129 results about "Breeding chicken" patented technology

The invention provides a multi-modal information fusion feeding decision-making system and method for chicken breeding behavior recognition, and the method comprises the steps: collecting a multi-source heterogeneous data set, and extracting a primary fusion feature vector; constructing a triple knowledge graph; mining implicit association rules of the ingestion frequency and the body temperature; performing secondary fusion on the primary fusion feature vector and an implicit association rule to generate an intermediate decision feature; and generating a feeding decision instruction through the pre-training decision model and the expert rule base. According to the method, the knowledge graph is constructed, GNN reasoning is utilized, and a manual preset rule static mode is replaced; performing secondary feature fusion, generating intermediate decision features by combining primary fusion features and implicit rules, and then combining a pre-training model and an expert rule base, ensuring decision real-time performance, integrating domain knowledge, outputting accurate adjustment parameters, realizing full-link intelligence, improving the accuracy and adaptability of breeding chicken feeding decisions, and improving the accuracy and adaptability of chicken feeding decisions. Therefore, dynamic requirements of complex breeding scenes are met, and chicken flock health and breeding efficiency improvement are promoted.

The invention discloses a microbial fermentation chicken manure fish fertilizer for aquaculture and a preparation method of the microbial fermentation chicken manure fish fertilizer, and belongs to the technical field of agricultural waste resource utilization. The method comprises the following steps: firstly, flushing chicken manure of cage rearing chickens with a photosynthetic bacterium solution and screening out particles; then adding EM bacteria and lactic acid bacteria for composting fermentation; drying the fermentation product; and finally adding zeolite powder loaded with photosynthetic bacteria, mixing and modifying to obtain the final fish fertilizer. Through a unique process of combining multi-strain synergistic fermentation and zeolite powder modification, thorough harmlessness and recycling of the chicken manure are realized. The obtained fish fertilizer not only has comprehensive nutrition and lasting fertilizer efficiency, can effectively promote the growth of plankton in an aquaculture pond, but also has the functions of adsorbing and degrading ammonia nitrogen, hydrogen sulfide and other harmful substances in a water body, and has the remarkable advantages of improving water quality, reducing diseases and increasing the culture yield.

The utility model relates to the technical field of inhabiting frames, and discloses a free-range chicken inhabiting frame which comprises a transverse round rod, connecting pieces, an inclined rod, a first vertical rod, a second vertical rod, a first bottom supporting rod and a second bottom supporting rod, the connecting pieces are fixedly connected to the outer surface of the inclined rod and the outer surface of the first bottom supporting rod, and a hoop is installed on the outer surface of the transverse round rod. The outer surface of the hoop is fixedly connected with a first connecting lug, the inner side of the first connecting lug is rotationally connected with a second connecting lug through a pin shaft, and the top end of the second connecting lug is fixedly connected with an inhabiting disc. The hoops, the connecting lugs and the transverse round rods are rotationally connected, the two ends of the connecting rods are inserted into the arc-shaped grooves of the arc-shaped plates in a penetrating mode, the connecting rods slide in the arc-shaped grooves by lifting the connecting rod ball heads, the connecting plates and the inhabiting discs can be driven to rotate around the pin shafts, the inhabiting discs can be turned over at a time, and the inner straw mats fall off; by means of the design, the straw mats for the free-range chickens to lie down can be replaced regularly, the sanitary condition is effectively guaranteed, and the disease occurrence probability of the free-range chickens is reduced.

This invention discloses an automated chicken farming workshop, relating to the field of chicken farming technology. It includes workshop walls with doors and windows on the front side, and a chicken farming frame installed inside the walls. Multiple sets of chicken cages are vertically arranged and fixed within the chicken farming frame. Support legs are provided at the bottom of the chicken farming frame for auxiliary support. A water supply component is also included, mounted on the chicken farming frame. In the automated farming operation using this invention, the water supply component, feeding component, and feed collection component work together to achieve automated feeding, watering, and centralized egg collection during the chicken farming process. During feeding, a leveling component evenly distributes the pre-placed feed in the feeding trough, ensuring that all chickens in the cages have equal feeding space and feed amount, fundamentally reducing differences in group growth and improving the overall quality of the farming batch.

The invention provides application of an FZD4 gene. The FZD4 gene is used for regulating osteogenic differentiation and mineralization of chicken bone marrow mesenchymal stem cells. The FZD4 gene in the chicken bone marrow mesenchymal stem cells is over-expressed and is used for promoting osteogenic differentiation and mineralization of the chicken bone marrow mesenchymal stem cells; or / and the FZD4 gene in the chicken bone marrow mesenchymal stem cells is knocked down to inhibit osteogenic differentiation and mineralization of the chicken bone marrow mesenchymal stem cells; the nucleotide sequence of the coding region of the FZD4 gene is as shown in SEQ ID NO. 1. According to the invention, the positive regulation effect of the FZD4 gene in osteogenic differentiation of chicken bone marrow mesenchymal stem cells is determined for the first time, the blank of a bone regulation mechanism of the poultry FZD4 gene is filled, and a new biological preparation target is provided for prevention and treatment of poultry bone diseases; the FZD4 gene can also be used as a molecular marker for breeding chicken varieties with high bone strength.

The invention discloses a molecular marker related to chicken leg muscle weight character and application thereof, and belongs to the technical field of poultry breeding. The SNP site of the molecular marker is located at the 4165354 basic group of a chicken genome 21 chromosome, and the site has A / T mutation; and the login number of the chicken genome in an Ensible database is GRCg6aresease95, and the login number of the chicken genome in the Ensible database is GRCg6aresease95. The genotypes of the molecular marker are AA, TT and AT. The chicken leg muscle weight is used as an important index of carcass development, and the higher leg muscle weight shows that the carcass development of the chicken is better, so that the breeding efficiency can be improved and the chicken variety with excellent leg muscle weight character can be quickly selected by selecting the genotype with the leg muscle weight TT in chicken leg muscle weight character breeding. Theoretical support is provided for breeding chicken varieties related to the leg muscle weight character.

This utility model relates to the field of poultry farming technology and discloses an automatically cleaning chicken feed trough, including a fixed base. A cleaning component is provided at the middle of the fixed base, and the cleaning component includes a feed trough located at the middle of the fixed base. The feed trough has a water trough and a feed trough arranged sequentially from the inside to the outside. A rotating rod is located at the middle of the upper end of the feed trough. When a first motor is started, the mounting rod drives a cleaning plate to rotate circumferentially along the inner walls of the water trough and feed trough. Because the cleaning plate is in contact with the inner walls of the water trough and feed trough, it can clean these surfaces. When the cleaning plate passes the upper end of the discharge port, residual feed and debris in the feed trough fall out through the discharge port, thus automatically cleaning the feed trough without manual intervention, reducing worker workload and increasing cleaning efficiency.

The utility model discloses a feed mixing mechanism of a chicken feeding trough, and relates to the technical field of chicken raising equipment, the feed mixing mechanism comprises a feed trough, a feed mixing roller is rotatably clamped in the feed trough, one end of the feed mixing roller is fixedly connected with a first transmission belt pulley, the top end of the feed trough is fixedly communicated with a feeding pipe, and the top end of the feeding pipe is fixedly connected with a second transmission belt pulley. And the other end of the feeding pipe fixedly communicates with a crushing groove, a crushing roller is rotationally clamped in the crushing groove, and one end of the crushing roller is fixedly connected with a second transmission belt wheel. Vegetable leaves in the crushing groove are crushed by driving the crushing roller, the crushed vegetable leaves fall into the feed groove through the feeding pipe, and meanwhile, when the crushing roller rotates, a second transmission belt wheel at one end of the crushing roller drives a stirring roller to rotate under the transmission of a first belt, so that the stirring roller is driven to rotate; and the feed in the feed trough and the crushed vegetable leaves are mixed and stirred by the stirring roller, so that the chicken can eat the mixed feed which is uniformly mixed and contains the vegetables.

The application discloses a kind of composite plant essential oil for killing free-range chicken chicken skin acarid and application.The composite plant essential oil is composed of patchouli oil and clove basil oil, and the weight ratio of patchouli oil and clove basil oil is 3:1, there is significant synergistic effect between components, compared with using only one of them, its prevention and cure free-range chicken chicken skin acarid effect is more significant.The application utilizes chicken sand bath behavior, and the composite plant essential oil is mixed in sand, when chicken sand bath in sand pit, plant essential oil is attached to the fur and skin of chicken, the effect of killing body surface chicken skin acarid is achieved, the growth of free-range chicken and the recovery of egg production capacity are promoted, compared with prior art, the plant essential oil has the advantages of safety, environmental protection, no toxic side effects, simple preparation and wide application prospect.

The utility model discloses a chicken raising device convenient to collect eggs, relates to the chicken poultry breeding technical field, including connecting base plate, connecting base plate outer wall upper side left-right symmetry fixed installation support pillar, two support pillar outer wall upper end fixed installation support plate, support plate outer wall upper part is provided with rotatable chicken coop, the upper part of support plate outer wall is provided with the chicken coop, the support pillar outer wall upper part is provided with the support plate outer wall upper part, the support plate outer wall upper part is provided with the support plate outer wall upper part, the support plate outer wall upper part is provided with the support plate outer wall upper part. An egg falling frame is fixedly installed at the rear end of the outer wall of the coop, an egg outlet communicated with the egg falling frame is formed in the lower end of the rear side of the outer wall of the coop, and after chickens lay eggs, the device drives the coop and the egg falling frame to rotate upwards around the rotating frame by starting an electric telescopic rod, the eggs in the coop are discharged into the egg falling frame from the egg outlet, and therefore the eggs in the coop are discharged into the egg falling frame. When eggs enter the egg falling frame and then fall into the egg collecting frame below the egg falling frame to be collected, a worker can regularly pull the egg collecting frame to take out the egg collecting frame and take out the eggs in the egg collecting frame, and therefore the worker does not need to open the coop to find the eggs in the coop to take out the eggs, and the use convenience of the device is improved.

The utility model discloses chicken raising house ventilation equipment, and relates to the technical field of chicken raising house ventilation equipment, the chicken raising house ventilation equipment comprises a processing shell, the upper end of the processing shell is fixedly connected with an exhaust pipe, the left side of the processing shell is fixedly connected with an air inlet pipe, the lower end of the processing shell is fixedly connected with a motor, and the output end of the motor is fixedly connected with a rectangular rod; a conical block is slidably connected to the rod wall of the rectangular rod, a spring is arranged at the lower end of the conical block, a blade is arranged at the upper end of the rectangular rod, a first convex block is fixedly connected to the upper end of the conical block, rod pieces are fixedly connected to the interiors of the two sides of the treatment shell, and second convex blocks are fixedly connected to the lower ends of the rod pieces. When the deodorization device works, the conical block rotates while exhausting is carried out, and meanwhile, the conical block can continuously move up and down, so that gas entering the treatment shell can generate turbulent flow with certain strength, the gas can be in better contact with deodorization liquid, and the deodorization effect can be further improved.

The invention discloses a molecular marker related to chicken shank length character and application thereof, and belongs to the technical field of poultry breeding. The method comprises the following steps: selecting 505 spotted-brown chickens as experimental subjects for whole genome association analysis, collecting shin length characters, collecting subwing blood when the spotted-brown chickens are 77 days old, extracting genome DNA, detecting the integrity, purity and concentration of the extracted genome DNA, re-sequencing qualified samples, then performing whole genome association analysis on the shin length characters, and detecting 458 SNPs significantly associated with the shin length. A part of SNP sites and the shin length character are verified and analyzed, and a theoretical support is provided for breeding chicken varieties related to the shin length character.

The invention discloses a molecular marker related to chicken breast muscle weight character and application thereof, and belongs to the technical field of poultry breeding. The SNP site of the molecular marker is located at the 15953853th basic group of a chicken genome 13 chromosome, and G / A mutation exists at the SNP site; and the login number of the chicken genome in an Ensible database is GRCg6aresease95, and the login number of the chicken genome in the Ensible database is GRCg6aresease95. The method comprises the following steps: selecting 505 spotted-brown chickens as experimental subjects for whole genome association analysis, collecting pectoral muscle weight traits, and performing whole genome association analysis on the pectoral muscle weight traits to detect 747 SNPs (Single Nucleotide Polymorphisms) remarkably associated with pectoral muscle weight. And verification analysis is carried out on part of SNP loci and the pectoral muscle weight character, and the molecular marker provided by the invention is finally screened out, so that theoretical support is provided for breeding chicken varieties related to the pectoral muscle weight character.

The utility model relates to the technical field of chicken farm disinfection equipment, and discloses a chicken raising disinfection spraying device which comprises a bottom plate, a rotating shaft is rotatably connected to the outer wall of the top of the bottom plate through a bearing, a rotating pipe is fixedly connected to the top end of the rotating shaft, a transverse pipe is fixedly connected to the outer wall of the top end of the rotating pipe, and a plurality of nozzles are arranged on the outer wall of the transverse pipe. According to the device, the universal wheels are arranged, so that the device can be conveniently moved for disinfection operation, workers do not need to carry the sprayer on the back for a long time to walk, the labor intensity of the workers is greatly reduced, meanwhile, the working efficiency is improved, and meanwhile, the working efficiency is improved. Large-area spraying can be rapidly carried out through cooperation of the suction pump and the multiple nozzles, and the disinfection work efficiency is improved.

Stereoscopic laying hen welfare breeding equipment with a manure cleaning function at the bottom comprises a cage net cage frame, a front-back driving and manure cleaning system, a feeding system, an egg collecting system and a side wall chicken outlet door system which are arranged in a chicken coop, the cage net cage frame is located in the middle of the whole chicken coop and comprises a cage frame, cage nets, a water line, a lamp line and an inhabiting frame, and multiple layers of cage nets are fixed in the cage frame; the feeding system comprises a chain type stockline, a material box, a power head and a corner wheel, and the chain type stockline is fixed to the first layer, the third layer and the fourth layer of the cage frame; the egg collecting system is located on the second layer of the cage frame and comprises a vertical egg collecting machine, a plant area egg collecting system, a head-tail frame, an egg laying box, an egg belt, a support and a chicken driving system. The side wall chicken outlet door system comprises a chicken outlet door and a lifting system driving the chicken outlet door to be opened and closed. The chicken outlet door is arranged on the side wall of the henhouse and can be opened and closed in a timing mode, the sand bath area and the outdoor activity area are arranged on the outer side of the henhouse, chickens can conveniently release the nature, the use space is enlarged through the multi-layer design, the number of raised chickens is increased, cost is reduced, and the henhouse is suitable for application and popularization.

The application belongs to the technical field of feeding devices, in particular to a breeding chicken house double-bin mixed feeding device and a feeding method, which comprises a chicken house, a mixing assembly and a feeding assembly; the mixing assembly comprises a mounting plate; the mounting plate is fixedly connected with a mixing cylinder on the surface; a pair of feed bins are fixedly connected to the top of the mixing cylinder; the feeding assembly comprises a distribution box; the mixing cylinder and the distribution box are communicated through a discharge channel; a feed trough is fixedly connected to the inner side of the chicken house; a feed conveying channel is connected between the distribution box and the feed trough. Two kinds of feed are respectively stored in the two feed bins, the feed can enter the mixing cylinder through the connecting groove, and then the two kinds of feed are stirred by the stirrer, and then the feed enters the distribution box through the discharge channel and is guided into the feed trough through the feed conveying channel for the laying hens to eat, the application is convenient to operate, can mix different feeds, realizes automatic feeding, and is beneficial to improving the breeding efficiency of laying hens.

The application discloses an intelligent inspection management system and method for large-scale chicken breeding, and relates to the technical field of breeding management. In the process of artificial one-by-one inspection of chicken flocks, the inspection results of each type are recorded, and the high-spectrum image of the tail feather of the chicken and the call recording of the chicken are synchronously collected; the high-spectrum image features of the tail feather of the chicken and the audio features of the call recording of the chicken under the inspection results of each type are classified and extracted; the correlation calculation is performed, and the high-spectrum image feature range of the tail feather and the audio feature range of the call recording corresponding to the inspection results of each type are classified; the high-spectrum image of the tail feather and the call recording of the chicken in the breeding farm are batch-collected and the features are extracted, the high-spectrum image feature range of the tail feather and the audio feature range of the call recording corresponding to the inspection results of each type are compared, and the inspection results of the chicken are batch-obtained. The application realizes batch intelligent detection management of the chicken for large-scale breeding.

The utility model discloses a chicken breeding manger feeder which comprises a material storage hopper and a material distribution barrel, the material distribution barrel is a cylindrical cavity with one end open, the material storage hopper is fixedly connected to the upper portion of the material distribution barrel, a cover plate is hinged to the upper portion of the material storage hopper, the chicken breeding manger feeder further comprises a pre-storage pipe, a feeding mechanism and a quantitative feeding mechanism, and the pre-storage pipe is fixedly connected to the bottom of the material distribution barrel. The feeding mechanism is rotationally arranged in the material distributing barrel and used for pushing feed to transversely move and enabling the feed to be fully distributed in the pre-storage pipe, and the quantitative feeding mechanism is movably connected to the bottom wall of the material distributing barrel, slidably adjusted in the height direction of the pre-storage pipe and used for quantitative feeding and opening and closing control of the pre-storage pipe. The utility model belongs to the technical field of poultry breeding, and particularly relates to a feeder for a chicken breeding trough, which is used for feeding a large-density cage-rearing chicken trough, is convenient for manually-controlled quantitative feed supplement and reduces the influence on chickens in the feed supplement process.

This invention discloses a molecular marker associated with the chicken shank length trait and its application, belonging to the field of poultry breeding technology. This invention selected 505 Ma Huang chickens as experimental subjects for genome-wide association analysis (GWAS). Shank length trait data were collected, and blood samples were collected from under the wings at 77 days of age to extract genomic DNA. The integrity, purity, and concentration of the extracted genomic DNA were tested. Qualified samples were resequencing, and then GWAS was performed on the shank length trait, detecting 458 SNPs significantly associated with shank length. Further validation analysis was conducted on some of these SNP sites and their association with the shank length trait, providing theoretical support for breeding chicken breeds associated with the shank length trait.

The utility model discloses a chicken manure treatment equipment control system which is characterized by comprising a slope bin, a slope is arranged at the bottom of the slope bin, fences for raising chickens are fixedly installed on the periphery of the top of the slope bin, and a manure leakage plate is laid on the top of the slope bin; the self-cleaning assembly is installed in the slope bin and located on the higher side of the slope, and the self-cleaning assembly comprises a rotatable spray pipe and a spray head installed on the outer wall of the spray pipe; the manure collecting bin is located at the bottom of the slope bin, and relates to the technical field of chicken manure treatment equipment, dead-corner-free washing is conducted on the interior of the slope bin by arranging a self-cleaning assembly through a nozzle with the angle capable of being adjusted in a rotating mode, and meanwhile under the action of the slope of a slope, chicken manure can be discharged into the manure collecting bin through a discharging pipe under the action of gravity; the chicken manure can be conveniently collected and used as farmyard manure, the chicken manure can be conveniently and reasonably utilized, and the energy-saving and environment-friendly effects of equipment use are improved.

The invention discloses a broiler chicken breeding precise feeding system which comprises a coop placing frame and further comprises separated chicken raising cages and a feeding barrel, the multiple separated chicken raising cages are arranged on the coop placing frame, the interior of each separated chicken raising cage is divided into multiple chicken raising areas, and each chicken raising area corresponds to a single broiler chicken; the middle of the separated chicken raising cage is fixedly connected with a feeding cylinder, the feeding cylinder is communicated with the multiple chicken raising areas, a water supply assembly for the multiple chicken raising areas is arranged between the feeding cylinder and the separated chicken raising cage, a plurality of quantitative feeding assemblies are arranged in the feeding cylinder, and the quantitative feeding assemblies correspond to the chicken raising areas in a one-to-one mode. A broiler positioning assembly is arranged at the bottom of the feeding cylinder, so that after the broiler moves to one side of the feeding cylinder, the quantitative feeding assembly feeds the broiler with feed. The broiler feeding device is used for solving the problem that in the feeding process of broilers in the prior art, it is difficult to keep enough feeding accuracy in the feeding process of each broiler.

The utility model relates to a welfare cage laying hen house which is characterized in that the welfare cage laying hen house comprises a ground activity area (3), a plurality of activity platforms and a plurality of laying platforms which form at least two layer structures, one layer structure is formed by overlapping the plurality of activity platforms, and the other layer structure is formed by overlapping one or more activity platforms and one or more laying platforms. Or the egg laying platform is formed by stacking a plurality of egg laying platforms; a vertical crossing activity space exists between the two layer structures, and the two layer structures are located on the ground activity area (3) to form a U shape. The laying hens can freely move on any platform between the two layer structures. On the premise that a larger activity space is provided for laying hens, the space height of the henhouse is utilized, a crossed three-dimensional inhabiting platform is provided, the number of the laying hens in unit volume is increased, and the chicken raising cost is reduced.

The auxiliary feed box comprises auxiliary feeding equipment, a feed box adjusting frame is installed on the auxiliary feeding equipment, a feed box is arranged in the auxiliary feeding equipment, an even number of height adjusting columns are installed on the feed box, a feeding cover is installed on the feed box, a box body is arranged in the feed box, and supporting plates are fixed to the two sides of the outer wall of the box body. A side clamping rod sleeve is arranged below the supporting plate, a box upper sleeve cover frame is nested on the periphery of an upper opening of the box body, and a feed supply device is connected to the bottom of the box body; a box inner cavity is formed in the box body, and a material guiding device is installed in the box inner cavity. The auxiliary feeding equipment is installed at the middle section position in the farm and is matched with the total feed box to form a concentric-square-shaped state, when the total feed box is used for front-end feeding, the auxiliary feeding equipment synchronously supplies for the subsequent process, and then the subsequent process completes material tray supplementing; therefore, the problems of stress, mutual pecking, treading and the like caused by the fact that breeding hens at the rear part cannot obtain feed while the feed is supplied by the feed line at the front part are avoided, and the feed on the feed line is synchronously supplemented.

The invention discloses a chicken raising feed feeding device, and particularly relates to the technical field of feeding devices, the chicken raising feed feeding device comprises a feeding basin and a water feeding basin, the feeding basin is welded to one side of the water feeding basin, the feeding basin and the water feeding basin are both made of stainless steel metal materials, and the feeding basin and the water feeding basin are provided with the same control module; the control module comprises a master controller, the output end of the master controller is connected with a WiFi module, the output end of the WiFi module is connected with a mobile phone end, and the connecting end of the master controller is connected with a feeding controller. By arranging the control module, not only can feed be provided, but also water can be provided, in the chicken raising process, a water feeding device does not need to be independently arranged, then when water and feed are insufficient, a worker can be prompted to add water, the problem of water freezing can be solved, it is guaranteed that chickens can normally eat feed and drink water, and the chicken raising efficiency is improved. Therefore, healthy growth of the chickens is guaranteed, and the practical use effect of the chicken feed is good.

The utility model discloses a foodstuff basin for raising chickens, which relates to the technical field of foodstuff basins and comprises a base plate, a feeding cylinder is arranged in the middle of the top surface of the base plate, a frustum is arranged in the feeding cylinder, a plurality of discharging ports are arranged at the bottom end of the feeding cylinder along the axial side at equal intervals, and a fixing ring is arranged on the peripheral side of the top surface of the base plate. Through cooperation of the base plate and the discharging barrel, fodder can be conveniently placed in a concentrated mode, the accuracy of fodder feeding is improved, and then the function of orderly feeding can be achieved; through cooperation of a frustum in the feeding barrel and a discharging port, scattered discharging is facilitated, discharging uniformity is improved, then the function of enabling chickens to eat evenly is achieved, by means of cooperation of a fixing ring, a lantern ring and a separation rod, a stable separation structure is conveniently constructed, the separation effect is improved, and then the function of dividing the feeding space of the chickens is achieved; finally, the problems that feed of an existing chicken raising feed basin is directly poured and accumulated at one position, chicken flocks eat feed unevenly, and weak and small individuals eat feed difficultly are solved.

The utility model discloses a multi-layer three-dimensional automatic water feeding chicken raising equipment relates to chicken raising field, including water feeding trough, liquid inlet pipe and rubbing subassembly, the number of water feeding trough is three, among the three water feeding trough is fixedly connected support connecting rod, and one side above water feeding trough is provided with liquid storage tank, and the rubbing subassembly is provided with the liquid storage tank. A stirring assembly is arranged in the liquid storage tank, and the liquid inlet pipe is fixedly connected to one side of the top of the liquid storage tank. According to the multi-layer three-dimensional automatic water feeding and chicken raising equipment, by arranging the stirring assembly and the rubbing assembly, in the using process of the automatic water feeding and chicken raising equipment, the purpose of feeding various liquid during chicken raising is achieved, mixed liquid can be fully stirred conveniently, the situation that the effect is affected due to uneven mixing of the mixed liquid is avoided, and the practicability is high. And meanwhile, impurities deposited at the bottom of the water feeding tank are scratched and cleaned, so that the purity of liquid is guaranteed to a certain extent, the situation that water drinking of chickens is affected by more deposited impurities is avoided, and workers can conveniently use the automatic water feeding chicken raising equipment.

This utility model relates to the field of chicken farming equipment technology, and more particularly to a feeding device. It includes a feed storage hopper with an open top. Multiple threaded pipes are provided at the bottom of the feed storage hopper, communicating with an internal cavity. A feeder is connected to each threaded pipe. The feeder includes a cylindrical body connected to the threaded pipes. A feed hopper is located inside the cylindrical body, with a feed pipe at the lower part of the feed hopper. A receiving basin is also provided inside the cylindrical body, located below the feed hopper. The lower end of the feed pipe is higher than the top of the receiving basin. A feeding inlet is provided on one side of the cylindrical body. This utility model eliminates the need for daily feed addition, saving time and effort.

The invention relates to the technical field of animal breeding, in particular to a structural variation molecular marker related to chicken feed conversion rate characters and application thereof. The molecular marker is located at the 3891127 site of the 23rd chromosome of the chicken, and the polymorphism of the molecular marker is G or GCTGTGGTTCCTCTGCCCCAGCGTGGCACATGGAGCTGTGTCCACAGGTGATCTTCCC. The molecular marker can be used for identifying the chicken disease, the chicken disease, the chicken disease and the chicken disease. A structural variation molecular marker chr233891127SV related to the chicken feed conversion rate is obtained through research and screening, and the feed conversion rate of a corresponding individual chicken can be reflected by detecting the genotype of the molecular marker. The molecular marker provided by the invention can be used for breeding chicken varieties with high feed conversion rate, and has important application value.

The invention relates to the technical field of livestock and poultry breeding feed, and discloses a breeding mixed feed additive formula and a feeding method. The additive is prepared from core nutrient components (calcium sulfate, methionine and lysine), immunity enhancing components (astragalus polysaccharide, eucommia ulmoides extract and probiotic compound preparation), digestion promoting components (amylase, phytase and fructo-oligosaccharide) and flavor improving components (pericarp residue compound) according to a specific weight part ratio. The feeding method combines physiological characteristics of 1-4 week old chicks, 5-16 week old bred chickens and laying hens / broiler chickens in the fattening stage, and the mixing proportion, the feeding amount and the feeding frequency are adjusted in a targeted mode. The technical defects that an existing feed additive is single in nutrition, poor in immunity enhancement effect, insufficient in meat quality improvement and unscientific in feeding are overcome, balanced nutrition supply, immunity enhancement, chicken flavor optimization and feed utilization rate improvement of chickens are achieved, and the chicken raising industry is promoted to develop towards the efficient, high-quality and green direction.