Kit for detecting fusarium oxysporum of cowpea fusarium wilt and application

Abstract

The invention belongs to the technical field of modern agriculture, and particularly relates to a kit for detecting fusarium oxysporum of cowpea fusarium wilt and application. A specific genome sequence for detecting fusarium oxysporum is obtained through analysis, the sequence is never reported in the technical field of detection, and specific detection of fusarium oxysporum of cowpea fusarium wilt can be achieved. Furthermore, a method for detecting fusarium oxysporum based on RPA-CRIPSR / RPA fluorescence is designed on the basis of the specific sequence, the method is high in specificity, no cross reaction exists between the fusarium oxysporum and other fungi and phytophthora, the sensitivity is 10 pg / mu L, and a detection result can be obtained within 30 min as soon as possible. The method solves the problem that a PCR instrument is lacked for on-site rapid detection, the result can be observed through naked eyes excited by blue light, the operation process is simple and rapid, and the method is very suitable for being applied to rapid detection of field samples.

Description

Technical Field

[0001] The invention belongs to the technical field of modern agriculture, and particularly relates to a kit for detecting Fusarium oxysporum causing cowpea wilt disease and an application thereof. Background Art

[0002] Fusarium oxysporum F.oxysporum ) is a soil-borne pathogenic fungus with a worldwide distribution and a wide host range. It can cause more than 100 plant wilt diseases such as melons, Solanaceae, bananas, cotton, legumes and flowers. Fusarium oxysporum is an important pathogen that causes cowpea wilt. It has a large range of activities and strong survival ability. Cowpeas from seedlings to adult plants can be attacked by Fusarium oxysporum. When the disease is serious, the loss can be as high as 70%, causing great economic losses to the cowpea industry. So far, the detection and diagnosis of this disease are mainly symptom diagnosis and pathogen isolation and identification. Traditional pathogen detection methods are cumbersome and time-consuming, and detailed classification information of pathogens must be available. They cannot meet the requirements of rapid, sensitive and stable detection in disease control. Therefore, it is crucial to establish a rapid and effective detection method to detect bacteria-carrying plants in a timely manner to control the occurrence and prevalence of diseases and reduce crop yield losses.

[0003] At present, traditional morphological identification methods require separation and purification. Since the pathogen grows slowly and is often accompanied by complex infection with other pathogens, separation and purification are difficult, identification takes a long time, and is not suitable for rapid detection and low-cost identification. Molecular detection methods such as ordinary PCR, loop-mediated isothermal amplification (LAMP), and recombinase polymerase isothermal amplification (RPA) have been used for the detection and identification of fungal pathogens. However, PCR-based molecular detection methods usually require a circulating heater and are not suitable for rapid field detection. LAMP usually needs to react at around 60°C, the primer design is complex, and the false positive rate is high.

[0004] In the prior art, there are literature reports (Matthews MC, van der Linden J, Robène I, Rozsasi S, Coetzee B, Campa M, Burger J, Akwuruoha UN, Madufor NJ, Perold W, Opara UL, Viljoen A, Mostert D. A combined recombinase polymeraseamplification CRISPR / Cas12a assay for detection of Fusarium oxysporum f. sp.cubense tropical race 4. Sci Rep. 2025 Jan 19;15(1):2436. doi: 10.1038 / s41598-025-85633-8. PMID: 39828694; PMCID: PMC11743600.): For the soil-borne pathogen Fusarium oxysporum Cuban tropical race 4 (FocTR4), the non-coding region sequence can be detected by RPA / CRISPR-Cas12a. However, since the non-coding region sequence contains a large number of repetitive sequences (such as transposable elements, microsatellite sequences) and low-complexity regions (such as AT-rich regions), these regions are prone to dynamic mutations (such as repeat amplification) or structural variations, and its detection specificity is not high.

[0005] Therefore, it is necessary to develop a method for rapid detection in the field with high sensitivity and low cost for the coding region sequence of Fusarium oxysporum. Summary of the invention

[0006] The purpose of the first aspect of the present invention is to provide a reagent for detecting Fusarium oxysporum causing cowpea wilt disease.

[0007] The second aspect of the present invention aims to provide a kit for detecting Fusarium oxysporum causing cowpea wilt disease.

[0008] The third aspect of the present invention aims to provide an application.

[0009] The purpose of the fourth aspect of the present invention is to provide a method for detecting Fusarium oxysporum of cowpea wilt based on RPA combined with CRISPR / Cas12a.

[0010] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is: A first aspect of the present invention provides a reagent for detecting Fusarium oxysporum, wherein the reagent comprises a primer pair for detecting crRNA of Fusarium oxysporum and / or a Fusarium oxysporum genome.

[0011] In some embodiments of the present invention, the primer pair is RPA-F / RPA-R, and the nucleotide sequence is as follows: RPA-F:5′-ATTATCGGGGTTCGCAACTGACTATGAGAC-3′ (SEQ ID NO: 2); RPA-R: 5′-TGGTTGATAGTCGCCTATAAACTTGCGATC-3′ (SEQ ID NO: 3).

[0012] In some embodiments of the present invention, the nucleotide sequence of the crRNA is 5′-UAAUUUCUACUAAGUGUAGAUGAAUCGCUCACAGAUGGACA-3′ (SEQ ID NO: 4).

[0013] In some embodiments of the present invention, the primer pair and crRNA are designed based on >lcl|CP052043.1_cds_QKD56343.1_9601. This specific genome sequence has never been reported in the field of Fusarium oxysporum detection technology.

[0014] The second aspect of the present invention provides a kit for detecting Fusarium oxysporum, comprising the reagent described in the first aspect of the present invention.

[0015] In some embodiments of the present invention, the kit further comprises a Cas12a protein and / or a signal reporter probe.

[0016] In some embodiments of the present invention, the Cas12a protein is selected from at least one of AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, and LbCas12a, preferably LbCas12a protein.

[0017] In some embodiments of the present invention, the signal reporter probe is ssDNA, and a fluorescent group and a quenching group are modified at both ends respectively.

[0018] In some embodiments of the present invention, the signal reporter probe ssDNA nucleic acid sequence is 5′-CCACCC-3′.

[0019] In some embodiments of the present invention, the fluorescent group is at least one of FAM, ROX, CY5, HEX, HTX, VIC, and TAMRA, preferably FAM.

[0020] In some embodiments of the present invention, the quenching group is at least one of BHQ1, BHQ2, and BHQ3, preferably BHQ1.

[0021] In some embodiments of the present invention, the kit further comprises a negative control and a positive control.

[0022] In some embodiments of the present invention, the kit further comprises an RPA reaction solution and a CRISPR-Cas12a buffer.

[0023] In some embodiments of the present invention, the CRISPR-Cas12a buffer is 10×NEBuffer 2.1.

[0024] The third aspect of the present invention provides the use of the reagent of the first aspect of the present invention and / or the kit of the second aspect of the present invention in any one of 1) to 2): 1) Detection of Fusarium oxysporum f. sp. vignae; 2) Preparation of a product for detecting Fusarium oxysporum f. sp. vignae.

[0025] The fourth aspect of the present invention provides a method for detecting Fusarium oxysporum f. sp. vignae based on RPA combined with CRISPR / Cas12a, comprising the steps of using the reagent of the first aspect of the present invention and / or the kit of the second aspect of the present invention.

[0026] In some embodiments of the present invention, the detection method specifically comprises the following steps: 1) Extract DNA from the sample to be tested; 2) Perform RPA amplification on the DNA extracted in step 1) using the primer pair described in the first aspect of the present invention to obtain an RPA product; 3) Mix and react the RPA product in step 2) with the crRNA described in the first aspect of the present invention, the ssDNA fluorescent probe described in the second aspect of the present invention, and the Cas12a protein, and read the detection signal; 4) Determine whether Fusarium oxysporum f. sp. vignae exists in the sample to be tested according to the detection signal.

[0027] In some embodiments of the present invention, the amplification temperature of the RPA is 37 - 42°C.

[0028] In some embodiments of the present invention, the amplification time of the RPA is 5 - 30 min.

[0029] In some embodiments of the present invention, the concentration of the crRNA is 100 - 800 nM.

[0030] In some embodiments of the present invention, the concentration of the Cas12a protein is 100~800nM.

[0031] In some embodiments of the present invention, the final concentration of the ssDNA fluorescent probe is 20-200 μM.

[0032] Specifically, the method comprises the following steps: (1) The RPA reaction system and the genomic DNA to be tested are mixed evenly and added to the bottom of the reaction tube. The CRISPR / Cas12a system is added to the tube cover of the same reaction tube without affecting each other. Then, the bottom of the reaction tube is placed in a constant temperature amplification device for RPA amplification of the target fragment; the target fragment includes a nucleotide sequence as shown in SEQ ID NO: 1.

[0033] (2) After the RPA reaction system is amplified, add the CRISPR / Cas12a system on the tube cap to the bottom of the tube and mix evenly with the RPA amplification system.

[0034] (3) Performing visual detection of the fluorescence intensity of the reaction system solution in step (2).

[0035] If the reaction tube emits fluorescence, it indicates that Fusarium oxysporum of cowpea wilt disease exists in the sample to be tested; if the reaction tube does not emit fluorescence, it indicates that Fusarium oxysporum of cowpea wilt disease does not exist in the sample to be tested.

[0036] In some embodiments of the present invention, the specific operation of performing fluorescence intensity visualization detection on the reaction system solution in step (2) is: Place the RPA solution system at the bottom of the reaction tube in a constant temperature device at 38°C for 15 minutes, then centrifuge the CRISPR / Cas12a reaction solution on the tube cap to the bottom of the tube and continue to react for 30 minutes, collecting FAM fluorescence every 30 seconds; or after reacting in a constant temperature device at 38°C for 30 minutes, observe the reaction tube with the naked eye to see if fluorescence appears under blue light.

[0037] The beneficial effects of the present invention are: 1. The present invention runs Orthofinder to cluster analyze the protein sequences of Fusarium oxysporum and Fusarium equisetum, Fusarium graminearum, Fusarium graminearum, Phytophthora vulgaris, Phytophthora nicotianae, etc., screen out the specific protein sequence of Fusarium oxysporum, correspond the protein sequence to its genome sequence one by one, and then put the specific genome sequence >lcl|CP052043.1_cds_QKD56343.1_9601 into NCBI and Fungi DB for blast comparison and verification to obtain the specific genome sequence. The specific genome sequence has never been reported in the field of detection technology. The discovery of the sequence realizes the specific detection of Fusarium oxysporum causing cowpea wilt.

[0038] 2. The reagent of the present invention contains an RPA primer pair and crRNA, which can amplify the nucleic acid signal of Fusarium oxysporum under the RPA amplification technology, which is fast and highly specific; the crRNA can form a complementary double strand with the gene specificity of Fusarium oxysporum, and there is no cross reaction with other fungi and Phytophthora, thereby improving the specificity for Fusarium oxysporum.

[0039] 3. The present invention designs crRNA based on the Fusarium oxysporum specific sequence>lcl|CP052043.1_cds_QKD56343.1_9601. The crRNA can form a complementary double strand with the target genomic DNA and there must be a PAM sequence nearby, which ensures that the crRNA can specifically target the target area and reduce the probability of off-target. The optimal RPA primer pair is screened and designed according to the binding site of the crRNA to achieve specific target gene amplification, to activate Cas12a for cis-cutting and then trans-cutting, to establish a method that can be used for visual detection of Fusarium oxysporum, and to optimize the RPA / CRISPR-Cas12a system, and to evaluate the specificity and sensitivity. The results show that the method has good specificity for detecting Fusarium oxysporum, without cross-contamination with the control strain, with a sensitivity of 10pg / μL, and the detection result can be obtained within 30min at the fastest.

[0040] 4. The present invention does not need to be opened during implementation. The RPA amplification solution and the Cas12a system are mixed and directly placed in a constant temperature device for reaction, thereby reducing aerosol contamination and false positive results caused by opening the cover.

[0041] 5. The present invention combines RPA-specific amplification with crRNA-specific sequence identification to make the enhanced Cas12a detection more specific; and the detection is carried out at 38°C, which solves the problem of lack of PCR instruments for rapid on-site detection. At the same time, the results can be observed by naked eyes through blue light stimulation. This method does not require expensive and large-scale instruments and equipment, has a simple and fast operation process, strong sensitivity and specificity, and is very suitable for rapid detection of field samples.

[0042] In summary, the method of detecting Fusarium oxysporum based on RPA-CRIPSR / RPA fluorescence has better sensitivity than isolation and culture, and the detection time is greatly shortened, and the detection can be completed within 30 minutes at the fastest. The method provided by the present invention has the advantages of simplicity, less time consumption, high sensitivity and strong specificity. The whole process is carried out at 38°C, the equipment requirements are relatively low, and it is easy to be widely carried out at the customs port for on-site detection, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 Optimization results for crRNA and cas12a reaction concentrations (800nM:800nM, 700nM:700nM, 600nM:600nM, 500nM:500nM).

[0044] Figure 2 Optimization results for crRNA and cas12a reaction concentrations (400nM:400nM, 300nM:300nM, 200nM:200nM, 100nM:100nM).

[0045] Figure 3 Optimize results for RPA response time.

[0046] Figure 4 Results for RPA reaction temperature optimization.

[0047] Figure 5 These are the results of three repeated specific detections of RPA / CRISPR-Cas12a; A is the fluorescence value of the amplification of the RPA-Cas12a system; B is the visualization result of RPA-Cas12a under two kinds of light (blue light and ultraviolet light). In the figure, 1 to 13 represent: 1 Fusarium oxysporum, 2 Fusarium equisetum, 3 Fusarium ovale, 4 Fusarium solani, 5 Fusarium graminearum, 6 Fusarium solani, 7 Fusarium ovale, 8 Fusarium multifilamentum, 9 Magnaporthe grisea, 10 Phytophthora vulgaris, 11 Phytophthora nicotianae, 12 Cowpea plants, and 13 negative control.

[0048] Figure 6 It is the sensitivity detection of RPA combined with CRISPR / Cas12a; A is the fluorescence curve of RPA / Cas12a amplification; B is the visualization result of RPA / Cas12a under two kinds of light; the concentration gradients of each reaction are: 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, NC: Negative control.

[0049] Figure 7 This is a schematic diagram of treating cowpea seedlings with spore suspension of Fusarium oxysporum using the root immersion method, showing the infection of cowpea seedlings with Fusarium oxysporum at different time points.

[0050] Figure 8The results of testing different parts of cowpea seedlings infected with Fusarium oxysporum on the 6th day, where A is the test sample picture, and the parts where cowpea samples were extracted are leaves, stems, and roots; B is the fluorescence curve result of RPA combined with CRISPR / Cas12a amplification; C is the visualization detection result of RPA combined with CRISPR / Cas12a under two irradiation lights, "leaf" is the detection result of the leaf part of the diseased cowpea seedling, "stem" is the detection result of the middle part of the stem of the diseased cowpea seedling, "root" is the detection result of the root part of the diseased cowpea seedling, "Fo" represents the positive control with the genomic DNA of Fusarium oxysporum causing cowpea wilt as the template, and "NC" is the negative control. DETAILED DESCRIPTION

[0051] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0052] Example 1 Design of RPA-specific amplification primer pairs and crRNA guide sequences The present invention runs Orthofinder to perform cluster analysis on protein sequences of Fusarium oxysporum, Fusarium equisetum, Fusarium graminearum, Fusarium graminearum, Phytophthora cowpea, Phytophthora nicotianae, etc., screens out the specific protein sequence of Fusarium oxysporum, corresponds the protein sequence to its genome sequence one by one, and then puts the specific genome sequence >lcl|CP052043.1_cds_QKD56343.1_9601 into NCBI and Fungi DB for blast comparison and verification, to obtain the specific genome sequence, and the specific genome sequence has never been reported in the field of detection technology.

[0053] The nucleotide sequence of this specific genomic sequence is: ATGCAGATATCTGAAGTTACCAGGATTGCGTCTTTGCTTTCTCTAACGGCTGCAAGAATTGTCACAACTATCGCGGAAAAATGGGATTACACGTGGGAGGAAGAAATGCCCGTCGAAGACTTGGCATGCTGGAGTGAAGATAAAGACAACGTTATCAAGTATATGGGCTGGGAGTCTCTGAAGAACCTACCCGTTGCGATCGCGGGCTATGAAGGCGGCCGCCGCCAGGCAATGCTCGTCCTGGACTACGCATTATCGGGGTTCGCAACTGACTATGAGACTTTTGAATCGCTCACAGATGGACAGGCTTGGAGGACTGGGAAGGCAAATGTTACTGCCTTTCACTCTTCTGATCTTCGTGATTCTGGCATTGGGTCTGAGCCGGCGGGGGTAGATCGCAAGTTTATAGGCGACTATCAACCATTTGAGGAACCCAGCTCTTAA (SEQ ID NO: 1).

[0054] Design specific guide crRNA and RPA primer pairs for this specific sequence.

[0055] The nucleotide sequences of the RPA primer pairs are as follows: RPA-F: 5′- ATTATCGGGGTTCGCAACTGACTATGAGAC-3′ (SEQ ID NO: 2); RPA-R: 5′-TGGTTGATAGTCGCCTATAAACTTGCGATC-3′ (SEQ ID NO: 3).

[0056] The nucleotide sequences of the RPA primer pairs are as follows: 5′-UAAUUUCUACUAAGUGUAGAUGAAUCGCUCACAGAUGGACA-3′ (SEQ ID NO: 4).

[0057] Example 2 Establish a visual detection method for Fusarium oxysporum f. sp. vignae based on the RPA / CRISPR-Cas12a system (1) RAP reaction system (50 μL) was mixed evenly in a dry powder tube: 2 μL RPA-F (10 μM), 2 μL RPA-R (10 μM), 29.4 μL Buffer A (Anpu Future Biotech, Catalog No. #WLBB201KIT), 2.5 μL Buffer B (Anpu Future Biotech, Catalog No. #WLBB201KIT), 5 μL genomic DNA of the sample to be tested, and the rest was made up to 50 μL with water; RPA amplification procedure: the amplification temperature was 38 °C and the amplification time was 15 min.

[0058] (2) Prepare CRISPR-Cas12a reaction solution (10 μL): 3 μL Cas12a (700 nM), 2 μL crRNA (700 nM), 3 μL ssDNA fluorescent probe (100 μM), 1.5 μL 10 × NEBuffer r2.1, and 0.5 μL enzyme-free water and mix well.

[0059] (3) The ssDNA fluorescent probe is 5'-FAM-CCACCCA-BHQ1-3'.

[0060] (4) Take the RPA reaction solution in step (1) and add it to the bottom of the enzyme-free tube, specifically 10 μL, and place the CRISPR / Cas12a reaction solution in step (2) on the lid of the enzyme-free tube, specifically 10 μL, and then place the reaction tube at 38°C for constant temperature amplification for 15 minutes. After the RPA amplification is completed, the CRISPR / Cas12a reaction solution in the tube lid is centrifuged to the bottom of the tube and mixed with the RPA system for enzyme digestion reaction. The specific CRISPR procedure is: place the reaction tube in a fluorescent quantitative PCR instrument, react at 38°C for 30 minutes, during which FAM fluorescence is collected every 30 seconds, or react at 38°C for 30 minutes, and observe the fluorescence results of the reaction solution in the tube under blue light excitation with the naked eye.

[0061] When the reaction system emits fluorescence, it indicates that the sample to be tested contains Fusarium oxysporum, and when the reaction system does not emit fluorescence, it indicates that the sample to be tested does not contain Fusarium oxysporum.

[0062] Based on the above RPA and CRISPR / Cas12a amplification systems, the relevant reaction conditions were optimized as follows: Diseased cowpea plant samples collected in the field were isolated and purified. Molecular identification showed that it was a strain of Fusarium oxysporum. Its genomic DNA was extracted using the CTAB method and optimized using this DNA as a template.

[0063] The specific optimization scheme for the crRNA and cas12a reaction concentration is as follows: control the amplification time to 30min, the ssDNA probe concentration (100μM), and dilute the crRNA concentration while keeping the above parameters consistent. The diluted concentrations are 800nM, 700nM, 600nM, 500nM, 400nM, 300nM, 200nM, and 100nM. The concentration of the cas protein after dilution is the same as that of the crRNA. The reaction ratio of crRNA and cas12a is 1:1. The specific reaction conditions are 800nM:800nM, 700nM:700nM, 600nM:600nM, 500nM:500nM, 400nM:400nM, 300nM:300nM, 200nM:200nM, and 100nM:100nM, and a negative control is set. The test results are as follows: Figure 1 , 2 As shown, the reaction concentration of crRNA:cas12a of 700nM:700nM reaches the plateau phase the fastest, that is, the most suitable reaction concentration of crRNA and cas12a is 700nM:700nM.

[0064] The specific optimization scheme for RPA reaction time is as follows: control the amplification time to 30min, the ssDNA probe concentration (100μM), the crRNA and cas12a reaction concentrations to 700nM:700nM. When the above parameters remain the same, set the reaction time to 5, 10, 15, 20, 25, and 30min, and set a negative control. The test results are as follows Figure 3 As shown in the figure, the most suitable RPA reaction time is 15 min.

[0065] The specific optimization scheme for RPA reaction temperature is as follows: control the amplification time to 15min, the ssDNA probe concentration (100μM), the crRNA and cas12a reaction concentrations to 700nM:700nM, and keep the above parameters consistent, set the reaction temperature to 37, 38, 39, 40, 41, 42℃, and set a negative control. Figure 4 As shown, the most suitable RPA reaction temperature is 38°C.

[0066] Example 3 Specificity Detection The amplification time was controlled at 15 min, the ssDNA probe concentration was 100 μM, the crRNA and cas12a reaction concentrations were 700 nM:700 nM, and the reaction temperature was 38 °C. The specific effect of this system on detecting Fusarium oxysporum was evaluated.

[0067] The genomic DNA templates of Fusarium oxysporum, Fusarium equisetum, Fusarium laminarum, Fusarium graminearum, Fusarium solani, Fusarium erythrorhizium, Fusarium multifilamentum, Magnaporthe oryzae, Phytophthora avium, Phytophthora nicotianae, and cowpea plants were extracted by CTAB method, and sterile ddH 2 O is the negative control.

[0068] The results showed that the system with the addition of Fusarium oxysporum genomic DNA was significantly amplified, and the fluorescence value was significantly higher than that of the system with the addition of non-Fusarium oxysporum DNA and the negative control. By observing the fluorescence in the reaction tube with the naked eye, it was found that only the detection system with the addition of Fusarium oxysporum DNA had specific amplification and emitted obvious fluorescence under blue light and ultraviolet irradiation, while the reaction tubes with the addition of 11 other non-Fusarium oxysporum genomic DNAs and the negative control did not emit fluorescence ( Figure 5 ).

[0069] The above experimental results prove that the optimized RPA / CRISPR-Cas12a system has good specificity for the detection of Fusarium oxysporum causing cowpea wilt disease.

[0070] Example 4 Sensitivity Detection The optimized RPA / CRISPR-Cas12a system in Example (2) was used to evaluate the sensitivity of Fusarium oxysporum in detection. The genomic DNA of Fusarium oxysporum was extracted using the CTAB method. The concentration was determined using the Nanodrop micro-spectrophotometer available in the laboratory. The extracted genomic DNA was gradiently diluted using sterile water. The concentrations after dilution were 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL, respectively. Sterile water was used as a negative control. 5 μL of the diluted genomic DNA was added to the reaction solution with a total system of 50 μL for reaction.

[0071] The results showed that obvious fluorescence could be observed under blue and ultraviolet light in reaction tubes with DNA concentrations ranging from 100 ng / μL to 10 pg / μL, but no fluorescence signal could be observed in reaction tubes with DNA concentrations below 10 pg / μL. There was no significant difference in fluorescence curve amplification compared with the negative control. The above results showed that the sensitivity detection limit of the RPA / CRISPR-Cas12a system was 10 pg / μL ( Figure 6 ).

[0072] Example 5 Detection of actual cowpea wilt disease samples The spore suspension of Fusarium oxysporum was collected after shaking and then treated with cowpea seedlings by root immersion method. Specifically, the concentration of the spore suspension of Fusarium oxysporum was 5×10 6 / mL, the root immersion time was 30min, and the roots of the treated cowpea seedlings changed color and withered on the 6th day, and the leaves turned yellow ( Figure 7 ), extract the genomic DNA of the roots, stems and leaves of the diseased cowpea plants on the 6th day, and use the RPA combined with CRISPR / Cas12a technology optimized in Example 2 to detect the genomic DNA of different parts of the diseased cowpea plants mentioned above to determine whether they are infected with Fusarium oxysporum.

[0073] The results showed that the diseased cowpea plant samples collected in the field were separated and purified, and the results after molecular identification showed that it was a strain of Fusarium oxysporum. The DNA extracted using the CTAB method was used as a template for a positive control, and the reaction tube emitted a strong green fluorescence; the roots and middle stems of the diseased cowpea seedlings treated with Fusarium oxysporum emitted fluorescence similar to the positive control, indicating that Fusarium oxysporum can infect the roots of cowpea plants and spread to the stems through the root vascular bundles, but Fusarium oxysporum was not detected in the leaves. The above experimental results show that the optimized RPA / CRISPR-Cas12a technology in Example 2 can achieve rapid detection of cowpea wilt caused by Fusarium oxysporum on cowpea plants. ( Figure 8 ).

[0074] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple improvements and modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A reagent for detecting Fusarium oxysporum, characterized in that: The reagent includes a primer pair and crRNA for detecting Fusarium oxysporum; The primer pair is RPA-F / RPA-R, and the nucleotide sequence is as follows: RPA-F:5′-ATTATCGGGGTTCGCAACTGACTATGAGAC-3′; RPA-R:5′-TGGTTGATAGTCGCCTATAAACTTGCGATC-3′; The nucleotide sequence of the crRNA is: 5′-UAAUUUCUACUAAGUGUAGAUGAAUCGCUCACAGAUGGACA-3′.

2. A kit comprising the reagent of claim 1 and a CRISPR-Cas12a detection reagent.

3. The kit according to claim 2, characterized in that: The CRISPR-Cas12a detection reagent includes Cas12a protein and a signal reporter probe.

4. The kit according to claim 3, characterized in that: The Cas12a protein is selected from at least one of AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, and LbCas12a.

5. The kit according to claim 3, characterized in that: The signal reporter probe comprises ssDNA; The two ends of the ssDNA are modified with a fluorescent group and a quenching group respectively.

6. The kit according to claim 2, characterized in that: The kit also includes an RPA reaction solution and a CRISPR-Cas12a buffer.

7. Use of the reagent according to claim 1 and / or the kit according to any one of claims 2 to 6 in any one of 1) to 2): 1) Detection of Fusarium oxysporum causing cowpea wilt disease; 2) Preparation of products for detecting Fusarium oxysporum of cowpea wilt.

8. A method for detecting Fusarium oxysporum of cowpea wilt based on RPA combined with CRISPR / Cas12a, comprising the step of using the kit described in any one of claims 2 to 6.

9. The detection method according to claim 8, characterized in that: The method comprises the following steps: 1) Extract DNA from the sample to be tested; 2) using the primer pair described in claim 1, performing RPA amplification on the DNA extracted in step 1) to obtain an RPA product; 3) Mixing the RPA product in step 2) with the crRNA described in claim 1, the signal reporter probe described in claim 3, and the Cas12a protein to react and read the detection signal; 4) Determine whether Fusarium oxysporum is present in the sample to be tested based on the detection signal.

10. The method according to claim 9, characterized in that: The RPA amplification conditions are 37-42°C for 5-30 minutes; In the step 3), the concentration of crRNA in the CRISPR reaction system is 100-800 nM; The concentration of the Cas12a protein is 100-800 nM; The final concentration of the signal reporter probe is 20-200 μM.

Images