Primer for detecting ACBD6 gene molecular marker for chicken lateral crown branch defect and its application

Abstract

The present invention belongs to the field of molecular marker technology and specifically discloses a method for detecting defects in chicken lateral crown branches. ACBD6 The primers and applications of molecular markers of genes were studied. Phenotypic determination and whole-genome resequencing of 300-day-old Qingyuan Ma chickens were carried out, and whole-genome association analysis was performed. The Chr8:5934516 (GRCg7b) (rs737527050) locus discovered has a very high genetic correlation with the lateral crown branch phenotype (p=3.49207e-10), and can therefore be effectively used in molecular marker-assisted selection breeding for chicken lateral crown branch defects. Selecting individuals with the GG genotype of the molecular marker Chr8:5934516 locus as breeding chickens can quickly reduce the incidence of lateral crown branch defect alleles in the breeding population and its subsequent generation population, and can also indirectly improve the carcass uniformity of the breeding core group.

Description

Technical Field

[0001] The present invention relates to the field of molecular marker technology, in particular to a method for detecting chicken lateral crown branch defects. ACBD6 Primers and applications for molecular markers of genes. Background Art

[0002] The comb is an important secondary sexual characteristic of chickens and an important indicator of chicken health and carcass uniformity. Side sprigs on chicken comb refer to additional, irregular protrusions or growths extending from the main structure of the comb. In the broiler and laying hen industries, it is often regarded as a defect, especially in breeds that require a clear comb shape. The appearance of side sprigs is usually caused by genetic factors and is usually an unwelcome feature in the breeding selection process. Genetically, chicken side sprigs are considered to be a quality trait controlled by a single gene or a few genes, but they have a more complex inheritance pattern and can be dominant, incompletely dominant or semi-dominant under different population genetic backgrounds, indicating that there may be regulatory genes and genetic markers with more significant genetic effects for this trait.

[0003] At present, molecular marker-assisted selection for traits related to comb type mainly focuses on several common comb type variations, such as a silky chicken rose comb molecular marker based on KASP technology and its application disclosed in Chinese Patent Publication No. CN114854880A; a primer, kit and application for identifying chicken rose comb genotype by whole blood method disclosed in Chinese Patent Publication No. CN113604580A; a primer, kit and detection method for detecting chicken rose comb locus gene disclosed in Chinese Patent Publication No. CN108570506A; a method for detecting chicken rose comb traits disclosed in Chinese Patent Publication No. CN102041310A; a molecular marker related to chicken antler comb traits and its application disclosed in Chinese Patent Publication No. CN116397034A; a molecular marker related to chicken "antler" comb traits and its typing method and application disclosed in Chinese Patent Publication No. CN111394473A; there is no patent technology in the field of molecular detection related to chicken lateral crown branch traits.

[0004] Therefore, conducting genome-wide association analysis on this trait, exploring genes related to chicken lateral crown branches and their significantly associated molecular markers for assisted selection, is of great significance for quickly eliminating this defective trait in chicken breeding. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides a method for detecting defects in chicken lateral crown branches. ACBD6 Primers and applications for molecular markers of genes.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0007] The first technical solution provided by the present invention is a method for detecting defects in chicken lateral crown branches. ACBD6 Primers for molecular markers of genes, including:

[0008] Upstream primer, sequence F: 5′-AGCTGAAGTACCCCCAGTGA-3′;

[0009] Downstream primer, sequence: R: 5′-GGCTGCGTTAGCGGGATTA-3′;

[0010] The specific chromosome location of the molecular marker site in the genome was determined by comparing the chicken 7.0 reference genome GRCg7b as the reference genome. The molecular marker is Chr8:5934516, which is located in the chromosome 8 of Qingyuan Ma chicken. ACBD6 Position 5934516 within the gene region is a C / A mutation.

[0011] The second technical solution provided by the present invention is an application of the above-mentioned primers in assisted selection breeding for reducing lateral crown branch defects in Qingyuan Ma chicken, comprising the following steps:

[0012] S1. Extracting genomic DNA from the Qingyuan Silkie chicken to be tested;

[0013] S2. performing PCR amplification on the genomic DNA of the Qingyuan Ma chicken to be tested using the primers, and obtaining a PCR amplification product after the PCR amplification reaction procedure is completed;

[0014] S3. Perform Sanger sequencing on the PCR amplification product using the downstream primers; select individuals with the GG genotype at the molecular marker Chr8:5934516 site as breeder chickens.

[0015] Furthermore, the PCR amplification reaction system is: 500 ng genomic DNA, 25 μL 2X Pro TaqMaster Mix (dye plus), 1 μL upstream primer with a concentration of 0.2 μM, 1 μL downstream primer with a concentration of 0.2 μM, and enzyme-free sterile water is added to the total reaction system to 50 μL; the PCR reaction program is 94°C 30s; 98°C 10s, 60°C 30s, 72°C 1min, 35 cycles; 72°C 2min.

[0016] Compared with the existing technology, the present invention conducted phenotypic measurement and whole-genome resequencing of 300-day-old lateral crown branches-related chickens on 1,496 purebred Qingyuan Ma chickens (average sequencing depth of individuals >10×), and carried out whole-genome association analysis. The Chr8:5934516 (GRCg7b) (rs737527050) site mined has an extremely high genetic correlation with the lateral crown branch phenotype (p = 3.49207e-10), and can therefore be effectively used for molecular marker-assisted selection breeding of chicken lateral crown branch defects; selecting individuals with the GG genotype of the molecular marker Chr8:5934516 locus as breeding chickens can quickly reduce the lateral crown branch defect allele in the breeding population and the incidence of lateral crown branches in subsequent generations, and can also indirectly improve the carcass uniformity of the breeding core group. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a genome-wide association analysis of the phenotypic characteristics of lateral crown branches and non-lateral crown branches in a group of 1,496 purebred Qingyuan Silkie hens at 300 days of age: a is a QQ plot; b is a Manhattan plot.

[0018] Figure 2 Genotyping of the molecular marker site Chr8:5934516: a is TT genotype; b is TG genotype; c is GG genotype. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0020] Example 1: Detection of defects in chicken lateral crown branches ACBD6 Mining of the molecular marker site Chr8:5934516 (GRCg7b) (rs737527050) of the gene

[0021] A total of 1501 purebred Qingyuan Ma chicken hens were phenotyped at 300 days of age for lateral crown branches (n = 43) and non-lateral crown branches (n = 1458). Blood samples were collected from each individual for whole-genome resequencing (average sequencing depth > 10×). After excluding 5 individuals with individual locus deletion rates greater than 0.05 (43 individuals with lateral crown branches and 1453 individuals with non-lateral crown branches), 1496 individual genome data were retained and population SNP quality control was performed using VCFtools under the following conditions: "--not-chr W --not-chr Z --min-alleles 2 --max-alleles 2 --maf 0.015 --max-missing0.95". A total of 15,175,078 high-quality autosomal SNPs were obtained. At the same time, LD-pruning (parameter "--indep-pairwise") was performed on autosomal SNPs based on the adjustment of the effective number of independent tests using Plink 1.9. 50 5 0.5”, the number of low-linked autosomal SNPs was estimated to be 3682389 as the effective number of sites, and the significance test of genome-wide association analysis was performed using Bonferroni correction, that is, the suggested significance threshold was 2.715628e-07 (1 / 3682389), and the genome-wide significance threshold was 1.357814e-08 (0.05 / 3682389);

[0022] A genome-wide association analysis of lateral crown branches was performed based on 15,175,078 high-quality autosomal SNPs using a generalized linear model in PLINK2 (with PC1, PC2, and PC3 as covariates and Firth logistic regression as a fallback when data were sparse or separated). The significance threshold was 1.357814e-08 (Bonferroni correction; 0.05 / 3,682,389). The results are shown in Figure 2. Figure 1 As shown, Figure 1 This is a genome-wide association analysis of the phenotypic characteristics of lateral crown branches and non-lateral crown branches in a group of 1496 purebred Qingyuan Ma chicken hens at 300 days of age: a is a QQ plot (Quantile-quantile plot), which represents the degree of fit between the actual observed value and the expected value; b is a Manhattan plot; Figure 1 As can be seen from a in , there are 6 SNPs significantly associated with 300-day-old lateral crown branches. Figure 1 As can be seen from b, all six significant loci are located in a 58 Kb genomic region on chromosome 8 (8:5876910-5934637; GRCg7b), which contains ACBD6 ( Acyl-CoA Binding Domain Containing 6 )and XPR1 ( Xenotropic and Polytropic Retrovirus Receptor 1 ) and other 2 protein-coding genes; located in ACBD6 The site Chr8:5934516 (GRCg7b) (rs737527050) within the intron region of the gene had the highest genetic correlation with lateral crown branches ( p = 3.49207e-10), the genetic effect of this site is a typical additive effect.

[0023] Then, the incidence of lateral crown branches at 300 days of age corresponding to different genotypes of the Chr8:5934516 (GRCg7b) (rs737527050) locus was counted, and the results are shown in Table 1.

[0024] Table 1

[0025]

[0026] As shown in Table 1, the incidence of lateral crown branches in the lateral crown branch and non-lateral crown branch populations was as follows: genotype AA (population lateral crown branch incidence: 33.33%) > genotype CA (population lateral crown branch incidence: 5.91%) > genotype CC (population lateral crown branch incidence: 1.72%). Individuals with the A allele had a higher incidence of lateral crown branches, while individuals with the C allele had a lower incidence. Therefore, the incidence of lateral crown branch defects in chickens can be significantly reduced by eliminating the A allele at this locus.

[0027] Example 2: Detection of defects in the lateral crown branches of Qingyuan chickens ACBD6 Design and synthesis of primers for molecular markers of genes

[0028] NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to design upstream and downstream primers for amplification of site Chr8:5934516 (GRCg7b) (rs737527050):

[0029] The upstream primer sequence is F: 5′-AGCTGAAGTACCCCCAGTGA-3′ (see SEQ ID NO. 1);

[0030] The downstream primer sequence is R: 5′-GGCTGCGTTAGCGGGATTA-3′ (see SEQ ID NO. 2);

[0031] The upstream and downstream primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0032] Example 3: Detection of defects in the lateral crown branches of Qingyuan chickens ACBD6Application of primers for molecular markers of genes in assisted selection breeding to reduce lateral crown branch defects in Qingyuan Ma chicken

[0033] 1) Blood samples were collected from individual Qingyuan Ma chickens to be tested, and genomic DNA was extracted using the phenol-chloroform method;

[0034] 2) PCR amplification was performed on genomic DNA of the Qingyuan Silkie chicken to be tested using the upstream primers and downstream primers shown in SEQ ID NO. 1 and SEQ ID NO. 2. PCR reagents, methods, and reaction procedures were all purchased from Aikerui Biotechnology Co., Ltd. (Changsha, China). The reaction system and reaction conditions are shown in Tables 2 and 3, respectively.

[0035] Table 2

[0036]

[0037] *1: When using the 2X Pro Taq Master Mix (dye plus) for the first time, centrifuge it before use to avoid enzyme loss.

[0038] *2: Generally, the recommended template addition amount is no more than 500 ng; the template amount can be adjusted according to actual needs.

[0039] *3: Primers are usually used at a final concentration of 0.2 μM. This concentration can be adjusted within the range of 0.2 to 1.0 μM based on experimental results.

[0040] *4: The reaction system needs to be prepared on ice, and then placed in a PCR instrument for reaction.

[0041] Table 3

[0042]

[0043] After the PCR amplification reaction program was completed, the PCR amplification products were subjected to Sanger sequencing;

[0044] Among them, the upstream primer: F: 5'-AGCTGAAGTACCCCCAGTGA-3' (primer NCBI online alignment result: physical position is Chr8: 5933867-5933886);

[0045] Downstream primer: R: 5'-GGCTGCGTTAGCGGGATTA-3' (primer NCBI online alignment result: physical location is Chr8: 5934746-5934728);

[0046] Considering that the upstream primer is 630 bp away from the site Chr8:5934516, which is close to the low-quality end region of Sanger sequencing; and the downstream primer is 230 bp away from the site Chr8:5934516, which belongs to the high-quality region of Sanger sequencing, the downstream primer was selected for Sanger sequencing. The full length of the Sanger sequencing sequence is as follows:

[0047] AATCTGATGA TACCGGCAGC GGGCTGGCTT CCAAACGGCA GGGGGACGGG GAGAGGGGTGCTGGGGGTGC TGGCTGCCAC CCGACTGCCC AGTGGCCCCC GCTTCTGAAC CAGCAGCGAG CCCATGGGGCTTGCTCTGCT CCGGGGAGTGGACT GGC GTGGTGGTTTGTCAGAAAAGAGCTTGTTTCACCCCTTGGGATGKCAGAGCGTATCACATAGCTCAATGGG ACCTTAAAGCCCATTCAATTCCATCCCAGCGCATGGTCCACACACAGG CAGCTCCTCTGCTGTGCTCGGAAATGGAAG CGGACGTCTGGCAGCAGCATTTGCTATCTGCCAAGTTTGCTGGAAACGTTTGTAAACTGCCTTTTTTTTTTTTTTTTT TCCTCCTTAAAAAAATGTTTTAAAAGAACTCTGAAGTTGA1ATTTCCAGTTGTGCAGCACTCCTGGGCTTCTCCCTCAGTC TGCATCTTAGATTTGATTCACCCCTTCCTTTCATTCATTCATTTCCAGTT TCCCAATGGTTAATTCCCAACTTTGGGAAA ATTGAATTAA TATTAATTGGTCATTGAAAAAACTCCACCACTTGTGGCTTCCTTCCGGGATTAAAAACAAAATAAAACTT TAATCAACAA GAAAAAAACCACAATAAGCCCAACAATGGTTAACCACC TTAAACCACCAA AACCCTTTTTT TCCAAGGGAATCCTCGAATTCCAACAA CAAGCCTTAA TTTTATCCTA TGGCCAAAGT GAGATTAGTG ATTTACAGAAAAACCCCAAG GGCAAAGCACTATGCTAATA CATTTTGCAA CTGTTCCCCA TTAGTCACTG GGGGTAACTTCACCTAAA(SEQ.

[0048] The full length of the Sanger downstream primer sequencing sequence is 858 bp, of which the 204th base, the shaded base K (T / G mutation - A / C mutation when sequencing with the forward primer), is the site Chr8:5934516 (GRCg7b) (rs737527050)-SNP marker. The genotyping of the molecular marker site Chr8:5934516 is as follows Figure 2 shown by Figure 2 It can be seen that when the individual Sanger sequencing peak is TT (the forward complementary genotype is AA) (see Figure 2 In a), the frequency of lateral branches of the individual cockscomb is high (33.33%). When the sequencing peak is TG (the positive complementary genotype is AC) (see Figure 2 b), the frequency of side branches in the individual cockscomb is medium (5.91%). When the sequencing peak is GG (the positive complementary genotype is CC) (see Figure 2 The frequency of individual lateral combs (c) is low (1.72%). Therefore, in chicken breeding, by detecting this SNP marker and selectively selecting for the GG genotype at the Chr8:5934516 locus or eliminating breeders with the TT genotype, the frequency of lateral comb defects in the breeding population and the incidence of lateral combs in subsequent generations can be rapidly reduced. This can also indirectly improve the carcass uniformity of the breeding core herd.

[0049] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for detecting defects in chicken lateral crown branches ACBD6 The invention relates to an application of a primer for a molecular marker of a gene in assisted selection breeding for reducing lateral crown branch defects in Qingyuan Ma chicken, characterized in that: The following steps are involved: S1. Extracting genomic DNA from the Qingyuan Silkie chicken to be tested; S2. Using the method of detecting defects in chicken lateral crown branches ACBD6 The primers for the molecular marker of the gene are used to perform PCR amplification on the genomic DNA of the Qingyuan Ma chicken to be tested. After the PCR amplification reaction program is completed, a PCR amplification product is obtained; the primers include: The upstream primer, sequence F: 5'-AGCTGAAGTACCCCCAGTGA-3', and Downstream primer, sequence: R: 5′-GGCTGCGTTAGCGGGATTA-3′; The specific chromosome position of the molecular marker site in the genome was determined after comparison with the chicken 7.0 reference genome GRCg7b. The molecular marker was located in chromosome 8 of Qingyuan Ma chicken. ACBD6 Position 5934516 within the gene region is a C / A mutation; S3. Perform Sanger sequencing on the PCR amplification product using the downstream primers; select individuals with a genotype of GG in the molecular marker in the sequencing results as breeder chickens.

2. The use according to claim 1, characterized in that The PCR amplification reaction system was as follows: 500 ng genomic DNA, 25 μL 2× Pro Taq Master Mix (dye plus), 1 μL upstream primer at a concentration of 0.2 μM, 1 μL downstream primer at a concentration of 0.2 μM, and enzyme-free sterile water was added to a total reaction system of 50 μL. The PCR amplification reaction program was as follows: 94°C for 30 s; 98°C for 10 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 2 min.

Images