Application of PRP19 in preparation of hepatic fibrosis medicine

Abstract

The invention relates to the field of biological medicine, and discloses application of PRP19 in preparation of a medicine for treating hepatic fibrosis. According to the application, the expression difference of PRP19 in a hepatic fibrosis sample and a normal sample is proved through a clinical specimen of a large sample; through the AAV6 virus with hepatic stellate cell targeting, knock-down of the PRP19 can improve the hepatic fibrosis degree of a model mouse, and the research has high credibility and clinical transformation value. Furthermore, the adeno-associated virus for knocking down the PRP19 in a targeted manner can delay the progress of the hepatic fibrosis and improve the liver function, and can be used as a novel target spot for treating the hepatic fibrosis.

Description

Technical Field

[0001] This application relates to the field of biomedicine, and more specifically, it relates to the use of PRP19 in the preparation of drugs for liver fibrosis. Background Art

[0002] Liver fibrosis is the common outcome of various chronic liver injuries, mainly manifested as the excessive deposition of extracellular matrix (ECM) in the liver parenchyma, and its essence is a scar repair reaction. During the occurrence and progression of liver fibrosis, although various cells such as hepatocytes, bile duct epithelial cells, Kuffer cells, and hepatic sinusoidal endothelial cells all play important regulatory roles, the activation of hepatic stellate cells (HSCs) is the core link in this process. In the normal liver, HSCs are in a quiescent state, located in the perisinusoidal space between hepatocytes and sinusoidal endothelial cells. Their cytoplasm contains a large number of lipid droplets and stores 50%-95% of the body's vitamin A mainly in the form of retinyl esters. However, when the liver is in a state of chronic persistent injury, such as chronic viral infection, autoimmune hepatitis, biliary obstruction, alcoholic and non-alcoholic fatty liver disease, damaged or apoptotic hepatocytes will stimulate Kuffer cells to release a large number of inflammatory factors or directly promote the activation of HSCs in a paracrine manner and further differentiate into myofibroblast-like cells. Activated HSCs can rapidly proliferate and migrate to the liver injury area, and at the same time secrete a large amount of ECM mainly composed of type I and type III collagens, thereby achieving the repair of the damaged area. When the primary disease causing liver injury is timely controlled, liver fibrosis can be reversed; however, when the injury factor persists, ECM will be excessively deposited, resulting in the destruction of the normal liver lobule structure and abnormal liver hemodynamics, and ultimately leading to the loss of normal liver physiological function and the progression of liver fibrosis to cirrhosis. At present, liver transplantation is the only treatment for cirrhosis, but due to its high cost and severe shortage of donors, this program cannot benefit all patients. Therefore, it is a more feasible plan to take effective intervention measures to reverse liver fibrosis before it progresses to cirrhosis. However, so far, the US Food and Drug Administration has not approved any related drugs for marketing. Therefore, understanding the molecular mechanism of HSC activation and finding more effective anti-fibrotic treatment targets are of great significance for the treatment of liver fibrosis and chronic liver diseases.

[0003] Among the signaling pathways that regulate the activation of HSCs, the TGFβ / Smad pathway is considered to play the most important regulatory role. When the liver tissue is stimulated by external factors, the content of TGFβ in the liver rapidly increases and binds to the receptor (TβR) II on the surface of HSCs, subsequently promoting the phosphorylation of TβR I. The activated type I receptor transmits the signal from the extracellular to the intracellular, further promoting the phosphorylation of downstream Smad proteins (mainly Smad 3), and the activation of SMAD3 can promote the transcription of type I and III collagens. In addition, the TGFβ / Smad pathway interacts with the mitogen-activated protein kinase (MAPK), Janus kinase / signal transducer and activator of transcription (JAK / STAT), Ras and other pathways, synergistically promoting the activation of HSCs. The activation of HSCs by other cytokines or regulatory pathways such as PDGF, CTGF, VEGF, Hedgehog, etc. is also commonly reported in the literature. However, since these targets, like TGFβ, have extensive physiological functions, it is difficult to directly inhibit them to achieve the treatment of liver fibrosis. Recent studies have suggested that once HSCs transform from the quiescent state to the activated state with rapid proliferation and the ability to secrete a large amount of ECM, the cells face a dramatically increased energy demand. To adapt to such a state, HSCs need to reprogram their own glucose metabolism, lipid metabolism, and glutamine metabolism. A full understanding of the driving factors of these metabolic processes is of great significance for finding suitable therapeutic targets and slowing down or even blocking the progression of liver fibrosis.

[0004] The so-called reprogramming of glucose metabolism refers to the fact that under sufficient oxygen conditions, normal cells take up glucose for oxidative phosphorylation to meet various energy requirements for life activities. However, tumors or rapidly proliferating cells (such as myofibroblast-like cells) preferentially produce adenosine triphosphate (ATP) through glycolysis rather than oxidative phosphorylation. Although the amount of ATP produced by glycolysis per unit of glucose is much less than that of oxidative phosphorylation, its rate of generating ATP is faster, thus being able to better meet the energy requirements during rapid cell proliferation. Research suggests that activated HSCs have stronger glucose transport capacity and glycolytic activity; the encoding genes of key glycolytic enzymes such as glucosetransporters (GLUTs), hexokinase 2 (HK2), fructose-2,6-bisphosphatase-3 (PFKFB3), and pyruvate kinase isozymes M2 (PKM2) are all significantly upregulated. In addition, studies have found that exosomes derived from activated HSCs contain PKM2 and GLUT1 proteins and can promote the transformation of resting HSCs into the activated state; while the use of PKM2 agonists or PFKFB3 inhibitors can significantly reduce the activation level of HSCs. It is worth noting that the PKM2 molecule exists in two structural forms. Its tetrameric form mainly promotes the process of oxidative phosphorylation; while the content of dimeric PKM2 is significantly upregulated in rapidly proliferating cells. Its main role is to promote glycolytic activity and can be transported into the nucleus to act as a protein kinase to promote the transcription of genes encoding key glycolytic enzymes. Currently, there have been multiple studies from different institutions suggesting that this gene is upregulated in activated HSCs, and the use of agonists of this protein (promoting the transformation from dimers to tetramers) such as TEPP-46 or DASA-58 can significantly inhibit the activation of HSCs, suggesting that this protein may be a reliable target for intervening in the activation of HSCs. However, the current mechanism of the upregulation of PKM2 expression in activated HSCs and the pathway mediating the activation of HSCs are still unclear.

[0005] Pre-mRNA processing factor 19 (PRP19) is a multifunctional protein molecule, which consists of an N-terminal U-box domain, a central coiled-coil region, and a C-terminal WD40 domain. Among them, the U-box domain has E3 ubiquitin ligase activity, providing the basis for PRP19-mediated substrate polyubiquitination; the C-terminal WD40 repeat region is a substrate recognition and protein interaction platform; the central coiled-coil region promotes PRP19 to form a stable tetrameric structure in the spliceosome. Studies have found that PRP19 can participate in a variety of biological processes, including DNA damage repair and pre-mRNA splicing during tumor progression and embryonic development. In the previous studies of our research group, we found that PRP19 can promote the progression of hepatocellular carcinoma through pathways such as chemoradiotherapy resistance, epithelial-mesenchymal transition, and cell cycle conversion. In addition to these classical functions, some literatures have also reported that PRP19 is involved in intracellular energy and material metabolism processes such as fatty acid and cholesterol metabolism. However, it is still unclear whether PRP19 can participate in other metabolic processes of cells such as glucose metabolism. Summary of the Invention

[0006] The purpose of the present invention is to explore whether PRP19 can be used as a therapeutic target for liver fibrosis. Therefore, aiming at the blank of the existing technology, the present invention provides an application method of using PRP19 as a molecular target in the treatment of liver fibrosis, and specifically adopts the following technical solutions:

[0007] In the first aspect, the present application provides the use of PRP19 in the preparation of drugs for liver fibrosis.

[0008] In the second aspect, the present application provides the use of substances that inhibit the expression of the PRP19 gene in the preparation of drugs for liver fibrosis.

[0009] Furthermore, the substance that inhibits the expression of the PRP19 gene is a virus with AAV6 containing the PRP19 target sequence knockdown as shown in SEQ NO:1, SEQ NO:2, and SEQ NO:3 as a vector;

[0010] SEQ NO:1ACCTCAAATTCTACAGTCTGTATAGTGAAGCCACAGATGTATACAGACTGTAGAATTTGAGGC;

[0011] SEQ NO:2ACGACTCATTGAGAAGTACATTTAGTGAAGCCACAGATGTAAATGTACTTCTCAATGAGTCGC;

[0012] SEQ NO:3 ACCTCATCTCAGTAGTGGGTTATAGTGAAGCCACAGATGTATAACCCACTACTGAGATGAGGC。

[0013] In a third aspect, the present application provides the use of PRP19 protein in the preparation of a screening or prognostic marker for liver fibrosis.

[0014] In a fourth aspect, the present application provides the use of a reagent for detecting the expression level of PRP19 protein in the preparation of a liver fibrosis screening or prognostic kit

[0015] In summary, the present application has the following beneficial effects:

[0016] Previously, there has been no recognized or clinically translated therapeutic target for liver fibrosis. This study demonstrated the differential expression of PRP19 in liver fibrosis samples and normal samples through large-scale clinical specimens; through the AAV6 virus with hepatic stellate cell targeting, it was demonstrated that knocking down PRP19 could improve the degree of liver fibrosis in model mice, and the study has high credibility and clinical translation value. Further, it can be known that the adeno-associated virus targeting and knocking down PRP19 can delay the progression of liver fibrosis and improve liver function, and can be used as a new therapeutic target for liver fibrosis. Description of the Drawings

[0017] Figure 1 PRP19 is significantly upregulated in human liver fibrosis clinical specimens. A. Verification of the expression level of PRP19 mRNA in liver fibrosis samples; B. Verification of the expression level of PRP19 protein in liver fibrosis samples; C. In consecutive pathological sections of normal liver tissue and liver fibrosis tissue, hematoxylin-eosin staining, Sirius red staining, α-SMA and PRP19 immunohistochemical staining were performed simultaneously; D. Quantitative analysis of the results of Sirius red staining, α-SMA and PRP19 immunohistochemical staining in 32 liver fibrosis patients and 8 normal control liver tissues. E. Correlation analysis between the immunohistochemical staining score of PRP19 and the immunohistochemical staining scores of Sirius red staining and α-SMA in liver fibrosis pathological sections. Scale bar, 100 μm; ***p < 0.001.

[0018] Figure 2 Knocking down PRP19 can significantly inhibit the activation of HSCs induced by CCl 4 and the progression of liver fibrosis. A. Schematic diagram of the experimental operation. B. Primary mouse HSCs isolated after different interventions were cultured in vitro for 1 day, and then stained with different markers. C. Mouse liver tissues harvested after different treatments were paraffin-embedded, sectioned, and then immunofluorescently stained with different markers. D. Mouse liver tissues harvested after different treatments were paraffin-embedded, sectioned, and then hematoxylin-eosin, Sirius red and immunohistochemical staining were performed. E.Figure 2 Quantitative analysis results of Sirius red staining, α-SMA and PRP19 in D. **p < 0.01, ***p < 0.001.

[0019] Figure 3 AAV6-shPRP19 can significantly reduce liver collagen content and improve liver function. A. Hydroxyproline content in liver tissues of mice in different groups in the CCl 4 model. B. Changes in serum ALT, AST, ALP and TBIL levels. ***p < 0.001. Detailed implementation manners

[0020] The technical solutions and effects of the present application will be further described in detail below in combination with embodiments and accompanying drawings. It can be understood that the specific embodiments described herein are only used to explain the invention, rather than limiting the invention.

[0021] The materials and methods used in the following embodiments are as follows:

[0022] 1. Immunoblotting (Western blotting)

[0023] (1) Protein sample preparation

[0024] 1) Prepare RIPA lysis buffer containing phosphatase inhibitors according to the instructions, which can be stored at -20°C and protease inhibitors are added and mixed well when in use (prepared immediately before use).

[0025] 2) For liver tissue samples, weigh 10 mg into a 1.5 mL EP tube, add 2 ceramic beads and 200 - 300 μL of RIPA mixture. Place it in a pre-cooled homogenizer and grind at 60 HZ / s for 2 min until there are no obvious tissue blocks; for cell samples, after removing the culture medium, wash twice with pre-cooled PBS (note that since both LX-2 and 293T cells do not adhere firmly, pay attention to gentle operation), add 100 μL of RIPA mixture to each well (6-well plate), let it stand on ice for 10 min, and then use a cell scraper or pipette to blow and collect the protein lysate.

[0026] 2) Centrifuge at 12000 rpm for 10 min in a pre-cooled high-speed centrifuge.

[0027] 3) Transfer the supernatant to a new EP tube, and take 10 μL of the supernatant for BCA protein concentration detection. The remaining supernatant is added with 5× protein loading buffer Loading Buffer at a ratio of 4:1, and then incubated in a 95°C metal bath for 10 min. The cooked samples can be directly used for subsequent experiments or stored in a -20°C refrigerator.

[0028] (2) Protein concentration determination

[0029] This experimental operation was carried out according to the instructions of the BCA Protein Concentration Assay Kit (P0012S) from Beyotime Institute of Biotechnology.

[0030] 1) Prepare protein standard

[0031] Prepare a protein standard with a concentration of 0.5 mg / mL using RIPA lysis buffer.

[0032] 2) Prepare BCA working solution

[0033] Calculate the total volume of the working solution according to the number of samples, 3 - 4 replicates per sample, and 200 μL per well. Then, add BCA Reagent A and Reagent B at a volume ratio of 50:1 to prepare the BCA working solution. Pipette and mix well, and place on ice.

[0034] 3) Make a protein concentration standard curve

[0035] Add the 0.5 mg / mL protein standard to the standard wells of a 96 - well plate at volumes of 0, 1, 2, 4, 8, 12, 16, 20 μL, and then use RIPA lysis buffer to make up to 20 μL.

[0036] 4) Measure the protein concentration of samples

[0037] Aspirate 1 - 2 μL of the sample to be measured into the sample wells, and use RIPA lysis buffer to make up to 20 μL. Then, add 200 μL of the prepared BCA working solution to the standard wells and sample wells, and react in an oven at 37 °C for 30 min. Finally, set the wavelength of the microplate reader to 562 nm, measure the absorbance of each well above, make a standard curve, and calculate the sample concentration accordingly.

[0038] (3) Preparation of SDS - PAGE gel

[0039] This experimental operation was carried out according to the instructions of the SDS - PAGE Gel Fast Preparation Kit (P0012AC) from Beyotime Institute of Biotechnology.

[0040] Prepare clean glass plates with a thickness of 1.5 mm, clamp them tightly on the gel - casting rack, and pay attention to the lower ends being flush. Premix various solutions in the specified volume according to the kit instructions to prepare the separating gel. After pipetting and mixing well, use a 5 - mL pipette to inject the above - prepared separating gel into the glass plates, and then quickly inject 1 - 2 mL of anhydrous ethanol to flatten the top and remove air bubbles. In this experiment, freshly prepared 10% APS has the best effect. If it is stored in aliquots, it should be used within 1 month, and avoid repeated freezing and thawing as well as long - term frozen storage.

[0041] After the lower separating gel has solidified (usually 20 - 30 minutes), pour off the upper anhydrous ethanol. While waiting for it to dry, premix various solutions according to the instructions for preparing the upper stacking gel. After thoroughly pipetting and mixing, carefully pour it into the glass plate, vertically insert a 15 - well comb, and tilt it slightly left and right to remove the tiny air bubbles at the bottom of the comb. It can completely solidify after standing at room temperature for 20 - 30 minutes.

[0042] (4) Preparation of electrophoresis buffer and transfer buffer

[0043] Prepare the electrophoresis buffer and transfer buffer according to the following table. Note that the prepared transfer buffer needs to be left standing on ice.

[0044] Table 1 Preparation of electrophoresis and transfer buffers

[0045] Reagent Name Electrophoresis Buffer Transfer Buffer SDS 1g - Tris 3.03g 3.03g Glycine 14.43g 14.43g 95% Ethanol - 200 mL <![CDATA[ddH 2 O]]> 1000 mL 800 mL

[0046] (5) Electrophoresis

[0047] Pour the electrophoresis buffer into the electrophoresis tank, fix the glass plate containing the gel, vertically pull out the comb, and add 10 μg - 20 μg of protein sample into the well. To mark the loading order, add 1 μL or 3 μL of protein marker to the lanes on both sides of the sample. First, perform electrophoresis at a constant voltage of 80 V for 20 - 30 minutes until the protein marker bands are clearly visible, and then change to a constant voltage of 140 V for 50 minutes until the marker reaches the bottom of the gel or the target protein molecules are completely separated.

[0048] (6) Transfer

[0049] 1) Cut a PVDF membrane of appropriate size (0.45 μm, 8 cm × 5 cm in length and width), soak it in methanol for 15 s - 5 min, and place it in the pre - cooled transfer buffer. To keep the PVDF membrane clean, avoid direct contact during the whole transfer process, and use tweezers to pick it up.

[0050] 2) Take out the gel after electrophoresis, separate the short glass plate and the gel, cut off the upper gel and the unseparated protein sample at the bottom, and transfer the gel to the transfer buffer.

[0051] 3) Place the transfer cassette with the transparent side up, put the activated PVDF membrane on top of the gel, pay attention to removing the air bubbles between the two, and then place 1 wet sponge and 2 filter papers (sponge facing outwards) on the top and bottom respectively to form a sandwich structure. Close the transfer cassette, transfer it to the transfer tank, place a frozen ice box or ice bag, pour in enough transfer buffer, and transfer at a constant current of 300 mA for 1 h - 2 h according to the molecular weight. Note the positive and negative poles of the transfer to avoid incorrect insertion, which may cause the protein molecules in the gel not to be transferred to the PVDF membrane.

[0052] (7) Blocking and antibody incubation

[0053] 1) After the membrane transfer is completed, quickly transfer the PVDF membrane to the rapid blocking solution and block it at room temperature for 15 - 30 minutes. Then, briefly wash it with TBST solution, transfer the PVDF membrane into a thin film glove, and cut the membrane according to the molecular weight of the target protein. Note that to clearly show the position of the band, a width of 2 - 3 markers should be reserved above and below the target molecule position.

[0054] 2) Transfer the band to the diluted primary antibody solution and incubate it overnight at 4°C. The main antibody information used in this step is as follows:

[0055] Table 2 Specific information on antibody usage

[0056] Antibody Company (Cat.No.) Working concentrations PRP19 Santa Cruz (sc-514338) WB: 1:1000 α-SMA Cell Signaling Technology (19245) WB: 1:2000 β-actin Proteintech (66009-1-Ig) WB: 1:50000

[0057] 3) Recover the primary antibody solution, wash the target band 3 times with TBST solution, 10 minutes each time. Then add a sufficient amount of diluted secondary antibody solution to the band and incubate it at room temperature for 40 - 60 minutes. Recover the secondary antibody working solution and continue to wash the band 3 times, 10 minutes each time.

[0058] (8) Development

[0059] In this step, YaMei Biotechnology Enhanced Chemiluminescence Detection Kit is used. It should be noted that due to the relatively high protein abundance in this method, hypersensitive luminescent solution should be avoided to prevent overexposure. Before use, pipette equal volumes of Solution A and Solution B to prepare the final luminescent solution and drop it onto the test band. Use Tianneng Luminescence Imaging System to detect protein abundance. Finally, save the luminescent band and perform gray-scale quantitative analysis of the band using Image J software.

[0060] 2. Immunohistochemistry (IHC)

[0061] (1) Dewaxing to water

[0062] 1) Place the paraffin section in an oven and bake it at 60°C for 2 hours;

[0063] 2) Put the liver tissue section into xylene I and II for 15 minutes each;

[0064] 3) Transfer it successively to absolute ethanol, 95% ethanol, 85% ethanol, and 70% ethanol and soak it for 5 minutes each;

[0065] 4) Wash it 3 times with PBS, 5 minutes each time.

[0066] (2) Antigen retrieval

[0067] 1) Transfer the section to the citrate antigen retrieval solution, heat it in a microwave oven at high power until boiling, and then heat it at medium-high power and low power for 5 minutes successively, and let it stand at room temperature for 10 minutes.

[0068] 2) Wash with PBS for 5 min and repeat 3 times.

[0069] 3) Transfer the above-mentioned sections to a humid chamber, add an appropriate amount of 3% hydrogen peroxide solution, and incubate in the dark at room temperature for 30 min.

[0070] 4) Wash with PBS for 5 min and repeat 3 times.

[0071] (3) Blocking

[0072] 1) Block with 5% BSA solution at room temperature for 1 h.

[0073] 2) Wash 3 times with PBS, 5 min each time.

[0074] (4) Antibody Incubation

[0075] 1) Drop an appropriate amount of the primary antibody working solution corresponding to the protein on the tissue and incubate overnight at 4°C.

[0076] Table 3 Specific Information on Antibody Use

[0077] Antibody Company (Cat.No.) Working concentrations PRP19 Santa Cruz (sc-514338) IHC: 1:100 α-SMA Cell Signaling Technology (19245) IHC: 1:500

[0078] 2) Discard the primary antibody working solution, wash 3 times with PBS, 5 min each time.

[0079] 3) Drop an appropriate amount of the corresponding secondary antibody working solution on the tissue and incubate at room temperature for 1 h.

[0080] 4) Wash 3 times with PBS, 5 min each time.

[0081] (5) DAB Color Development

[0082] Prepare the DAB color development working solution freshly, drop it onto the section tissue block, terminate the color development time according to the coloring result under the microscope, and then rinse with running water for 1 min.

[0083] (6) Nuclear Staining, Dehydration, Clearing, Mounting and Imaging

[0084] 1) Drop hematoxylin solution to counterstain the nucleus for 2 min, rinse with running water, add hydrochloric acid alcohol for differentiation for 2 s, and then rinse with running water again for bluing.

[0085] 2) Transfer the above-mentioned sections to 75%, 85%, 95% and absolute ethanol successively and soak for 5 min each for dehydration and drying.

[0086] 3) Transfer to xylene I for 5 min.

[0087] 4) Transfer to xylene II for 5 min.

[0088] 5) Mount with neutral balsam and image under the microscope.

[0089] (7) IHC scoring criteria

[0090] For the determination of protein abundance in IHC images, scoring is performed according to the classical H-Score standard. Staining intensity (i): negative is 0 points, weak staining is 1 point, moderate staining is 2 points, and strong staining is 3 points. The percentage of cells (Pi) under each staining intensity category can range from 0% to 100%. The final H-Score is obtained by summing the product of i and Pi, and its value ranges from 0 to 300.

[0091] 3. Construction of liver fibrosis model (carbon tetrachloride (CCl 4 ) model)

[0092] Thirty-six 8-week-old C57BL / 6 mice were randomly divided into 6 groups. Group 1 was intraperitoneally injected with 100 μL of corn oil twice a week; Groups 2-4 were injected with 100 μL of corn oil containing 10% CCl 4 for 4, 8, and 12 weeks respectively. 72 hours after the last injection of the above mice, the abdominal cavity was opened after anesthesia with 100 μL of 1% sodium pentobarbital intraperitoneally. The appearance of the liver was observed, blood was collected from the inferior vena cava, and then centrifuged at 3000 rpm for 15 min. The supernatant was collected and stored in a -80 °C refrigerator; the liver tissue of the mice was removed and stored in 4% paraformaldehyde for subsequent hematoxylin-eosin, Sirius red, or immunohistochemical staining, or stored in a -80 °C refrigerator for subsequent qPCR and Western blot detection. In addition, the operation of Group 5 was the same as that of Group 4, and Group 6 was the control group of Group 5, that is, intraperitoneally injected with 100 μL of corn oil twice a week for 12 weeks. 72 hours after the last injection of the above two groups of mice, the abdominal cavity was opened after anesthesia with 100 μL of 1% sodium pentobarbital intraperitoneally for primary liver cell isolation.

[0093] 4. Construction and injection of AAV6

[0094] To examine the effect of PRP19 expression in HSCs on the progression of liver fibrosis, and considering that the AAV6 serotype has the best targeting ability for HSCs, in this study, AAV6-shPRP19 targeting the knockdown of PRP19 was further used. Its targeting sequences are shown below. To ensure the knockdown effect, 3 knockdown sequences were concatenated in the same plasmid. In addition, this plasmid also carried the luc group to facilitate the examination of transfection efficiency. The construction of this viral plasmid and virus packaging were completed by Guangzhou Yuanjing Biotechnology Co., Ltd. Subsequently, observations were continued for four weeks.

[0095] Table 4 AAV6-shPRP19 sequences

[0096]

[0097] Example 1: Significantly upregulated expression of PRP19 in human liver fibrosis clinical specimens

[0098] To further clarify the expression level of PRP19 in liver fibrosis clinical specimens, we collected 12 clinical samples of liver fibrosis and 8 normal liver tissues without obvious fibrosis as controls. The qPCR test results indicated that compared with normal liver tissues, the expression level of PRP19 mRNA in fibrotic samples was upregulated by 1.57 - 5.36 times (p < 0.001, Figure 1 A). Meanwhile, we randomly selected 6 pairs of samples for Western blot detection, and the results showed that the protein expression level of PRP19 was also significantly upregulated in liver fibrosis tissues ( Figure 1 B). Subsequently, we enlarged the sample size, obtained pathological sections of 32 liver fibrosis patients, and selected 8 normal liver tissues without obvious fibrosis as controls. We performed Sirius red staining (indicating liver collagen content) and immunohistochemical staining of α-SMA (an activation marker of HSCs, encoded by the ACTA2 gene) on the pathological sections of each patient to clarify the degree of fibrosis progression. On this basis, immunohistochemical staining of PRP19 was performed using serial sections ( Figure 1 C). The results showed that in liver fibrosis clinical specimens, the protein level of PRP19 was significantly upregulated (p < 0.001, Figure 1 D), and was positively correlated with the degree of liver fibrosis in patients (PRP19 and Sirius red staining group: r = 0.661, p < 0.001; PRP19 and α-SMA staining group: r = 0.601, p < 0.001; Figure 1 E).

[0099] Example 2: AAV6-shPRP19 can significantly inhibit the activation of HSCs and the progression of liver fibrosis

[0100] Construct a CCl 4 liver fibrosis model to test the therapeutic effect of AAV6-shPRP19. As Figure 2 shown in A, 2 weeks after intraperitoneal injection of 10% CCl 4 solution, we intravenously injected AAV6-shControl and AAV6-shPRP19 virus solutions with a virus titer of 2*10^ 11 , and then continued to inject CCl 4 solution for 4 weeks. At the end of the experiment, primary HSCs of mice in different groups were isolated, blood was drawn from the inferior vena cava, and liver tissues were harvested for immunohistochemistry and immunofluorescence staining. The results indicated that injecting CCl 4 solution for 6 weeks could significantly promote the activation of HSCs, while injecting AAV6-shPRP19 simultaneously could significantly reduce its activation degreeFigure 2 B) and inhibit the progression of CCl 4 -induced liver fibrosis ( Figure 2 C-E).

[0101] Example 3: AAV6-shPRP19 can significantly improve liver function

[0102] Although the therapeutic effect of AAV6-shPRP19 has been visually analyzed and judged by immunofluorescence or immunohistochemical staining, in order to obtain more accurate quantitative data, the hydroxyproline content of liver tissues and liver serum biochemical indexes were subsequently detected. The results showed that in the CCl 4 and BDL models, the injection of AAV6-shPRP19 could significantly reduce the hydroxyproline content, suggesting a decrease in the collagen content of liver fibrosis tissues ( Figure 3 A). Further serological examinations also indicated that although the ALT, AST, ALP, and TBIL indexes could not completely return to the levels of normal control mice after the injection of AAV6-shPRP19, they were significantly improved compared with those of the model group mice ( Figure 3 B), suggesting that PRP19 has important potential value for the treatment of liver fibrosis.

[0103] This specific embodiment is only an interpretation of the present application and does not limit the present application. Those skilled in the art can make modifications to this embodiment without creative contributions according to needs after reading this specification, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. Use of PRP19 in the preparation of drugs for liver fibrosis.

2. Use of substances that inhibit PRP19 gene expression in the preparation of liver fibrosis drugs.

3. The use according to claim 2, characterized in that: The substance that inhibits the expression of the PRP19 gene is a virus using AAV6 as a vector containing the PRP19 knockdown target sequence shown in SEQ NO: 1, SEQ NO: 2 and SEQ NO:

3.

4. Use of PRP19 protein in the preparation of a marker for screening or prognosis of liver fibrosis.

5. Use of a reagent for detecting the expression level of PRP19 protein in the preparation of a liver fibrosis screening or prognosis kit.

Images