Polypeptide targeting NPAT protein and application of polypeptide in inhibition of tumor cell proliferation

Abstract

The invention discloses a polypeptide targeting NPAT protein and application of the polypeptide in inhibition of tumor cell proliferation, and relates to the technical field of biological medicines. The polypeptide provided by the invention is found in research on a regulatory mechanism formed by a membrane-free organelle-histone matrix in a cell nucleus. The polypeptide is over-expressed in cells, NPAT condensation in the cells can be effectively inhibited, then formation of a histone matrix is inhibited, and expression of a histone gene is down-regulated. A CCK8 experiment and a clone formation experiment can be used for observing that the polypeptide has an obvious effect of inhibiting tumor cell proliferation. The polypeptide is 1-50 amino acid sequences at the N end of NPAT protein, and can effectively interfere the normal function of NPAT for regulating histone transcription and hinder the normal process of the cell cycle. The compound has an application prospect in the field of medicines, and a new design idea can be provided for developing medicines for inhibiting abnormal proliferation of tumor cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a polypeptide targeting NPAT protein and its application in inhibiting the proliferation of tumor cells. Background Art

[0002] Membrane-less organelles within cells, such as stress granules, P-bodies, nucleoli, etc., provide a structural basis for cells to rapidly respond to environmental changes. The condensation / phase separation of biomacromolecules is the formation mechanism for assembling membrane-less organelles and is also one of the hotspots in the field of biological research in recent years.

[0003] "Phase separation" in cell biology refers to the process in which biomacromolecules such as proteins and RNAs form membrane-less, droplet-like dynamic structures through multivalent interactions such as electrostatic interactions and hydrophobic interactions within cells. Cells respond to external stimuli or internal signal changes through the rapid formation or disassembly of these membrane-less organelles, thereby regulating biochemical reactions and signal transduction within cells. Once abnormal phase separation of the biomacromolecules that determine the formation of membrane-less organelles occurs, corresponding diseases may be caused. Neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease are both caused by abnormal phase separation in the nerve cells of patients. Therefore, research on the phase separation mechanism of important proteins is expected to provide new ideas and methods for the diagnosis and treatment targets of these major diseases.

[0004] The normal operation of the cell cycle is inseparable from DNA replication and histone synthesis. Both need to be precisely regulated simultaneously to ensure the normal proliferation of cells. The regulation of histone transcription is carried out by a membrane-less organelle called "Histone Locus Body" (HLB) in the cell nucleus, and the formation and maintenance of its function are the key to ensuring the normal transcription of histone genes. NPAT (Nuclear Protein mapped to the AT locus) protein is a key protein regulating histone transcription. Our research found that NPAT undergoes phase separation through self-interaction in the cell nucleus to form condensates, thereby driving the formation of histone locus bodies and then initiating the transcription of histones. Once the phase separation of NPAT is abnormal, the formation of histone locus bodies will be affected, and the cell cycle will be disrupted due to abnormal histone transcription. Therefore, the condensation / phase separation of NPAT is often a new target for the development of tumor treatments such as breast cancer and lymphoma.

[0005] In the prior art, for example, the patent application with the publication number CN118373895A discloses a polypeptide targeting the phase separation of NPAT protein and its application, which relates to the field of biomedical technology. The polypeptide provided by this invention was discovered during the study of the mechanism of NPAT protein in regulating the formation of histone bodies and is a truncated form of importin-α4. Transfecting this polypeptide into cells can effectively inhibit the formation of histone bodies and downregulate the expression of histone genes. MTT experiments and colony formation experiments show that the polypeptide of this invention has an obvious effect of inhibiting the proliferation of tumor cells. Moreover, in the polypeptide of this invention, the longest sequence has only 49 amino acid residues, with a small molecular weight and high permeability, having certain application prospects in the medical field and providing a design idea for the development of drugs to inhibit the growth of tumor cells with strong proliferative ability. Summary of the Invention

[0006] The object of the present invention is to provide a polypeptide targeting the condensation / phase separation of NPAT protein. This polypeptide is the amino acid sequence of the N-terminal 1-50 of NPAT protein, which can interfere with the self-interaction of NPAT and inhibit the occurrence of its phase separation. Through this mechanism, this polypeptide interferes with the formation of histone bodies, downregulates the transcriptional level of histone genes, and ultimately inhibits the proliferation of tumor cells.

[0007] The applicant's research found that NPAT protein forms condensates through self-interaction. This means that disrupting the self-interaction of NPAT will inhibit the formation of its condensates. The present invention first discovered that the amino acid sequence of the N-terminal 1-90 of NPAT contains LisH and SIF domains, which are the key sequences mediating the self-interaction of NPAT. Based on this key sequence, we designed a polypeptide containing 50 amino acids. This polypeptide can compete with endogenous NPAT in cells, thereby interfering with the self-interaction of NPAT protein and preventing it from condensing to initiate the formation of histone bodies, ultimately inhibiting the proliferation of tumor cells.

[0008] To achieve the above object, the technical solution of the present invention is as follows:

[0009] The present invention provides a polypeptide targeting NPAT protein, which is a truncated form of NPAT protein, and the amino acid sequence of the polypeptide is

[0010] MLLPSDVARLVLGYLQQENLISTCQTFILESSDLKEYAEHCTDEGFIPAC.

[0011] The present invention also provides a gene encoding the polypeptide. Preferably, the nucleotide sequence of the gene is as shown in SEQ ID No.6.

[0012] The present invention also provides a delivery system containing the gene.

[0013] Delivery is carried out through any one or more of the following delivery systems:

[0014] a) Delivery with a plasmid vector;

[0015] b) Delivery with a viral vector, including but not limited to adeno-associated virus vectors, retroviral vectors, etc.;

[0016] c) Delivery with a non-viral vector, such as liposome delivery, polymer delivery, etc.;

[0017] d) Delivery with nanoparticles, including inorganic nanoparticles, polymer nanoparticles, etc.;

[0018] e) Direct mRNA delivery, where the mRNA encodes the polypeptide described above. The mRNA serves as a direct template for gene expression and can be translated into protein within the cell, thus enabling the rapid production of gene products.

[0019] The present invention also provides the use of the polypeptide described above, or the gene described above, in inhibiting the proliferation of tumor cells.

[0020] In some embodiments of the present invention, the tumor cells are tumor cells with abnormally rapid proliferation, including but not limited to breast cancer cells or lymphoma cells.

[0021] The present invention also provides the use of the polypeptide described above, or the gene described above, in the preparation of anti-tumor drugs.

[0022] In some embodiments of the present invention, the tumor is tumor cells with abnormally rapid proliferation, including but not limited to breast cancer or lymphoma.

[0023] The present invention also provides a pharmaceutical composition, comprising the polypeptide described above and a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient is selected from excipients, auxiliary materials, fillers, sweeteners, disintegrants, wetting agents, and lubricants.

[0024] The polypeptide provided by the present invention was discovered in the study of the regulatory mechanism of the formation of a membraneless organelle in the cell nucleus - the histone body. Overexpressing this polypeptide in cells can effectively inhibit the aggregation of NPAT in the cell, thereby inhibiting the formation of the histone body and downregulating the expression of histone genes. Using the CCK8 assay and colony formation assay, it can be observed that this polypeptide has an obvious effect of inhibiting the proliferation of tumor cells. The polypeptide of the present invention is the amino acid sequence of the N-terminal 1-50 of the NPAT protein, which can effectively interfere with the normal function of NPAT in regulating histone transcription and hinder the normal progression of the cell cycle. It has application prospects in the pharmaceutical field and can provide new design ideas for the development of drugs that inhibit the abnormal proliferation of tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1The LisH and SIF sequences at the N-terminus of the NPAT protein are the key regions mediating the interaction of NPAT to form condensates: A. The amino acid sequence at the N-terminus of NPAT contains LisH and SIF domains. B. Schematic diagrams of three mutants: N-terminal truncated mutant of NPAT, LisH-deleted mutant at the N-terminus of NPAT, and SIF-deleted mutant at the N-terminus of NPAT. C. Co-immunoprecipitation analysis to detect Figure 1 the self-interaction of the three mutants in B. D. In vitro phase separation experiment to detect Figure 1 the phase separation of the three mutants in B.

[0026] Figure 2 The 1-50 amino acid sequence at the N-terminus of NPAT can inhibit the formation of histone bodies: A. Immunofluorescence staining experiments showed that overexpression of the 1-50 amino acid sequence at the N-terminus of NPAT significantly inhibited the condensation at the N-terminus of NPAT. Scale bar: 10 μm. B. Immunofluorescence staining experiments showed that overexpression of the 1-50 amino acid sequence at the N-terminus of NPAT significantly inhibited the formation of histone bodies. Scale bar: 10 μm.

[0027] Figure 3 The 1-50 amino acid sequence at the N-terminus of NPAT can inhibit the transcription of histone genes: The results of fluorescence quantitative PCR showed that the 1-50 amino acid sequence at the N-terminus of NPAT significantly inhibited the expression of histone genes.

[0028] Figure 4 The polypeptide derived from NPAT can inhibit cell proliferation: A. CCK8 experiments showed that the polypeptide derived from the N-terminus of NPAT could significantly inhibit the proliferation of MCF-7 cells. B. Colony formation experiments showed that the polypeptide derived from the N-terminus of NPAT could significantly inhibit the proliferation of MCF-7 cells. Detailed implementation methods

[0029] Example 1: In vitro phase separation experiment of NPAT

[0030] The in vitro phase separation experiment of NPAT was the same as that in Example 1 of the patent with the publication number CN118373895A.

[0031] Example 2: Construction of expression plasmids for the N-terminal sequence of NPAT and the 1-50 amino acid sequence

[0032] Construct relevant vectors using the pXJ40-FLAG plasmid. Design primers for the NPAT N-terminal sequence and the 1-50 amino acid sequence. The primer sequences are shown in Table 1. Use PCR to amplify the relevant DNA fragments. At the same time, digest the DNA fragments and the pXJ40-FLAG plasmid with enzymes, and use ligase for ligation, transformation, and detection of correct clones. Finally, obtain the relevant vectors. The specific cloning method is the same as that in Example 2 of the patent with the publication number CN118373895A.

[0033] The amino acid sequence of the 1-430 of the NPAT N-terminal is shown in SEQ ID No.1, and the corresponding nucleotide sequence is shown in SEQ ID No.4;

[0034] The amino acid sequence of the 1-90 of the NPAT N-terminal is shown in SEQ ID No.2, and the corresponding nucleotide sequence is shown in SEQ ID No.5.

[0035] The amino acid sequence of the 1-50 of the NPAT N-terminal is shown in SEQ ID No.3, and the corresponding nucleotide sequence is shown in SEQ ID No.6.

[0036] The amino acid sequence of the 1-90 of the NPAT protein contains the LisH and SIF domains ( Figure 1 A). We constructed N-terminal truncated mutants, N-terminal LisH domain-deleted mutants, and N-terminal SIF domain-deleted mutants of NPAT ( Figure 1 B). The deletion mutants were cloned using homologous recombination to remove them. The operation is as follows: Design forward primers and their reverse complementary primers so that the primer sequences contain the sequences upstream and downstream of the deleted fragment at the same time (the sequence corresponding to the forward primer is the 15 nucleotide sequences upstream and downstream of the deleted fragment, and the reverse primer is the complementary sequence of the forward primer). The primer sequences are shown in Table 1. Use the plasmid of the NPAT N-terminal (containing the 1-430 amino acid sequence) as a template for PCR amplification, and the obtained PCR product can be ligated by homologous recombinase to obtain the plasmid with the deleted fragment removed.

[0037] The amino acid sequence of the LisH domain of the NPAT N-terminal is shown in SEQ ID No.7, and the corresponding nucleotide sequence is shown in SEQ ID No.9.

[0038] The amino acid sequence of the SIF domain of the NPAT N-terminal is shown in SEQ ID No.8, and the corresponding nucleotide sequence is shown in SEQ ID No.10.

[0039] Table 1

[0040] Primer Sequence (5’-3’) NPAT-N1-430F CGCGGATCCATGATGTTGTTACCCTCGGAC NPAT-N1-430R CGGCTCGAGTTATGTTTTAAAGGCCTTTTT NPAT-N1-50F CGCGGATCCATGATGTTGTTACCCTCGGAC NPAT-N1-50R CGGCTCGAGTTAGCAGGCTGGAATAAACCC NPAT-N-ΔLisH F GATAAGTCCGGATCCGAATATGCAGAACAT NPAT-N-ΔLisH R ATGTTCTGCATATTCGGATCCGGACTTATC NPAT-N-ΔSIF F TTATTTGGAAAAAACGACCATACACTTTCT NPAT-N-ΔSIF R AGAAAGTGTATGGTCGTTTTTTCCAAATAA

[0041] Example 3: Detection of the self-interaction of the NPAT N-terminal truncated protein and its deletion mutants by immunoprecipitation assay

[0042] Inoculate cells into a 6-well cell culture plate and transfect with the vector plasmid containing the cDNA of the target gene in Example 2. After culturing overnight, lyse the cells with lysis buffer (1% sodium deoxycholate, 200 mM NaCl, 60 mM Tris-HCl pH 7.3, 0.75 mM EDTA, 25 mM phosphatase inhibitor, 1% Triton-X-100, 0.2% sodium fluoride, 5 mM sodium orthovanadate, protease inhibitor), and then centrifuge at 15000 rpm. Add 15 μL of m2-FLAG beads to the supernatant, incubate for 2 - 4 hours, and then wash the beads with cell lysis buffer. Add Loading buffer to the sample and detect protein interaction by Western-blot.

[0043] The results are as Figure 1 shown in C. Deletion of LisH or SIF sequence results in the loss of self-interaction ability of the NPAT N-terminal truncated protein, and thus phase separation cannot occur (consistent with the in vitro phase separation experiment results, Figure 1 D).

[0044] Example 4: Detection of the effect of NPAT-derived polypeptides on the aggregation of the NPAT N-terminus and the formation of histone matrix by immunofluorescence staining

[0045] Place cover slips in a 24-well cell culture plate in advance, inoculate cells and culture overnight. Use the lipofectamine kit to transfect the plasmid containing the target gene in Example 2 into the cells and leave overnight. The next day, wash the cells with PBS solution. After fixing the cells with a fixing solution (3% Paraformaldehyde) for 30 minutes, wash the cells with PBS, and add PBS solution containing 0.1% Saponin to permeabilize the cells. Subsequently, add specific primary antibodies (rabbit anti-FLAG monoclonal antibody, Wuhan Abbkine Biological Co., Ltd., catalog number: AE092; mouse anti-NPAT antibody, BD Biosciences, catalog number: 611344; rabbit anti-Myc polyclonal antibody, Hangzhou Huaan Biotechnology Co., Ltd., catalog number R1208-1; mouse anti-FLAG monoclonal antibody, Shanghai Yeasen Biotechnology Co., Ltd., catalog number 30505ES60), incubate for 3-6 hours, and then wash 3 times with PBS. Then add fluorescently labeled secondary antibodies (goat anti-rabbit-Alexa Fluor 555, Thermo Fisher Scientific, catalog number: A-32732; goat anti-mouse-Alexa Fluor 488, Thermo Fisher Scientific, catalog number: A-32723), wash clean after 1 hour, carefully clamp out the slides and invert them on the glass slides. After sealing with 20 μL of Fluoresafe reagent, observe and take pictures using a confocal microscope.

[0046] The NPAT protein undergoes phase separation to form condensates through self-interaction. Therefore, inhibiting the self-interaction of NPAT will inhibit the occurrence of its phase separation. Since LisH is the key region mediating the interaction of NPAT, we hypothesized that a polypeptide derived from the LisH domain (i.e., a polypeptide of the 1-50 amino acid sequence at the N-terminus of NPAT) should be able to bind to NPAT, interfere with its self-interaction by competitive binding, and block the formation of histone locus bodies (HLBs). Immunofluorescence staining analysis showed that the 1-50 amino acid sequence of NPAT not only inhibited the aggregation of the N-terminus of NPAT ( Figure 2 A), but also inhibited the condensation of endogenous NPAT and the formation of histone matrixes could not occur ( Figure 2 B).

[0047] Example 5: Detection of the effect of NPAT-derived polypeptide on histone transcription by fluorescence quantitative PCR

[0048] Culture cells overnight in a 6-well cell culture dish. Transfect the relevant vector containing the target gene constructed into the cells using lipofectamine and place it in 5% CO 2Cultivate at 37°C in an incubator for 24 - 48 h, and extract RNA using the AFTSpin Tissue / Cell Fast RNA Extraction Kit (purchased from Abclonal). Take 1 μg of RNA and perform reverse transcription using the ABScriptIII RT Master Mix for qPCR with gDNA Remover kit (purchased from Abclonal). Dilute the obtained sample to 100 μl with DEPC H 2 O. Take 5 μl of the obtained reverse transcription product as a template and perform real-time quantitative PCR reaction using 2×Universal SYBR Green Fast qPCR Mix (purchased from Abclonal). Detect the PCR fluorescence signal using a LightCycler480II real-time fluorescence quantitative PCR instrument. Process and analyze the obtained results using Excel and Graphpad Prism.

[0049] The results are as Figure 3 shown. Consistent with the results of Example 4, overexpression of the 1 - 50 amino acid sequence at the N-terminus of NPAT in MCF-7 cells can significantly downregulate the expression of histone genes.

[0050] Example 6: The polypeptide derived from NPAT significantly inhibits the proliferation of MCF-7 cells

[0051] Since the 1 - 50 amino acid sequence at the N-terminus of NPAT can significantly inhibit the expression of histone genes, we predict that this polypeptide can inhibit cell proliferation. CCK8 experiments and colony formation experiments were used to verify the inhibitory effect of the polypeptide on tumor cell proliferation.

[0052] 1. CCK8 experiment

[0053] After culturing for 24 hours, the cells are in the logarithmic phase. Digest the cells with trypsin, collect and prepare cell suspensions with 5 - 7 concentration gradients. Add 100 μl of the suspension to each well of a 96-well culture plate, with 4 - 6 replicates per group. The cells can adhere to the wall 2 - 4 h after inoculation. Add 10 μl of CCK-8 reagent to each culture well. After 1 hour, measure the absorbance at OD450nm using an enzyme-linked immunosorbent assay (ELISA) reader to make a standard curve. At the same time, inoculate cells on a 96-well culture plate, with 1000 cells in each of the control group and the experimental group, 100 μl of medium per well, and 4 - 6 replicates per group. After culturing for 24, 48, 72, and 96 h respectively, add 10 μl of CCK-8 reagent to each culture well. After 1 hour, measure the absorbance at OD450nm using an ELISA reader. Process and analyze the obtained results using Excel and Graphpad Prism.

[0054] 2. Colony formation experiment

[0055] Cells in the logarithmic growth phase were digested with 0.25% trypsin and resuspended in high-glucose DMEM medium containing 10% fetal bovine serum to prepare a gradient-fold cell suspension. The cells were evenly suspended at a density of 500 and 1000 cells per well in culture dishes containing 5 ml of medium. Each group was repeated in 3 culture dishes and placed in an incubator at 37 °C, 5% CO 2 and saturated humidity for 1-2 weeks. The medium was changed every 3 days during the period and the cell morphology was observed. When the cell clones were visible to the naked eye, the supernatant was discarded, and then the cells were washed twice with PBS. 5 ml of 4% paraformaldehyde was added to each well for fixation for 15 minutes. After removing the fixing solution, crystal violet staining solution was added for staining. After 15 minutes, the cells were washed 3-4 times with PBS. After air drying, the culture dishes were photographed with a digital camera and the number of clones was counted. Finally, the results were analyzed using Graphpad Prism.

[0056] The experimental results showed that whether it was the CCK8 assay ( Figure 4 A) or the colony formation assay ( Figure 4 B), it was confirmed that the polypeptide with a size of 1-50 amino acids derived from NPAT could significantly inhibit the proliferation of MCF-7 cells.

[0057] In summary, the research results of the present invention showed that this polypeptide derived from NPAT could affect NPAT aggregation by interfering with the self-interaction of NPAT, making it unable to initiate the formation of histone substrates, thereby inhibiting cell proliferation and having good application prospects in the medical field.

Claims

1. A polypeptide targeting NPAT protein, characterized in that: It is a truncated form of NPAT protein, and the amino acid sequence of the polypeptide is MLLPSDVARLVLGYLQQENLISTCQTFILESSDLKEYAEHCTDEGFIPAC.

2. A gene encoding the polypeptide according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID No.

6.

4. A delivery system comprising the gene according to claim 2 or 3.

5. The delivery system according to claim 4, characterized in that Delivered via any one or more of the following delivery systems: a) delivery by plasmid vector; b) delivery by viral vectors; c) delivery by non-viral vectors; d) delivery via nanoparticles; e) Direct mRNA delivery.

6. Use of the polypeptide according to claim 1 or the gene according to claim 2 or 3 in inhibiting tumor cell proliferation.

7. The use according to claim 6, characterized in that The tumor cells are abnormally rapidly proliferating tumor cells.

8. Use of the polypeptide according to claim 1 or the gene according to claim 2 or 3 in the preparation of anti-tumor drugs.

9. The use according to claim 8, characterized in that The tumor is an abnormally fast-proliferating tumor cell.

10. A pharmaceutical composition, characterized in that The invention comprises the polypeptide according to claim 1 and pharmaceutically acceptable excipients.

Images