickens

[0036] 1) Extract the blood samples of the adult chickens to be tested, and extract genomic DNA by the phenol-chloroform method;

[0037] 2) Use the upstream primer and downstream primer shown in SEQ ID NO.1 and SEQ ID NO.2 to perform PCR amplification on the genomic DNA of the Qingyuan partridge chicken to be tested. The PCR reagents, methods, and reaction procedures are all selected from Aikerui Bioengineering Co., Ltd. (Changsha, China). The reaction system and reaction conditions are shown in Tables 1 and 2 below, respectively.

[0038] Table 1

[0039]

[0040] *1: When the 2X Pro Taq Master Mix (dye plus) in the product is used for the first time, centrifuge it first and then use it to avoid loss of enzyme amount.

[0041] *2: Usually, it is recommended that the template addition amount does not exceed 500 ng; the template usage can be adjusted according to actual needs.

[0042] *3: The primer is usually used at a final concentration of 0.2 μM and can be adjusted within the range of 0.2 - 1.0 μM according to the experimental results.

[0043] *4: The reaction system needs to be prepared on ice, and finally, the prepared reaction solution is placed in a PCR instrument for reaction.

[0044] Table 2

[0045]

[0046] After the PCR amplification reaction program ends, perform Sanger sequencing on the PCR amplification product:

[0047] Among them, upstream primer: F: 5’-CAGCAAGTCCTGTGGTCCAT-3’ (primer NCBI online alignment result: physical position is Chr1:169650450 - 169650469);

[0048] downstream primer: R: 5’-GCCAACTGGCTCAGTGGTAT-3’ (primer NCBI online alignment result: physical position is Chr1:169650968 - 169650949);

[0049] Considering that the distance between the upstream primer and the locus Chr1:169650555 is relatively close (86 bp), near the low-quality starting end area of Sanger sequencing; while the distance between the downstream primer and the locus Chr1:169650555 is 413 bp, belonging to the high-quality area of Sanger sequencing. Therefore, the downstream primer is selected for Sanger sequencing during sequencing. The full length of the sequence of Sanger sequencing is as follows (see SEQ ID NO.3):

[0050] TTTAGCGGAT CATGACTCTA AAAGGAACAA AGCAAAAACA CCCTAATATT TCCTCCACCGCCCTGTTGTC CCAAATGGCT GAGTCTAATC TATATAATAA GGAGTATAAC TTCCAGTCCA AGGAATTATTTGAACGTGAT GTGCTGAGAA GCGTACTGAA GACAGTGAAT AACCACCCTT CTCCCACTGA GCTGTTCACTGATTTTATCA TTATATTACT GCACTGTGTT TCTTTGGACC ACCAAGCTGA TTGATCCCAT CCAGCTACACTACGCCTAAA TGACTTTCAG TCTCTTGAAT TAAATGTCTC CTCAATTCAG AAATCACTTA TTTCACCAGAAGTGGGGCCT CTTCTGGCAG GCACCTGACA TAGACTGGGT CCCTTGGYGT GCAACACTGC TTTCATTATTTTGCAGGTCA TAGATTTTAA GAAGTGGACT CACCATGAGG CTTCAAGCCA ATGTCGTTTT TGCATGGACCACAGAACTTG CTGA;

[0051] The full length of the Sanger downstream primer sequencing sequence is 494 bp. The 388th base (the shaded base Y; T / C mutation, i.e., A / G mutation at the sense strand locus) is the SNP marker at locus Chr1:169650555 (GRCg7b) (rs313551736); the genotyping of the molecular marker locus Chr1:169650555 (GRCg7b) is as Figure 7 shown, and it can be seen from Figure 7 that when the Sanger sequencing peak map of an individual is TT (the complementary genotype is AA) (see a in Figure 7 ), the body slanting length of the individual at 300 days of age is relatively large. When the sequencing peak map is TC (the complementary genotype is AG) (see b in Figure 7 ), the body slanting length of the individual at 300 days of age is medium. When the sequencing peak map is CC (the complementary genotype is GG) (see Figure 7In c) among them, the body slant length of the individual at 300 days of age is on the small side. Therefore, in chicken breeding practice, by directionally selecting individuals with genotypes TT (long body slant length), TC (medium body slant length), and CC (short body slant length) at the molecular marker Chr1:169650555 locus as breeding chickens, the genetic selection progress for the specific body slant length requirements of the chicken breeding line can be rapidly improved.

[0052] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.

Claims

1. Application of a primer for a molecular marker for detecting the body slant length of adult chickens in the assisted selection breeding of the body slant length of adult chickens, characterized in that, Including the following steps: S1. Extract the genomic DNA of the chicken to be detected, which is a 300-day-old chicken in the 19th generation population of the AH distant-related deep hybridization line resource population; S2. Use the primers for detecting the molecular markers of the body slant length of adult chickens to perform PCR amplification on the genomic DNA of the chicken to be detected. After the PCR amplification reaction program ends, a PCR amplification product is obtained; the primers for detecting the molecular markers of the body slant length of adult chickens include: Forward primer, with the sequence F: 5’-CAGCAAGTCCTGTGGTCCAT -3’; Reverse primer, with the sequence R: 5’-GCCAACTGGCTCAGTGGTAT -3’; Among them, the specific chromosomal position of the molecular marker in the genome is determined after alignment with the chicken 7.0 reference genome GRCg7b. The molecular marker is Chr1:169650555, located at the 169650555bp of chicken chromosome 1, and is a T / C mutation; S3. Use the reverse primer to perform Sanger sequencing on the PCR amplification product; select individuals with the TT or TC or CC genotype at the Chr1:169650555 locus of the molecular marker as breeding chickens by directional selection.

2. The application according to claim 1, wherein The PCR amplification reaction system is: 500 ng genomic DNA, 25 μL 2X Pro Taq Master Mix, 1 μL forward primer with a concentration of 0.2 μM, 1 μL reverse primer with a concentration of 0.2 μM, and add enzyme-free and sterile water to make the total reaction system 50 μl; the PCR reaction program is 94 °C for 30 s; 98 °C for 10 s, 60 °C for 30 s, 72 °C for 1 min, 35 cycles; 72 °C for 2 min.

Images