A complex enzyme and its application in corn-soy meal type feed production
By adding a complex enzyme of acidic pectinase, cellulase and xylanase to corn-soybean meal feed, the problem that non-starch polysaccharides in feed ingredients such as corn and soybean meal cannot be digested by livestock and poultry has been solved, thereby improving feed digestibility and metabolizable energy, improving the production performance of livestock and poultry, and reducing feed costs.
Patent Information
- Application Number
- CN202510254512.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2045-03-05
AI Technical Summary
Non-starch polysaccharides in feed ingredients such as corn and soybean meal cannot be digested by livestock and poultry, resulting in low nutrient utilization, increased digest viscosity, and impaired livestock and poultry production performance.
A compound enzyme, including acidic pectinase, cellulase, and xylanase, is used and added to corn-soybean meal feed through proper blending to improve the dry matter utilization rate and reduce the viscosity of the digesta.
It significantly improves the digestibility and metabolizable energy of corn-soybean meal feed, enhances livestock and poultry production performance, reduces feed costs, and increases production efficiency.
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of feed additive production, in particular to a compound enzyme and its application in corn-soybean meal type feed production. BACKGROUND
[0002] In recent years, with the high price of corn and soybean meal, the cost of feed has increased substantially. On the one hand, the use of unconventional feed raw materials can replace corn and soybean meal to reduce the use of corn and soybean meal; on the other hand, the addition of enzyme preparations in corn-soybean meal type feed can improve feed conversion efficiency and improve animal production performance, thereby achieving the purpose of increasing efficiency.
[0003] Corn and soybean meal are commonly used feed raw materials in livestock and poultry diets. Although their utilization rate is higher than that of unconventional feed raw materials, more than 10% of the nutrients in corn and more than 30% of the nutrients in soybean meal cannot be utilized by livestock and poultry animals. Therefore, by adding exogenous enzyme preparations, the potential nutritional value of corn-soybean meal type feed can be further tapped to achieve the purpose of reducing cost and increasing efficiency in livestock and poultry breeding.
[0004] Corn and soybean meal both belong to plant feed raw materials, and the cell wall is composed of non-starch polysaccharides such as cellulose, xylan, and pectin. In particular, the pectin content in cake and meal type feed raw materials is relatively high. On the one hand, livestock and poultry cannot secrete enzymes to degrade non-starch polysaccharides in the digestive tract, and non-starch polysaccharides themselves cannot be utilized by animals. On the other hand, non-starch polysaccharides wrap nutrients such as protein and starch in cells, which cannot be well contacted with endogenous enzymes. In addition, soluble non-starch polysaccharides can increase the viscosity of chyme and reduce the speed of chyme through the digestive tract, causing problems such as feces. Therefore, by adding non-starch polysaccharide enzymes such as xylanase, cellulase, and pectinase in corn-soybean meal type diets, the negative effects of non-starch polysaccharides can be reduced, the feed utilization rate of livestock and poultry can be improved, and the production performance of livestock and poultry can be improved. SUMMARY
[0005] The purpose of the present application is to provide a compound enzyme and its application in corn-soybean meal type feed production. The compound enzyme is specially designed for the nutritional characteristics of corn-soybean meal type diets, which can effectively improve the digestibility and metabolic energy of livestock and poultry to feed, and has a good effect on reducing chyme viscosity, thereby improving the potential nutritional value of corn-soybean meal type feed.
[0006] The present application relates to a compound enzyme, which comprises an acid pectinase.
[0007] The acid pectinase has an amino acid sequence of SEQ ID NO: 9.
[0008] The compound enzyme further comprises cellulase and xylanase.
[0009] The components and their weight percentages in the complex enzyme are as follows: 10-20 parts acidic pectinase, 10-20 parts cellulase, and 10-25 parts xylanase.
[0010] More preferably, the components and their weight proportions in the complex enzyme are as follows: 18 parts acidic pectinase, 15 parts cellulase, and 10-25 parts xylanase.
[0011] More preferably, the components and their weight proportions in the complex enzyme are as follows: 18 parts acidic pectinase, 15 parts cellulase, and 15 parts xylanase.
[0012] The present invention also provides the application of the compound enzyme in feed production.
[0013] The feed contains corn and soybean meal.
[0014] The amount of the compound enzyme added is 200-300 grams per ton of feed.
[0015] The compound enzyme provided by this invention, through the rational combination of acidic pectinase, cellulase, and xylanase, can effectively improve the dry matter utilization rate and in vitro metabolizable energy of corn-soybean meal feed, reduce digesta viscosity, and thus promote the efficient digestion and absorption of corn-soybean meal feed by livestock and poultry, maximizing the utilization of the nutritional value of corn-soybean meal feed and reducing feed costs. Compared with the corn-soybean meal diet group, adding 200g / t of compound enzyme #3 can increase the egg production rate of laying hens by 1.19%, reduce the feed conversion ratio by 0.06, increase the average egg weight by 0.55g, and significantly improve egg quality. This demonstrates that the compound enzyme described in this invention can significantly improve the production performance of laying hens fed a corn-soybean meal diet, help reduce livestock and poultry breeding costs, improve production efficiency, and has broad application prospects. Detailed Implementation
[0016] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLSIN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:
[0017] Strains and plasmids: Escherichia coli DH5α, Amp, etc. were purchased from Invitrogen.
[0018] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.
[0019] The culture medium formulation in the examples is as follows:
[0020] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0021] LB+Amp medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0022] LB+Amp plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.
[0023] The xylanase described in this embodiment of the invention can be purchased from Weifang Kangdian Biotechnology Co., Ltd., with an enzyme activity of 100,000 u / g; the cellulase can be purchased from Weifang Kangdian Biotechnology Co., Ltd., with an enzyme activity of 10,000 u / g.
[0024] The present invention will be further illustrated below with reference to the embodiments.
[0025] Example 1 Cloning of the acid pectinase gene
[0026] Using the Aspergillus niger Su genome as a template, an acidic pectinase gene fragment was amplified using primers 1 and 2. This acidic pectinase was named PG, and its nucleotide sequence is SEQ ID NO: 1, while its encoded amino acid sequence is SEQ ID NO: 2.
[0027] The PCR primers and reaction conditions are as follows:
[0028] Primer 1 (F): ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 3);
[0029] Primer 2 (R): TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 4).
[0030] The reaction conditions were: denaturation at 94℃ for 5 min; followed by denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 60 s, for 30 cycles, and then incubation at 72℃ for 10 min. Agarose gel electrophoresis results showed that the amplified acidic pectinase gene was 1160 bp in size.
[0031] Example 2 Construction of recombinant plasmids
[0032] The acidic pectinase gene was amplified by PCR, with Xba I sites introduced at both ends of the primers. The primer sequences are as follows:
[0033] Primer 3 (F): GC TCTAGA ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 5);
[0034] Primer 4(R): GC TCTAGA TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 6).
[0035] The PCR reaction conditions were: denaturation at 94℃ for 5 min; followed by denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 60 s, for 30 cycles, and then incubation at 72℃ for 10 min. Agarose gel electrophoresis results showed that the acid pectinase gene was a 1160 bp fragment.
[0036] The acidic pectinase gene fragment and expression plasmid pSU obtained above were digested with restriction endonuclease XbaI, respectively. The digestion conditions are shown in Table 1.
[0037] Table 1 Enzyme digestion system
[0038] PCR fragment enzyme cutting system (50 μL) Plasmid pSU enzyme cutting system (50 μL) PCR fragment 20 μL pSU plasmid 20 μL 10*M 5 μL 10*M 5 μL BSA 5 μL BSA 5 μL XbaI 2 μL XbaI 2 μL ddH2O 18 μL ddH2O 18 μL
[0039] The DNA fragments were digested at 37°C for 2 hours. After electrophoresis, the two target fragments were recovered and dissolved in 20 μL ddH2O. Ligation was performed using T4 DNA ligase; the ligation system is shown in Table 2.
[0040] Table 2 Connection System
[0041] PCR fragment 2 μL pSU 2 μL 10*Buffer 1 μL T4 DNA ligase 1 μL ddH2O 4 μL Total volume 10 μL
[0042] Ligation was performed at 22℃ for 1 hour, followed by transformation of E. coli DH5a competent cells. The cells were plated on LB+AMP plates and incubated overnight at 37℃. Single colonies grew after colony PCR verification. Plasmids were extracted from the correctly ligated transformants and sent for sequencing. After successful sequencing, the recombinant plasmid pSU-PG containing the acid pectinase gene was obtained.
[0043] Example 3 Screening of high-temperature resistant mutants
[0044] To further improve the heat resistance of acidic pectinase PG, the applicant conducted extensive mutation screening on the enzyme using directed evolution technology.
[0045] Design PCR primers F3 and R3:
[0046] F3: GC GAATTC ATGCCTTCTGCCAAGCCTTTG (SEQ ID NO: 7, underlined is the EcoRI restriction enzyme recognition site);
[0047] R3:TA GCGGCCGC TTACTGACTGCAGGAAGCGCC (SEQ ID NO: 8, underlined is the NotI restriction enzyme recognition site).
[0048] Using the PG gene (SEQ ID NO: 1) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a plasmid that had been digested with the same enzymes. The product was then transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing acid pectinase.
[0049] 30 μL of lysis buffer was transferred to two new 96-well plates. One plate was treated at 90 °C for 5 min. 30 μL of substrate was added to both 96-well plates and reacted at 40 °C for 10 min. The generated galacturonic acid was determined by the DNS method. Different mutants maintained different activities after high-temperature treatment.
[0050] Experimental results showed that some mutations had no effect on the thermostable properties of acidic pectinase PG, while others even worsened its thermostable properties or enzyme activity. Additionally, some mutations, although improving the temperature tolerance of acidic pectinase, significantly altered its enzymatic properties, which did not meet the requirements. Ultimately, the mutation site S98E was found to significantly improve the thermostable properties of acidic pectinase without affecting its enzyme activity and original enzymatic properties.
[0051] Based on the above-mentioned wild-type acidic pectinase PG, this invention provides a mutant containing a single S98E mutation site, the amino acid sequence of which is SEQ ID NO: 9.
[0052] Example 4 Recombinant Expression of Acidic Pectinase
[0053] Following the method described in Example 2, the screened mutants were amplified by PCR using primers F2 and R2, digested with Xba I, and then ligated with the pSu plasmid digested with the same enzyme. The resulting plasmid was then transformed into *E. coli* DH5α, plated on LB+Amp plates, and incubated upside down at 37°C. After transformants appeared, colony PCR was performed (reaction system: single clones picked from the template, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5' AOX primer (10 mM): 0.5 μL, 3' AOX primer: 0.5 μL, ddH2O 14.5 μL; reaction program: 95°C pre-denaturation for 5 min, 30 cycles: 94°C 30 sec, 55°C 30 sec, 72°C 2 min, 72°C 10 min). Positive clones were verified by sequencing, yielding the correct mutant recombinant expression plasmid.
[0054] 4.1 Protoplast preparation:
[0055] Inoculate the *Aspergillus niger* host strain onto PDA+U (potato 200 g / L, boiled for 20-30 min and filtered to remove residue; glucose 2%; uridine 1%; agar powder 1.5%) plates and incubate at 30℃ for 5-7 days. Cut 2 cm × 2 cm mycelial blocks and inoculate them into 100 mL of liquid PDA+U (potato 200 g / L, boiled for 20-30 min and filtered to remove residue; glucose 2%; uridine 1%) medium and incubate at 30℃ for 16 h to grow mycelium for transformation. Filter the grown mycelium and resuspend it in 20 mL of 1.2 M magnesium sulfate solution. Add 0.2 g of lysozyme and incubate at 30℃ and 100 rpm for 2-3 h. Filter the lysed mycelium through two layers of lens paper and centrifuge at 3000 rpm for 10 min to obtain protoplasts. Filter the lysed mycelium through lens paper and centrifuge to obtain protoplasts. Resuspend the protoplasts in an appropriate amount of sorbitol solution.
[0056] 4.2 Transformation:
[0057] The obtained Aspergillus niger host protoplasts were washed twice with 1.2M sorbitol solution, and then resuspended in an appropriate amount of sorbitol solution to achieve a protoplast concentration of 10. 8 per mL; add 10 μL of prepared recombinant plasmid to each 200 μL protoplast, add 50 μL of 25% PEG6000, incubate on ice for 20 min, then add 2 mL of 25% PEG6000, and incubate at room temperature for 5 min; add 4 mL of sorbitol solution, mix by inversion, pour into 50 mL of transformation upper layer medium, and then pour into 4 transformation lower layer plates. After the upper layer medium solidifies, incubate upside down in a 30℃ incubator for 5 days.
[0058] 4.3 Transformer Screening:
[0059] After 5 days of cultivation, the grown colonies were selected and inoculated onto the lower layer of transformation plates for re-screening, and then incubated at 30℃ for 3 days. Normally growing transformants were inoculated onto fresh PDA plates and incubated at 30℃ for 5-7 days. A 2cm × 2cm piece was cut from each transformant and inoculated into 50mL of liquid shake flask medium (maltose 12%; corn steep liquor 1.5%; ammonium sulfate 0.5%; magnesium sulfate 0.3%; potassium sulfate 0.37%; calcium chloride 0.1125%; trace elements 0.1%) for fermentation, and incubated at 30℃ for 5 days. After 5 days of cultivation, the supernatant obtained by centrifugation was the crude enzyme solution, which was analyzed by SDS-PAGE protein electrophoresis and acid pectinase activity assay.
[0060] 4.4 Detection of Acidic Pectinase Activity
[0061] (1) Definition of acid pectinase enzyme activity unit
[0062] Under conditions of 40℃ and pH 4.5, the amount of enzyme that hydrolyzes polygalacturonic acid to produce 1 μmol of galacturonic acid per minute is defined as one unit of enzyme activity, U.
[0063] (2) Enzyme activity assay method
[0064] Polygalacturonic acid solution (0.5%): Weigh 0.5g of sodium polygalacturonate, place a suitable beaker containing 80mL of water on a heated magnetic stirrer, keep stirring and slowly add sodium polygalacturonate. After it is basically dissolved, turn on the heater of the magnetic stirrer to 80℃ and keep it for 2min. After the sodium polygalacturonate is completely dissolved (becomes transparent), immediately transfer the beaker to a cold water bath and cool it to room temperature. Add 5mL of 1mol / L sodium acetate buffer to the beaker, and then make up to 100mL with water.
[0065] Galacturonic acid solution (1%): Dry D-galacturonic acid in an oven at 60℃ until constant weight, then accurately weigh 0.5g, dissolve in 0.05mol / L sodium acetate buffer and bring the volume up to 50mL.
[0066] Enzyme solution: Dilute with 0.05 mol / L sodium acetate buffer at pH 4.5 to an appropriate multiple, and control the absorbance value in the range of 0.28-0.33.
[0067] Construction of the galacturonic acid standard curve: Prepare 0, 0.2, 0.4, 0.6, 0.8, and 1.0 mL of 1% galacturonic acid standard solution, respectively, and bring the volume to 10 mL with 0.05 mol / L sodium acetate buffer to obtain the standard point solutions. Take 0.5 mL of each of the above standard point solutions, add 0.5 mL of polygalacturonic acid substrate solution, and then add 2 mL of DNS stop solution. Mix well and place all test tubes in a boiling water bath for 5 min. Then remove the water bath and cool to room temperature. Add 5 mL of water to all test tubes, mix well, transfer the solution to 10 mL centrifuge tubes, centrifuge at 4000 rpm for 10 min, and take the supernatant to read the absorbance at 540 nm using a spectrophotometer.
[0068] Plot the standard curve Y=kX+b with absorbance value as the ordinate (Y) and galacturonic acid concentration (μmol / mL) as the abscissa (X).
[0069] Assay: Add 0.5 mL of diluted enzyme solution to the reaction tube and blank tube, and place the reaction tube and blank tube in a 40°C water bath for 3 min. Then, at regular time intervals, add 0.5 mL of polygalacturonic acid solution that has been preheated for 5 min to the reaction tube, mix well, and time the reaction for 10 min. Finally, stop the reaction by adding 2 mL of DNS solution to all reaction tubes at the same time intervals, and add 0.5 mL of polygalacturonic acid solution to the blank tube.
[0070] All test tubes were boiled in a water bath for 5 minutes, then removed from the water bath and cooled to room temperature. 5 mL of water was added to each test tube, and the mixture was thoroughly combined. The test tubes were then transferred to 10 mL centrifuge tubes and centrifuged at 4000 rpm for 10 minutes. The supernatant was collected and the absorbance was read at 540 nm using a spectrophotometer. The difference in absorbance between the reaction tube and the blank tube was recorded as A.
[0071] Enzyme activity calculation formula: U=[(Ab)×n] / (10×k).
[0072] In the formula:
[0073] U – Enzyme activity of the sample, expressed in U / mL;
[0074] A – The difference in absorbance between the sample blank and the sample blank;
[0075] k — the slope of the standard curve;
[0076] b—the intercept of the standard curve;
[0077] n—dilution factor;
[0078] 10 — Reaction time, 10 min;
[0079] Example 5: Heat resistance analysis of acidic pectinase mutant
[0080] The fermentation supernatant of the recombinant Aspergillus niger strain expressing acidic pectinase PG and its mutants obtained above was diluted to approximately 200 U / mL with acetate-sodium acetate buffer at pH 4.5. After treatment at 80℃ for 3 min, the residual enzyme activity was measured. The enzyme activity of the untreated sample was taken as 100%, and the residual enzyme activity rate was calculated. The specific results are shown in Table 3.
[0081] Table 3. Heat resistance analysis of acidic pectinase mutants
[0082] Acid pectinase Residual rate of enzyme activity after 3 min treatment at 80℃ Wild type PG 32.00% S98E single-point mutant 86.48%
[0083] As shown in Table 3, compared with wild-type acidic pectinase PG, the acidic pectinase mutant containing a single S98E mutation site showed a 54.48% increase in enzyme activity residual rate and significantly enhanced heat resistance after treatment at 80℃ for 3 min, achieving unexpected technical results.
[0084] In summary, the acidic pectinase mutant provided by this invention has stronger heat resistance and is more suitable for application in feed, food processing and other fields.
[0085] The applicant named the acidic pectinase mutant containing a single S98E mutation site "acidic pectinase MY". The recombinant Aspergillus niger strain expressing this mutant was scaled up for production, yielding a solid product of acidic pectinase MY with an enzyme activity level of 1000 u / g.
[0086] Example 6 A composite enzyme and its preparation method
[0087] A complex enzyme, the components and their contents are as follows: acidic pectinase MY 13kg, cellulase 15kg, xylanase 25kg. This is complex enzyme #1.
[0088] The above-mentioned complex enzyme was obtained by weighing each component of the complex enzyme according to the above proportions and then mixing each component thoroughly.
[0089] Example 7 A composite enzyme and its preparation method
[0090] A compound enzyme, the components and their contents are as follows: acidic pectinase MY 18kg, cellulase 20kg, xylanase 15kg. This is compound enzyme #2.
[0091] The preparation method of the above-mentioned complex enzyme is the same as that in Example 6.
[0092] Example 8 A composite enzyme and its preparation method
[0093] A compound enzyme, the components and their contents are as follows: acidic pectinase MY 18kg, cellulase 15kg, xylanase 15kg. This is compound enzyme #3.
[0094] The preparation method of the above-mentioned complex enzyme is the same as that in Example 6.
[0095] Example 9: Evaluation of the application effect of the compound enzyme
[0096] This embodiment evaluates the application effect of the composite enzyme described in this invention by using a biomimetic digestion system for monogastric animals to conduct a biomimetic digestion experiment.
[0097] The monogastric animal biomimetic digestive system is an automated device designed and developed by the Chinese Academy of Agricultural Sciences to simulate the digestive capacity of the gastrointestinal tract of monogastric animals. In addition to its advantages such as high efficiency, good stability and low variability, more importantly, it has a good correlation with traditional animal experiments and is currently a widely recognized evaluation method in the industry.
[0098] Materials and Methods
[0099] 1.1 Test Samples
[0100] The experimental samples used were the No. 1 compound enzyme, No. 2 compound enzyme, and No. 3 compound enzyme described in Examples 6-8.
[0101] The feed used is a corn-soybean meal diet.
[0102] 1.2 Experimental Grouping
[0103] This experiment used a chicken system based on a monogastric animal biomimetic digestive apparatus, with 5 replicates per group. The specific group design is shown in Table 4.
[0104] Table 4 Experimental group design
[0105] Group Composite enzyme addition Control group Corn-soybean meal type diet Test group 1 Corn-soybean meal type diet with the addition of 200 g / t 1# composite enzyme Test group 2 Corn-soybean meal type diet with the addition of 200 g / t 2# composite enzyme Test group 3 Corn-soybean meal type diet with the addition of 200 g / t 3# composite enzyme
[0106] 1.3 Measurement Indicators
[0107] Based on the operating instructions for a monogastric animal bionic digester, the dry matter digestibility and the energy value of the enzyme hydrolysate were determined.
[0108] 1.4 Data Processing and Analysis
[0109] Experimental data were analyzed using ANOVA in SPSS 19.0 statistical software. All indicators were analyzed on a replicate-by-replication basis, and LSD multiple comparisons were used for testing. Results are expressed as mean and standard deviation; P < 0.05 was considered statistically significant.
[0110] 2 Results and Analysis
[0111] Table 5 Results of biomimetic digestion in chicken system
[0112] Group Dry matter digestibility (%) Enzymatic hydrolysate energy value (kcal / kg) Control group 77.95 c ±0.60]]> 3587 c ±13]]> Test group 1 78.81 ab ±0.42]]> 3624 ab ±9]]> Test group 2 78.62 b ±0.34 3616 b ±18]]> Test group 3 79.12 a ±0.29 3640 a ±20]]>
[0113] Note: Numbers in the table with the same letter in the upper right corner indicate no significant difference (P>0.05), while numbers with different letters indicate significant difference (P<0.05).
[0114] As shown in Table 5, compared with the control group, the dry matter digestibility of the corn-soybean meal diets supplemented with enzymes #1-#3 increased by 0.86%, 0.67%, and 1.17%, respectively, and the energy values of the enzyme hydrolysates increased by 37 kcal / kg, 29 kcal / kg, and 53 kcal / kg, respectively. This demonstrates that the compound enzymes provided by this invention can significantly improve the digestion, absorption, and utilization of corn-soybean meal diets by chickens, thereby increasing their energy utilization efficiency. Among them, enzyme #3 showed the best effect.
[0115] Example 10 Evaluation of the application effect of compound enzymes in laying hen farming
[0116] 1. Materials and Methods
[0117] 1.1 Test Samples
[0118] The test sample was the No. 3 compound enzyme described in Example 8.
[0119] 1.2 Experimental Grouping
[0120] This experiment selected 800 healthy laying hens with similar body weight and feed intake, and randomly divided them into two groups, with 10 replicates in each group and 40 hens in each replicate: a blank control group and an experimental group. The blank control group was fed a basal diet, while the experimental group was fed a basal diet supplemented with 200g / t of No. 3 compound enzyme. The pre-feeding period was 7 days, and the formal trial period was 56 days.
[0121] The specific grouping design is shown in Table 6.
[0122] Table 6 Experimental Group Design
[0123] Group Diet type Control group Corn-soybean meal type diet Test group Corn-soybean meal type diet + 200 g / t 3# composite enzyme
[0124] 1.3 Measurement Indicators
[0125] At the end of the experiment, six eggs were randomly collected from each replicate, and egg quality-related indicators were measured within 12 hours. Egg production rate, feed conversion ratio and other indicators for each group were also statistically analyzed.
[0126] 1.4 Data Processing and Analysis
[0127] Experimental data were analyzed using ANOVA in SPSS 19.0 statistical software. All indicators were analyzed on a replicate-by-replication basis, and LSD multiple comparisons were used for testing. Results are expressed as mean and standard deviation; P < 0.05 was considered statistically significant.
[0128] Results and Analysis
[0129] Experimental results:
[0130] Table 7. Effects of compound enzymes on egg quality and laying performance of laying hens.
[0131] As shown in Table 7, compared with the corn-soybean meal diet, the enzyme-added group showed a 1.19% increase in egg production, a 0.06 decrease in feed conversion ratio, a 0.55g increase in average egg weight, and improvements in eggshell thickness, Haugh unit, and albumen height, indicating a significant improvement in egg quality. This demonstrates that adding the compound enzyme described in this invention to a corn-soybean meal diet can effectively improve the production performance of laying hens and increase the profitability of laying hen farming.
[0132] In summary, the compound enzyme provided by this invention, through the rational combination of acidic pectinase, cellulase, and xylanase, can effectively improve the dry matter digestibility and in vitro metabolizable energy value of corn-soybean meal diets. By improving the digestibility of nutrients in feed, degrading non-starch polysaccharide components in cell walls, reducing the viscosity of intestinal digesta in livestock and poultry, and improving the egg production performance of laying hens, it maximizes the utilization of the nutritional value of corn-soybean meal diets, thereby enabling enterprises to reduce costs and increase efficiency.
Claims
1. A complex enzyme, characterized in that, The complex enzyme contains acidic pectinase; the amino acid sequence of the acidic pectinase is SEQ ID NO:
9.
2. The complex enzyme as described in claim 1, characterized in that, The complex enzyme also includes xylanase and cellulase.
3. The complex enzyme as described in claim 2, characterized in that, The components and their weight percentages in the complex enzyme are as follows: 10-20 parts acidic pectinase, 10-20 parts cellulase, and 10-25 parts xylanase.
4. The complex enzyme as described in claim 3, characterized in that, The components and their weight percentages in the complex enzyme are as follows: 18 parts acidic pectinase, 15 parts cellulase, and 10-25 parts xylanase.
5. The complex enzyme as described in claim 4, characterized in that, The components and their weight proportions in the complex enzyme are as follows: 18 parts acidic pectinase, 15 parts cellulase, and 15 parts xylanase.
6. The application of the compound enzyme according to any one of claims 1-5 in feed production.
7. The application as described in claim 6, characterized in that, The feed contains corn and soybean meal.
8. The application as described in claim 6 or 7, characterized in that, The amount of the compound enzyme added is 200-300 grams per ton of feed.
Citation Information
Patent Citations
Preparation of compound enzyme rich in acidic pectinase as well as strain and application of compound enzyme
CN111549020A