Application of tomato PAOL gene in regulation and control of botrytis cinerea resistance

Abstract

The invention provides application of a tomato PAOL gene in regulation and control of botrytis cinerea resistance, the nucleotide sequence of the tomato PAOL gene is as shown in a or b, in the formula, a is a sequence as shown in SEQ ID NO.1; and b is a sequence which is obtained by replacing, deleting and / or adding one or more nucleotides to the sequence as shown in SEQ ID NO.1 and can encode a protein with a function of regulating and controlling the botrytis cinerea resistance. A PAOL gene overexpression vector and an RNAi interference vector are respectively and stably transferred into a tomato plant, so that the application of the PAOL gene in regulating and controlling the resistance of the tomato to the gray mold is confirmed, and the PAOL gene is indicated to positively regulate and control the resistance of the tomato to the gray mold; the discovery provides a new target for subsequent improvement of tomato varieties and creation of anti-gray mold materials.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to application of a tomato PAOL gene in regulating resistance to tomato gray mold. Background Art

[0002] During its growth, tomatoes may be invaded by a variety of pathogens, among which Botrytis cinerea ( Botrytis cinerea ) is a common pathogenic fungus in low temperature and high humidity environments, which seriously threatens tomato yields. Botrytis cinerea, belonging to the genus Botrytis of the subphylum Deuteromycetes, can invade multiple organs such as stems, leaves, flowers and fruits of more than 200 plants, posing a huge threat to the yield and quality of fruits and vegetables worldwide. Botrytis cinerea reproduces rapidly under low temperature and high humidity conditions, invading plants through conidia and causing gray mold disease. The disease spreads from the leaf tip along the veins inward on the leaves. When the disease is severe, the stems, leaves and fruits of the plant appear water-soaked, the tissue softens, and a gray mold layer forms on the surface of the affected area. Botrytis cinerea can overwinter dormantly in the form of sclerotia or conidia, and germinate hyphae and produce conidia under suitable temperature and humidity conditions the following year.

[0003] Currently, tomato production primarily utilizes agricultural, physical, ecological, biological, and chemical control methods, with chemical control being the most widely used measure. However, excessive use of chemical fungicides poses numerous risks and hazards, primarily environmental pollution, food safety threats, and the development of antifungal strains.

[0004] Therefore, it is extremely urgent to study methods to prevent and control tomato gray mold, find and clone genes that are resistant to gray mold, and cultivate tomato varieties that are resistant to gray mold. Summary of the Invention

[0005] In view of this, the present invention provides the use of the tomato PAOL gene in regulating tomato gray mold resistance.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: One of the purposes of the present invention is to provide an application of a tomato PAOL gene in regulating resistance to tomato gray mold. The nucleotide sequence of the tomato PAOL gene is shown in a or b: a: sequence as shown in SEQ ID NO.1; b: The sequence shown in SEQ ID NO. 1 is replaced, deleted and / or added with one or more nucleotides and can encode a sequence having the function of regulating tomato gray mold resistance protein.

[0007] Furthermore, the application is specifically embodied as follows: when the PAOL gene is overexpressed in tomatoes, the resistance of tomatoes to gray mold can be significantly improved; when the expression of the PAOL gene in tomatoes is downregulated, the resistance of tomatoes to gray mold is significantly reduced.

[0008] A second object of the present invention is to provide an expression vector for expressing the protein encoded by the above gene, wherein the expression vector contains the tomato PAOL gene.

[0009] Furthermore, the primers for amplifying the PAOL gene when constructing the expression vector are shown in SEQ ID NO.2.

[0010] The third object of the present invention is to provide an engineered bacterium containing the above expression vector.

[0011] A fourth object of the present invention is to provide an interference vector for interfering with the expression of the above-mentioned gene, wherein the interference vector contains an interference fragment as shown in SEQ ID NO.3.

[0012] Furthermore, the primers for amplifying the interference fragment when constructing the interference vector are shown in SEQ ID NO.4.

[0013] The fifth object of the present invention is to provide an engineered bacterium containing the above-mentioned interference vector.

[0014] A sixth object of the present invention is to provide a method for regulating tomato resistance to gray mold, characterized in that it comprises the following steps: The engineered bacteria containing the above expression vector and the engineered bacteria containing the above interference vector are respectively infecting tomato plants, and the transgenic plants are identified as transgenic positive. The positive plants are transplanted to obtain tomato plants with controllable gray mold resistance.

[0015] Compared with the prior art, the present invention has the following beneficial effects: By stably introducing the PAOL gene overexpression vector and RNAi interference vector into tomato plants, the application of the PAOL gene in regulating tomato's resistance to gray mold was confirmed, indicating that the PAOL gene is positively regulating tomato's resistance to gray mold; this discovery provides a new target for the subsequent improvement of tomato varieties and the creation of materials resistant to gray mold. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the expression of the PAOL gene in Example 1 induced by Botrytis cinerea in the Botrytis cinerea-resistant material TS179.

[0017] Figure 2 This is the expression of the PAOL gene in Example 1 induced by Botrytis cinerea in the Botrytis cinerea susceptible material TS47.

[0018] Figure 3 The expression of the PAOL gene in the overexpression plant (PAOL-OE) in Example 4 is shown.

[0019] Figure 4This is the expression of the PAOL gene in RNAi interference plants (PAOL-RNAi) in Example 4.

[0020] Figure 5 The following are the incidence conditions of the three tomato plant seedlings in Example 5.

[0021] Figure 6 The following are the incidence results of the three tomato plant leaves inoculated with gray mold in Example 5.

[0022] Figure 7 The lesion areas of the leaves of the three tomato plants inoculated with gray mold in Example 5 are shown. DETAILED DESCRIPTION

[0023] The present invention will be further described in detail below with reference to specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0024] Example 1 This example provides information on the expression of the PAOL gene induced by Botrytis cinerea in extremely Botrytis cinerea-resistant and Botrytis cinerea-susceptible materials.

[0025] To investigate the involvement of the PAOL gene (sequence shown in SEQ ID NO. 1, and the PAOL gene ORF sequence shown in SEQ ID NO. 5) in tomato defense against gray mold, we tested the expression of the PAOL gene in response to gray mold in the extremely gray mold-resistant accession TS179 (TGRC, Tomato Genetics Resource Center, USA) and the extremely gray mold-susceptible accession TS47 (TGRC, Tomato Genetics Resource Center, USA). The specific procedures were as follows: Four-week-old extremely gray mold-resistant TS179 tomato seedlings and susceptible TS47 tomato seedlings were sprayed with Botrytis cinerea spores. Samples were collected at 0, 24, and 48 hours after inoculation. Total RNA was extracted and reverse transcribed into cDNA. Real-time quantitative PCR was used to detect the expression of the PAOL gene in the gray mold-resistant TS179 (see Figure 1 ) and gray mold susceptible material TS47 (see Figure 2 The results showed that the PAOL gene was greatly induced in the gray mold-resistant TS179 after inoculation with gray mold, while its expression was suppressed in the gray mold-susceptible TS47.

[0026] Example 2 This example provides the construction of transgenic plants overexpressing the PAOL gene.

[0027] The overexpression (OE) vector was constructed primarily using the Gateway method, using the pMV2 vector. First, the gDNA of the PAOL gene was found in the SGN tomato database (https: / / www.sgn.cornell.edu / search / locus). Forward and backward primers were designed upstream of the start codon and downstream of the stop codon (sequences shown in SEQ ID NO. 2), respectively.

[0028] Then, the amplified product was connected to the pEasy-Blunt vector using primers and transformed into E. coli Trans T1 by heat shock method. The clones with correct PCR detection were selected for sequencing. The plasmids of the clones with correct sequences were extracted and double-digested with KpnI and XhoI. Then, the plasmids were connected to the pMV2 vector that had also been double-digested with KpnI and XhoI using T4 ligase and transferred into Trans T1 for PCR detection. Finally, use CaMV35S and a gene-specific reverse primer (the RV sequence in SEQ ID NO. 2) for detection. Select the cells with the correct tape and send them for sequencing. If the sequence matches correctly, then proceed with Agrobacterium electroporation and genetic transformation.

[0029] Among them, SEQ ID NO.2 is as follows: FW: AAAAAGCAGGCTGTGGGAAGGATAGATCTGCGAT; RV: AGAAAGCTGGGT AATGACTTGAGGAAAATAAATAGGC.

[0030] The cultivated tomato variety Ailsa Craig was used as the recipient material and the tomato genetic transformation method mediated by Agrobacterium was used. The specific process is as follows: Tomato seeds were sterilized by shaking in 70% ethanol for 30 seconds, followed by disinfection with 3% sodium hypochlorite for 15 minutes; sown on 1 / 2MS medium and cultured at 25°C under a photoperiod of 16 hours light / 8 hours dark; cotyledons of 7-9 day old seedlings were cut and placed in KCMS medium for pre-culture for 1 day, and the bacterial liquid was activated at the same time; after the bacterial liquid was resuspended in KCMS liquid medium, the explants were placed in it for infection for 4 minutes; after the excess bacterial liquid was absorbed with sterilized filter paper, the explants were returned to KCMS medium and cultured in the dark for 2 days; transferred to screening medium for culture and growth, and subcultured every 15 days; when the regenerated buds grew to a certain size, they were cut and transferred to rooting medium for rooting induction; the rooted transformed plants were transplanted into the substrate for seedling training and finally transferred to the greenhouse for cultivation.

[0031] Example 3 This example provides the construction of PAOL gene RNAi interference transgenic plants.

[0032] The pHGRV vector was selected as the RNAi vector. First, the conserved domain of the gene was found in the SGN tomato database (https: / / www.sgn.cornell.edu / search / locus). A 226-bp interference fragment (sequence shown in SEQ ID NO. 3) was designed, avoiding the conserved domain. The designed sequence was searched through the tomato database, ensuring that only the gene was found, ensuring the accuracy of functional verification.

[0033] Next, a two-round amplification method was used. In the first round, the interference fragment was amplified using the designed primers (sequence shown in SEQ ID NO. 4). In the second round, the amplified product from the first round was used as a template, and primers attB1 and attB2 were used for a new round of amplification. The amplified fragment now has the interference fragment with the recombination site added, ready for vector ligation. The fragment was incubated at 37°C for 30 minutes for homologous recombination ligation. The fragment was then quickly placed in an ice-water mixture for 5 minutes to initiate a heat shock reaction and transform into competent E. coli. The plate was then plated, incubated at 37°C for 14-16 hours, and plaqued.

[0034] Finally, use CaMV35S and the reverse primer for the RNAi vector (RV sequence in SEQ ID NO. 4) for testing. Select the cells with the correct tape and send them for sequencing. If the sequence matches correctly, then proceed with Agrobacterium electroporation and genetic transformation.

[0035] The SEQ ID NO.3 sequence is as follows: CCATCCTTTAGACCCTCTTAGCCCTTCTGAGATCAACAAAATTAGAGTAATTATTCAAAAGTCTCATTTTAGTTCCCTCTCCAATTTAACATTTCACTTTGTTGATCTTGAAGAGCCCAAAAAAGAGGATGTCCTTCATTGGATGTCCTTGCATAAGCATAAACATAAACATGTTGTTTCTCCTTATCGACGAGCCAGGGTAGTGGTTCGTGCAAATAGTGAGACT.

[0036] The specific sequence of SEQ ID NO.4 is as follows: FW: AAAAAGCAGGCT CCATCCTTTAGACCCTCTTAGCC; RV: AGAAAGCTGGGT AGTCTCACTATTTGCACGAACCAC.

[0037] Agrobacterium-mediated tomato genetic transformation method was used, with cultivated tomato Ailsa Craig as the recipient material. The specific experimental process was referred to the transformation method in Example 2 above.

[0038] Example 4 In this example, the relative expression level of the PAOL gene was detected in the plants obtained in Examples 2 and 3 above.

[0039] Genomic DNA from leaves of the T0 generation transgenic plants was extracted using the CTAB method. PCR was then performed using CaMV35s and a gene-specific reverse primer as detection primers, DNA as the template, the expression vector plasmid as the positive control, and a blank system without template as the negative control. Following positive detection, the expression level of the positive plants was determined. Total RNA from leaves of transgenic plants was extracted using Trizol (Novozymes, China) and reverse transcribed into cDNA using the HiScript® II 1st Strand cDNA Synthesis Kit (Novozymes, China), following the kit instructions. After positive detection using β-actin primers, the cDNA concentration was determined using a Nanodrop 2000 and adjusted to approximately 50-100 ng / µL before storage at -20°C.

[0040] The expression of PAOL gene was detected using Roche Light Cycler® 480II fluorescence quantitative PCR instrument (see Figure 3 、 4 The real-time PCR reaction system consisted of 5 μL of SYBR Mix, 0.4 μL of each forward and reverse primer (10 nmol / L), and 4 μL of sample cDNA. The reaction procedure was as follows: 95°C for 30 s, 95°C for 5 s, 56°C for 10 s, and 72°C for 15 s, for a total of 45 cycles (if the melting curve peak time was later than 30 cycles, 10 additional cycles were added), followed by cooling at 40°C for 10 s. Melting curves were then collected and analyzed. Three technical replicates were performed for each sample, and the endogenous tomato actin gene was used as an internal reference.

[0041] Real-time fluorescence quantitative experiments were performed to detect the expression level of PAOL gene. The primer sequences were: FW: AGTCATCGAGCCAGGGATCAGT RV: CCAACATGAAAATCCCAATTAGCC The results of the detection of PAOL gene expression in PAOL overexpressing plants (PAOL-OE) showed that the expression levels of 6 lines were greatly upregulated (see Figure 3The results of the detection of the expression of PAOL gene in the PAOL gene RNAi interference plants (PAOL-RNAi) showed that the expression of 8 lines was down-regulated (see Figure 4 ).

[0042] Example 5 This example further inoculated the positive plants obtained in Examples 2 and 3 above with gray mold to observe the disease occurrence.

[0043] Three-week-old healthy PAOL-OE and PAOL-RNAi tomato seedlings and wild-type tomato seedlings were selected and sprayed with 10 5 spores / mL of B05.10 gray mold spore suspension, sealed and moisturized; place the tomato seedlings sprayed with gray mold spores in an artificial climate chamber at 22°C for 72 hours. Observe the disease status of the tomato seedlings and take photos (see Figure 5 ).

[0044] Depend on Figure 5 It can be seen that: 72 hours after spraying gray mold spores, all plants of the PAOL-RNAi strain became ill and withered; the leaves of the wild-type plants wilted over a large area, and the disease at the growing points was relatively mild; while the PAOL-OE strain only had some lesions on the leaves, and the leaves did not wilt.

[0045] Furthermore, the incidence and lesion area of ​​detached leaves of PAOL-overexpressing plants and RNAi plants inoculated with Botrytis cinerea were observed and counted.

[0046] Take healthy, approximately four-week-old tomato plants, and place detached leaves from PAOL-OE and PAOL-RNAi plants, as well as wild-type controls, on an inoculation tray lined with filter paper, the third and fourth leaves from the growth point. Place the leaves, dorsal side up, on each leaf inoculated with 10µL of a spore suspension of Botrytis cinerea on both sides of the vein. Seal the tray with plastic wrap to maintain moisture. Place the inoculation tray in an artificial climate chamber set at 20°C, 16h light / 8h dark. After 72 hours, observe and photograph the disease (see [see "Inoculation trays for disease"]. Figure 6 ), and the leaf spot area was calculated using a Wanshen leaf area analyzer (see Figure 7 ).

[0047] The results showed that the lesion area of ​​the PAOL-OE strain was significantly smaller than that of the wild type, while the lesion area of ​​the PAOL-RNAi strain was significantly larger than that of the wild type, indicating that PAOL positively regulates tomato resistance to gray mold.

[0048] The raw materials not specifically described in the present invention are all existing materials that can be directly purchased from the market.

[0049] The above is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of tomato PAOL gene in regulating tomato gray mold resistance, characterized in that: The tomato PAOL gene nucleotide sequence is shown in a or b: a: the sequence shown in SEQ ID NO.1; b: The sequence shown in SEQ ID NO.1 is replaced, deleted and / or added with one or more nucleotides and can encode a sequence of a protein having the function of regulating tomato gray mold resistance.

2. The use according to claim 1, characterized in that: The application is specifically embodied in that when the PAOL gene is overexpressed in tomatoes, the resistance of tomatoes to gray mold can be significantly improved; when the expression of the PAOL gene in tomatoes is downregulated, the resistance of tomatoes to gray mold is significantly reduced.

3. An expression vector for expressing the protein encoded by the gene according to claim 1, characterized in that: The expression vector contains the tomato PAOL gene.

4. The expression vector according to claim 3, characterized in that The primers for amplifying the PAOL gene when constructing the expression vector are shown in SEQ ID NO.

2.

5. An engineered bacterium containing the expression vector according to claim 3.

6. An interference vector for interfering with the gene expression of claim 1, characterized in that: The interference vector contains the interference fragment shown in SEQ ID NO.

3.

7. The interference vector according to claim 6, characterized in that: The primers for amplifying the interference fragment when constructing the interference vector are shown in SEQ ID NO.

4.

8. An engineered bacterium containing the interference vector according to claim 6.

9. A method for regulating tomato resistance to gray mold, characterized in that: The following steps are involved: The engineered bacteria described in claim 5 and the engineered bacteria described in claim 8 are respectively infecting tomato plants, and the transgenic plants are identified as transgenic positive, and the positive plants are transplanted to obtain tomato plants with controllable gray mold resistance.

Images